| Title: | Targeted scRNA-seq primer design for TAP-seq |
|---|---|
| Description: | Design primers for targeted single-cell RNA-seq used by TAP-seq. Create sequence templates for target gene panels and design gene-specific primers using Primer3. Potential off-targets can be estimated with BLAST. Requires working installations of Primer3 and BLASTn. |
| Authors: | Andreas R. Gschwind [aut, cre] (ORCID: <https://orcid.org/0000-0002-0769-6907>), Lars Velten [aut] (ORCID: <https://orcid.org/0000-0002-1233-5874>), Lars M. Steinmetz [aut] |
| Maintainer: | Andreas R. Gschwind <[email protected]> |
| License: | MIT + file LICENSE |
| Version: | 1.25.0 |
| Built: | 2026-07-04 07:26:04 UTC |
| Source: | https://github.com/bioc/TAPseq |
A set of functions for getting/setting/modifying the data stored in
TsIO or TsIOList class
objects.
sequence_id(x) sequence_id(x) <- value target_sequence(x) target_sequence(x) <- value beads_oligo(x) beads_oligo(x) <- value reverse_primer(x) reverse_primer(x) <- value target_annot(x) target_annot(x) <- value product_size_range(x) product_size_range(x) <- value primer_num_return(x) primer_num_return(x) <- value min_primer_region(x) min_primer_region(x) <- value primer_opt_tm(x) primer_opt_tm(x) <- value primer_min_tm(x) primer_min_tm(x) <- value primer_max_tm(x) primer_max_tm(x) <- value sequence_template(x) tapseq_primers(x) pcr_products(x)sequence_id(x) sequence_id(x) <- value target_sequence(x) target_sequence(x) <- value beads_oligo(x) beads_oligo(x) <- value reverse_primer(x) reverse_primer(x) <- value target_annot(x) target_annot(x) <- value product_size_range(x) product_size_range(x) <- value primer_num_return(x) primer_num_return(x) <- value min_primer_region(x) min_primer_region(x) <- value primer_opt_tm(x) primer_opt_tm(x) <- value primer_min_tm(x) primer_min_tm(x) <- value primer_max_tm(x) primer_max_tm(x) <- value sequence_template(x) tapseq_primers(x) pcr_products(x)
x |
A |
value |
A valid value to assign to the chosen slot. |
Returns the stored value(s) of a slot, or sets a new value
# chr11 primers example data data("chr11_primers") # slot values of TsIO objects can be accessed using accessor functions tsio <- chr11_primers[[1]] sequence_id(tsio) sequence_id(tsio) <- "Gene1" sequence_id(tsio) # some slots can only be obtained, but not set as filling these is part of the TAPseq workflow tapseq_primers(tsio) pcr_products(tsio) # sequence templates can be created sequence_template(tsio) # values of TsIOList object slots can be extracted as well, but not set tsio_list <- chr11_primers[1:2] sequence_id(tsio_list) target_sequence(tsio_list) target_annot(tsio_list) tapseq_primers(tsio_list) pcr_products(tsio_list) sequence_template(tsio_list)# chr11 primers example data data("chr11_primers") # slot values of TsIO objects can be accessed using accessor functions tsio <- chr11_primers[[1]] sequence_id(tsio) sequence_id(tsio) <- "Gene1" sequence_id(tsio) # some slots can only be obtained, but not set as filling these is part of the TAPseq workflow tapseq_primers(tsio) pcr_products(tsio) # sequence templates can be created sequence_template(tsio) # values of TsIOList object slots can be extracted as well, but not set tsio_list <- chr11_primers[1:2] sequence_id(tsio_list) target_sequence(tsio_list) target_annot(tsio_list) tapseq_primers(tsio_list) pcr_products(tsio_list) sequence_template(tsio_list)
Subset of a 10x mouse bone marrow dataset taken from Baccin et al., 2019 (https://www.nature.com/articles/s41556-019-0439-6). Contains gene expression and cell type data for 362 cells.
bone_marrow_genexbone_marrow_genex
object of Seurat class.
Check a TAP-seq primer set, i.e. outer or inner primers for a target gene panel, for potential
complementarity issues when multiplexing. Uses Primer3's check_primers functionality.
checkPrimers( object, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIO' checkPrimers( object, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIOList' checkPrimers( object, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") )checkPrimers( object, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIO' checkPrimers( object, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIOList' checkPrimers( object, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") )
object |
|
primer_opt_tm, primer_min_tm, primer_max_tm
|
Optimal, minumum and maximum primer melting temperature. Should be the same values that were used when designing the primers. |
thermo_params_path |
Optional path (character) to the |
primer3_core |
Path (character) to the |
A data.frame with check_primers results.
checkPrimers(TsIO): Check primers from TsIO objects.
checkPrimers(TsIOList): Check primers from TsIOList objects.
http://primer3.org/manual.html for Primer3 manual.
library(ggplot2) # chr11 primers example data data("chr11_primers") # pick best primers based on predicted off-targets for subset of all primers best_primers <- pickPrimers(chr11_primers, n = 1, by = "off_targets") # check for complementarity ## Not run: comp <- checkPrimers(best_primers) # plot complementarity scores for every pair. the lines indicate complementarity scores of 47, # the default value applied by Primer3 to identify high complementarity primer pairs ggplot(comp, aes(x = primer_pair_compl_any_th, y = primer_pair_compl_end_th)) + geom_hline(aes(yintercept = 47), colour = "darkgray", linetype = "dashed") + geom_vline(aes(xintercept = 47), colour = "darkgray", linetype = "dashed") + geom_point(alpha = 0.25) + theme_bw() ## End(Not run)library(ggplot2) # chr11 primers example data data("chr11_primers") # pick best primers based on predicted off-targets for subset of all primers best_primers <- pickPrimers(chr11_primers, n = 1, by = "off_targets") # check for complementarity ## Not run: comp <- checkPrimers(best_primers) # plot complementarity scores for every pair. the lines indicate complementarity scores of 47, # the default value applied by Primer3 to identify high complementarity primer pairs ggplot(comp, aes(x = primer_pair_compl_any_th, y = primer_pair_compl_end_th)) + geom_hline(aes(yintercept = 47), colour = "darkgray", linetype = "dashed") + geom_vline(aes(xintercept = 47), colour = "darkgray", linetype = "dashed") + geom_point(alpha = 0.25) + theme_bw() ## End(Not run)
GENCODE exon annotations of all protein-coding genes within a genomic region on human chromosome 11.
chr11_geneschr11_genes
object of GRanges class.
Example polyadenylation sites for expressed protein-coding genes within human chromosome 11
genomic region. This dataset was created using inferPolyASites on available
K562 Drop-seq data. In a real-world application these sites would have to be pruned manually
before further use.
chr11_polyA_siteschr11_polyA_sites
object of GRanges class.
Example of a TsIOList object containing input and output for
chromosome 11 genes primer design.
chr11_primerschr11_primers
object of TsIOList class.
Annotations of target gene transcripts within human chromosome 11 region that were truncated at
inferred polyA sites using truncateTxsPolyA.
chr11_truncated_txschr11_truncated_txs
object of GRangesList class.
Sequences of truncated transcripts within human chromosome 11 region that were extracted using
getTxsSeq.
chr11_truncated_txs_seqchr11_truncated_txs_seq
object of DNAStringSet class.
Takes a TsIO or TsIOList
object and converts it into a boulder IO record for Primer3. Essentially it converts it into a
list of character vectors that each contain the tag and the value in the form: "TAG=VALUE". More
on this format can be found in the Primer3 manual.
createIORecord(object, thermo_params_path = NA) ## S4 method for signature 'TsIO' createIORecord(object, thermo_params_path = NA) ## S4 method for signature 'TsIOList' createIORecord(object, thermo_params_path = NA)createIORecord(object, thermo_params_path = NA) ## S4 method for signature 'TsIO' createIORecord(object, thermo_params_path = NA) ## S4 method for signature 'TsIOList' createIORecord(object, thermo_params_path = NA)
object |
TsIO of TsIOList object for which a Primer3 boulder IO record should be created. |
thermo_params_path |
Optional path (character) to the |
This function is usually not needed by the user, because functions such as
designPrimers handle IO record generation. However, this function can for
instance be useful to generate IO records, write them to a file and pass them to Primer3 in the
conventional way.
A character vector containing the lines of the IO record.
createIORecord(TsIO): Create IO record from TsIO objects.
createIORecord(TsIOList): Create IO record from TsIO objects.
http://primer3.org/manual.html for Primer3 manual.
# chromosome 11 truncated transcript sequences data("chr11_truncated_txs_seq") # create TsIOList object for primer desing from sequence templates obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500)) # create boulder IO record boulder_io <- createIORecord(obj) head(boulder_io, 11)# chromosome 11 truncated transcript sequences data("chr11_truncated_txs_seq") # create TsIOList object for primer desing from sequence templates obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500)) # create boulder IO record boulder_io <- createIORecord(obj) head(boulder_io, 11)
Design primers based on TsIO or
TsIOList objects. Creates boulder-IO records, passes input
to Primer3 and parses the output.
designPrimers( object, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIO' designPrimers( object, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIOList' designPrimers( object, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") )designPrimers( object, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIO' designPrimers( object, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") ) ## S4 method for signature 'TsIOList' designPrimers( object, thermo_params_path = NA, primer3_core = getOption("TAPseq.primer3_core") )
object |
|
thermo_params_path |
Optional path (character) to the |
primer3_core |
Path (character) to the |
A new TsIO or
TsIOList object containing Primer3 output.
designPrimers(TsIO): Design primers using Primer3 from a TsIO object
designPrimers(TsIOList): Design primers using Primer3 from a TsIOList object
http://primer3.org/manual.html for Primer3 manual and TsIO for TsIO class objects.
# chromosome 11 truncated transcript sequences and annotations data("chr11_truncated_txs_seq") # create TsIOList object for the first two sequence templates tapseq_io <- TAPseqInput(chr11_truncated_txs_seq[1:2], product_size_range = c(350, 500)) # design primers ## Not run: tapseq_io <- designPrimers(tapseq_io) ## End(Not run) # designed primers are stored in the tapseq_primers slot tapseq_primers(tapseq_io)# chromosome 11 truncated transcript sequences and annotations data("chr11_truncated_txs_seq") # create TsIOList object for the first two sequence templates tapseq_io <- TAPseqInput(chr11_truncated_txs_seq[1:2], product_size_range = c(350, 500)) # design primers ## Not run: tapseq_io <- designPrimers(tapseq_io) ## End(Not run) # designed primers are stored in the tapseq_primers slot tapseq_primers(tapseq_io)
Functions to use BLAST to align TAP-seq primers against a genome and chromosome reference to estimate potential off-target binding sites.
createBLASTDb( genome, annot, blastdb, standard_chromosomes = TRUE, tx_id = "transcript_id", tx_name = "transcript_name", gene_name = "gene_name", gene_id = "gene_id", title = "TAP-seq_GT_DB", verbose = FALSE, makeblastdb = getOption("TAPseq.makeblastdb") ) blastPrimers( object, blastdb, max_mismatch = 0, min_aligned = 0.75, primer_targets = c("transcript_id", "transcript_name", "gene_id", "gene_name"), tmpdir = tempdir(), blastn = getOption("TAPseq.blastn") ) ## S4 method for signature 'TsIO' blastPrimers( object, blastdb, max_mismatch = 0, min_aligned = 0.75, primer_targets = c("transcript_id", "transcript_name", "gene_id", "gene_name"), tmpdir = tempdir(), blastn = getOption("TAPseq.blastn") ) ## S4 method for signature 'TsIOList' blastPrimers( object, blastdb, max_mismatch = 0, min_aligned = 0.75, primer_targets = c("transcript_id", "transcript_name", "gene_id", "gene_name"), tmpdir = tempdir(), blastn = getOption("TAPseq.blastn") )createBLASTDb( genome, annot, blastdb, standard_chromosomes = TRUE, tx_id = "transcript_id", tx_name = "transcript_name", gene_name = "gene_name", gene_id = "gene_id", title = "TAP-seq_GT_DB", verbose = FALSE, makeblastdb = getOption("TAPseq.makeblastdb") ) blastPrimers( object, blastdb, max_mismatch = 0, min_aligned = 0.75, primer_targets = c("transcript_id", "transcript_name", "gene_id", "gene_name"), tmpdir = tempdir(), blastn = getOption("TAPseq.blastn") ) ## S4 method for signature 'TsIO' blastPrimers( object, blastdb, max_mismatch = 0, min_aligned = 0.75, primer_targets = c("transcript_id", "transcript_name", "gene_id", "gene_name"), tmpdir = tempdir(), blastn = getOption("TAPseq.blastn") ) ## S4 method for signature 'TsIOList' blastPrimers( object, blastdb, max_mismatch = 0, min_aligned = 0.75, primer_targets = c("transcript_id", "transcript_name", "gene_id", "gene_name"), tmpdir = tempdir(), blastn = getOption("TAPseq.blastn") )
genome |
A |
annot |
A |
blastdb |
TAP-seq BLAST database created with
|
standard_chromosomes |
(logical) Specifies whether only standard chromosomes should be included in output genome sequences (e.g. chr1-22, chrX, chrY, chrM for homo sapiens). |
tx_id, tx_name, gene_name, gene_id
|
(character) Column names in annot metadata containing transcript id, transcript name, gene name and gene id information. |
title |
Optional title for BLAST database. |
verbose |
(logical) If |
makeblastdb |
Path to the |
object |
|
max_mismatch |
Maximum number of mismatches allowed for off-target hits (default: 0). |
min_aligned |
Minimum portion of the primer sequence starting from the 3' end that must align for off-target hits (default: 0.75). |
primer_targets |
Specifies what should be used to identify primer targets for off-target
identification. I.e. to what does the |
tmpdir |
Directory needed to store temporary files. |
blastn |
Path (character) to the |
createBLASTDb creates a BLAST database containing genome and transcriptome sequences,
which is required by blastPrimers. The created database contains both sequence files for
BLAST and annotations to process the results.
Use blastPrimers to align designed TAP-seq primers against the created database to
estimate off-target priming potential. Only hits where at least a specified portion of the
sequence involving the 3' end of the primer aligns with not more than a certain number of
mismatches are considered.
blastPrimers counts the number of genes in which a primer has 1) exonic hits or 2)
intronic hits, or 3) the number of hits in intergenic regions of the genome. The exonic and
intronic counts should be interptreted as: "In how many genes does a primer have exonic
(or intronic) hits?".
If a BLAST hit falls in both intronic and exonic regions of a given gene (i.e. exonic for one transcript, intronic for another transcript), only the exonic hit is counted for that gene. If a primer has for instance 3 BLAST hits in one gene, 2 exonic and 1 intronic, then one exonic hit and one intronic hit is counted for that gene.
If sequence IDs of the designed primers (sequence_id) refer to
the target gene/transcripts and can be found in the BLAST database annotations via
primer_targets, then only off-target hits are counted. This is usually the case if input
for primer design was produced from target gene annotations.
For createBLASTDb a directory containing the BLAST database. For
blastPrimers a TsIO or
TsIOList object with the number of potential off-targets
added to the TAP-seq primer metadata.
createBLASTDb(): Create a genome and transcriptome TAP-seq BLAST database
blastPrimers(TsIO): BLAST primers in a TsIO object
blastPrimers(TsIOList): BLAST primers in a TsIOList object
## Not run: library(BSgenome) # human genome (hg38) BSgenome object hg38 <- getBSgenome("BSgenome.Hsapiens.UCSC.hg38") # get annotations for BLAST annot_url <- paste0("ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_32/", "gencode.v32.annotation.gtf.gz") annot <- import(annot_url, format = "gtf") blast_exons <- annot[annot$type == "exon" & annot$gene_type == "protein_coding"] # build BLAST database blastdb <- file.path(tempdir(), "blastdb") createBLASTDb(genome = hg38, annot = blast_exons, blastdb = blastdb) # chr11 primers example data (already contains off-targets, but we can overwrite them) data("chr11_primers") chr11_primers <- chr11_primers[1:3] # only use a small subset for this example # run blast to identify potential off-targets chr11_primers <- blastPrimers(chr11_primers, blastdb = blastdb) tapseq_primers(chr11_primers) # allow 1 mismatch between primer and off-target chr11_primers <- blastPrimers(chr11_primers, blastdb = blastdb, max_mismatch = 1) tapseq_primers(chr11_primers) ## End(Not run)## Not run: library(BSgenome) # human genome (hg38) BSgenome object hg38 <- getBSgenome("BSgenome.Hsapiens.UCSC.hg38") # get annotations for BLAST annot_url <- paste0("ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_32/", "gencode.v32.annotation.gtf.gz") annot <- import(annot_url, format = "gtf") blast_exons <- annot[annot$type == "exon" & annot$gene_type == "protein_coding"] # build BLAST database blastdb <- file.path(tempdir(), "blastdb") createBLASTDb(genome = hg38, annot = blast_exons, blastdb = blastdb) # chr11 primers example data (already contains off-targets, but we can overwrite them) data("chr11_primers") chr11_primers <- chr11_primers[1:3] # only use a small subset for this example # run blast to identify potential off-targets chr11_primers <- blastPrimers(chr11_primers, blastdb = blastdb) tapseq_primers(chr11_primers) # allow 1 mismatch between primer and off-target chr11_primers <- blastPrimers(chr11_primers, blastdb = blastdb, max_mismatch = 1) tapseq_primers(chr11_primers) ## End(Not run)
A set of functions for TAP-seq primer export. Convert primers stored in
TsIO or TsIOList objects to
a simple data.frame for easier export. Or create BED format tracks for
primers and write them to files for viewing in a genome browser (e.g. IGV).
createPrimerTrack(object, color = 1) ## S4 method for signature 'TsIO' createPrimerTrack(object, color = 1) ## S4 method for signature 'TsIOList' createPrimerTrack(object, color = 1) exportPrimerTrack(..., con) primerDataFrame(object) ## S4 method for signature 'TsIO' primerDataFrame(object) ## S4 method for signature 'TsIOList' primerDataFrame(object)createPrimerTrack(object, color = 1) ## S4 method for signature 'TsIO' createPrimerTrack(object, color = 1) ## S4 method for signature 'TsIOList' createPrimerTrack(object, color = 1) exportPrimerTrack(..., con) primerDataFrame(object) ## S4 method for signature 'TsIO' primerDataFrame(object) ## S4 method for signature 'TsIOList' primerDataFrame(object)
object |
|
color |
Color used for the track (Default: black). Can be any of the three kinds of R color specifications. |
... |
One or more primer BED tracks created by
|
con |
Connection to which tracks are written. Typically a .bed file. |
For createPrimerTrack a data.frame with the primer track in
BED format.
createPrimerTrack(TsIO): Create primer BED track from TsIO objects
createPrimerTrack(TsIOList): Create primer BED track from TsIOList objects
exportPrimerTrack(): Export primer BED tracks files
primerDataFrame(TsIO): Create a data.frame with primer data from TsIO
primerDataFrame(TsIOList): Create a data.frame with primer data from TsIOList
# chr11 primers example data data("chr11_primers") # pick best primers based on predicted off-targets best_primers <- pickPrimers(chr11_primers, n = 1, by = "off_targets") # primers data can be exported to a simple data.frame to e.g. write them to a .csv file primers_df <- primerDataFrame(best_primers) head(primers_df) # primer binding sites in transcript sequences can be converted to genomic coordinates to create # a BED track to visualize primers in a genome browser (e.g. IGV) # create primer BED track with a fancy color track <- createPrimerTrack(best_primers[1:5], color = "steelblue3") # tracks can be written to .bed files using a little helper function (replace con = "" by a file) exportPrimerTrack(track, con = "") ## Not run: # one can easily export primer tracks for multiple TsIO or TsIOList objects (e.g. inner and # outer nested primers) to one .bed file using different colors for each object. see vignette for # a practical example: vignette("tapseq_primer_design", package = "TAPseq") obj1 <- best_primers[1:5] obj2 <- best_primers[6:10] exportPrimerTrack(createPrimerTrack(obj1, color = "steelblue3"), createPrimerTrack(obj2, color = "goldenrod1"), con = "path/to/file.bed") ## End(Not run)# chr11 primers example data data("chr11_primers") # pick best primers based on predicted off-targets best_primers <- pickPrimers(chr11_primers, n = 1, by = "off_targets") # primers data can be exported to a simple data.frame to e.g. write them to a .csv file primers_df <- primerDataFrame(best_primers) head(primers_df) # primer binding sites in transcript sequences can be converted to genomic coordinates to create # a BED track to visualize primers in a genome browser (e.g. IGV) # create primer BED track with a fancy color track <- createPrimerTrack(best_primers[1:5], color = "steelblue3") # tracks can be written to .bed files using a little helper function (replace con = "" by a file) exportPrimerTrack(track, con = "") ## Not run: # one can easily export primer tracks for multiple TsIO or TsIOList objects (e.g. inner and # outer nested primers) to one .bed file using different colors for each object. see vignette for # a practical example: vignette("tapseq_primer_design", package = "TAPseq") obj1 <- best_primers[1:5] obj2 <- best_primers[6:10] exportPrimerTrack(createPrimerTrack(obj1, color = "steelblue3"), createPrimerTrack(obj2, color = "goldenrod1"), con = "path/to/file.bed") ## End(Not run)
Extract the DNA sequences of all exons of transcript models and concatenate to one sequence per
transcript. This is basically a wrapper for extractTranscriptSeqs,
which makes sure that the exons are correctly sorted according to their position in the
transcript (3' to 5').
getTxsSeq(transcripts, genome) ## S4 method for signature 'GRangesList' getTxsSeq(transcripts, genome) ## S4 method for signature 'GRanges' getTxsSeq(transcripts, genome)getTxsSeq(transcripts, genome) ## S4 method for signature 'GRangesList' getTxsSeq(transcripts, genome) ## S4 method for signature 'GRanges' getTxsSeq(transcripts, genome)
transcripts |
A |
genome |
A |
A DNAString or
DNAStringSet object containing the transcript
sequence(s).
getTxsSeq(GRangesList): Obtain transcript sequence from GRangesList input
getTxsSeq(GRanges): Obtain transcript sequence from GRanges input
library(BSgenome) # protein-coding exons of transcripts within chr11 region data("chr11_genes") target_txs <- split(chr11_genes, f = chr11_genes$transcript_id) # human genome (hg38) BSgenome object (needs to be installed separately from Bioconductor) hg38 <- getBSgenome("BSgenome.Hsapiens.UCSC.hg38") # get sequences for all target transcripts on chr11 txs_seqs <- getTxsSeq(target_txs, genome = hg38)library(BSgenome) # protein-coding exons of transcripts within chr11 region data("chr11_genes") target_txs <- split(chr11_genes, f = chr11_genes$transcript_id) # human genome (hg38) BSgenome object (needs to be installed separately from Bioconductor) hg38 <- getBSgenome("BSgenome.Hsapiens.UCSC.hg38") # get sequences for all target transcripts on chr11 txs_seqs <- getTxsSeq(target_txs, genome = hg38)
Infer polyA sites from 10X, Drop-seq or similar 3' enriched sequencing data. Simple function that looks for peaks in read coverage to estimate potential polyA sites. Default parameters are chosen because they work reasonably well with the example data, but they should typically be empirically selected by verifying the output.
inferPolyASites( genes, bam, polyA_downstream = 100, min_cvrg = 0, wdsize = 200, by = 1, extend_downstream = 0, perc_threshold = 0.9, parallel = FALSE )inferPolyASites( genes, bam, polyA_downstream = 100, min_cvrg = 0, wdsize = 200, by = 1, extend_downstream = 0, perc_threshold = 0.9, parallel = FALSE )
genes |
|
bam |
Path to .bam file containing aligned reads used for polyA site estimation. |
polyA_downstream |
(numeric) How far downstream of a peak in coverage are polyA sites expected? Somewhat depends on input DNA fragment size. (default: 100). Importantly, this value should not be larger than half of the window size (wdsize), else polyA sites might be moved outside of the transcripts, even if they were extended using the extend_downstream parameter. |
min_cvrg |
(numeric) Minimal coverage for peaks to be considered for polyA site estimation (default: 0). |
wdsize |
(numeric) Window size to estimate sequencing coverage along transcripts (default: 200). |
by |
(numeric) Steps in basepairs in which the sliding window should be moved along transcripts to estimate smooth coverage (default: 1). |
extend_downstream |
(numeric) To which amount should transcript annotations be extended downstream when estimating polyA sites (default: 0). A reasonable value (e.g. 100-200 bp) allows to account for polyA sites that fall a few basepairs downstream of terminal exons. |
perc_threshold |
(numeric) Only sequencing coverage peaks within |
parallel |
(logical) Triggers parallel computing using the
|
A GRanges object containing coordinates of
estimated polyadenylation sites.
library(GenomicRanges) # protein-coding exons of genes within chr11 region data("chr11_genes") target_genes <- split(chr11_genes, f = chr11_genes$gene_name) # subset of target genes for quick example target_genes <- target_genes[18:27] # bam file containing aligned Drop-seq reads dropseq_bam <- system.file("extdata", "chr11_k562_dropseq.bam", package = "TAPseq") # infer polyA sites for all target genes with adjusted parameters. parameter values depend on the # input data and at this stage it's best to try different settings and check the results polyA_sites <- inferPolyASites(target_genes, bam = dropseq_bam, polyA_downstream = 50, wdsize = 100, min_cvrg = 1, parallel = TRUE)library(GenomicRanges) # protein-coding exons of genes within chr11 region data("chr11_genes") target_genes <- split(chr11_genes, f = chr11_genes$gene_name) # subset of target genes for quick example target_genes <- target_genes[18:27] # bam file containing aligned Drop-seq reads dropseq_bam <- system.file("extdata", "chr11_k562_dropseq.bam", package = "TAPseq") # infer polyA sites for all target genes with adjusted parameters. parameter values depend on the # input data and at this stage it's best to try different settings and check the results polyA_sites <- inferPolyASites(target_genes, bam = dropseq_bam, polyA_downstream = 50, wdsize = 100, min_cvrg = 1, parallel = TRUE)
Pick based primers from designed primers for every target based on Primer3 penalty score or
off-target priming estimated with blastPrimers.
pickPrimers(object, n = 1, by = c("penalty", "off_targets")) ## S4 method for signature 'TsIO' pickPrimers(object, n = 1, by = c("penalty", "off_targets")) ## S4 method for signature 'TsIOList' pickPrimers(object, n = 1, by = c("penalty", "off_targets"))pickPrimers(object, n = 1, by = c("penalty", "off_targets")) ## S4 method for signature 'TsIO' pickPrimers(object, n = 1, by = c("penalty", "off_targets")) ## S4 method for signature 'TsIOList' pickPrimers(object, n = 1, by = c("penalty", "off_targets"))
object |
|
n |
The number of top primers to pick (default: 1, which returns the best primer). |
by |
Attribute by which primers should be picked. Can be either |
If by is set to off_targets top primers are picked based on the lowest number of
exonic, intronic and intergenic off-targets (in that priority).
A TsIO or TsIOList
object containing the picked primers.
pickPrimers(TsIO): Pick best primers in a TsIO object
pickPrimers(TsIOList): Pick best primers per target in a TsIOList object
# chr11 primers examples data("chr11_primers") # pick the best primer per gene based on the fewest exonic, intronic and intergenic off-targets # (in that order) best_primers <- pickPrimers(chr11_primers, by = "off_targets") tapseq_primers(best_primers) # pick the best two primers per gene based on the lowest penalty score computed by Primer3 best_primers <- pickPrimers(chr11_primers, n = 2, by = "penalty") tapseq_primers(best_primers)# chr11 primers examples data("chr11_primers") # pick the best primer per gene based on the fewest exonic, intronic and intergenic off-targets # (in that order) best_primers <- pickPrimers(chr11_primers, by = "off_targets") tapseq_primers(best_primers) # pick the best two primers per gene based on the lowest penalty score computed by Primer3 best_primers <- pickPrimers(chr11_primers, n = 2, by = "penalty") tapseq_primers(best_primers)
Select target genes that serve as markers for cell populations using a linear model with lasso regularization. How well a selected set of target genes discriminates between cell populations can be assessed in an intuitive way using UMAP visualization.
selectTargetGenes(object, targets = NULL, expr_percentile = c(0.6, 0.99)) plotTargetGenes(object, target_genes, npcs = 15)selectTargetGenes(object, targets = NULL, expr_percentile = c(0.6, 0.99)) plotTargetGenes(object, target_genes, npcs = 15)
object |
Seurat object containing single-cell RNA-seq data from which best marker genes for different cell populations should be learned. Needs to contain population identities for all cell. |
targets |
Desired number of target genes. Approximately this many target genes will be returned. If set to NULL, the optimal number of target genes will be estimated using a cross-valdation approach. Warning: The number of target genes might end up being very large! |
expr_percentile |
Expression percentiles that candidate target genes need to fall into. Default is 60% to 99%, which excludes bottom 60% and top 1% expressed genes from markers. |
target_genes |
(character) Target gene names. |
npcs |
(integer) Number of principal components to use for UMAP. |
A character vector containing selected target gene identifiers.
library(Seurat) # example of mouse bone marrow 10x gene expression data data("bone_marrow_genex") # identify approximately 100 target genes that can be used to identify cell populations target_genes <- selectTargetGenes(bone_marrow_genex, targets = 100) # automatically identify the number of target genes to best identify cell populations using # cross-validation. caution: this can lead to very large target gene panels! target_genes_cv <- selectTargetGenes(bone_marrow_genex) # create UMAP plots to compare cell type identification based on full dataset and selected 100 # target genes plotTargetGenes(bone_marrow_genex, target_genes = target_genes)library(Seurat) # example of mouse bone marrow 10x gene expression data data("bone_marrow_genex") # identify approximately 100 target genes that can be used to identify cell populations target_genes <- selectTargetGenes(bone_marrow_genex, targets = 100) # automatically identify the number of target genes to best identify cell populations using # cross-validation. caution: this can lead to very large target gene panels! target_genes_cv <- selectTargetGenes(bone_marrow_genex) # create UMAP plots to compare cell type identification based on full dataset and selected 100 # target genes plotTargetGenes(bone_marrow_genex, target_genes = target_genes)
This package provides functions to select transcript isoforms and design PCR primers for TAP-seq.
In order to use the full functionality, Primer3 and BLAST need to be installed and added to PATH.
Furthermore, the primer3_config directory containing important files for Primer3 should be
located in the same directory as the primer3_core executable. If this is not practical,
all functions interacting with Primer3 have arguments to specify the paths to these files.
For more information on installation see: https://github.com/argschwind/TAPseq.
This function creates input for TAP-seq primer design from a DNAStringSet containing the target sequences (typically transcript sequences).
TAPseqInput( target_sequences, product_size_range, beads_oligo = NA, reverse_primer = "CTACACGACGCTCTTCCGATCT", target_annot = NULL, primer_num_return = 5, min_primer_region = 100, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66 )TAPseqInput( target_sequences, product_size_range, beads_oligo = NA, reverse_primer = "CTACACGACGCTCTTCCGATCT", target_annot = NULL, primer_num_return = 5, min_primer_region = 100, primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66 )
target_sequences |
A named |
product_size_range |
Numerical vector of length 2 specifying the desired length of the resulting amplicons. |
beads_oligo |
Beads-oligo-dT sequence for the used droplet sequencing protocol (10x,
Drop-seq). If nothing is specified ( |
reverse_primer |
Reverse primer sequence used for all PCR reactions. Default is the 10x
primer sequence: |
target_annot |
(optional) A named |
primer_num_return |
How many forward primers should be designed? (default: 5) |
min_primer_region |
Minimum sequence length required for primer design. Mostly relevant in
case a sequence template is too short to allow the specified |
primer_opt_tm, primer_min_tm, primer_max_tm
|
Optimal, minumum and maximum primer melting temperature. Set to NA to use Primer3s default values. |
TsIOList object.
# chromosome 11 truncated transcript sequences and annotations data("chr11_truncated_txs_seq") # create TsIOList object for primer design from target sequences obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500)) obj # transcript annotations can be added for optional genome browser tracks of designed primers data("chr11_truncated_txs") obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500), target_annot = chr11_truncated_txs) # create input for primer design with Drop-seq instead of default 10x ds_oligo <- "TTTTTTTAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" ds_rev_primer <- "AAGCAGTGGTATCAACGCAGAGT" ds_obj <- TAPseqInput(chr11_truncated_txs_seq, beads_oligo = ds_oligo, reverse_primer = ds_rev_primer, product_size_range = c(350, 500), primer_opt_tm = 62, primer_min_tm = 57, primer_max_tm = 65)# chromosome 11 truncated transcript sequences and annotations data("chr11_truncated_txs_seq") # create TsIOList object for primer design from target sequences obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500)) obj # transcript annotations can be added for optional genome browser tracks of designed primers data("chr11_truncated_txs") obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500), target_annot = chr11_truncated_txs) # create input for primer design with Drop-seq instead of default 10x ds_oligo <- "TTTTTTTAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" ds_rev_primer <- "AAGCAGTGGTATCAACGCAGAGT" ds_obj <- TAPseqInput(chr11_truncated_txs_seq, beads_oligo = ds_oligo, reverse_primer = ds_rev_primer, product_size_range = c(350, 500), primer_opt_tm = 62, primer_min_tm = 57, primer_max_tm = 65)
Truncate transcripts at overlapping polyadenylation (polyA) sites to infer likely 3' ends of transcripts. This is crucial to correctly design TAP-seq primers that amplify fragments of specific lengths. Typically the exons of all annotated transcripts per target gene are provided as input. If a polyA site overlaps a single transcript of a given gene, this transcript is truncated and returned. In case a polyA site overlaps multiple transcripts of the same gene, a "metatranscript" consisting of all annotated exons of the overlapping transcripts is generated and truncated. No statements about expressed transcripts can be made if no overlapping polyA sites are found for any transcripts of a gene. In that case a "meta transcript" consisting of the merged exons of that gene is generated and returned.
truncateTxsPolyA( transcripts, polyA_sites, extend_3prime_end = 0, polyA_select = c("downstream", "upstream", "score"), transcript_id = "transcript_id", gene_id = "gene_id", exon_number = "exon_number", ignore_strand = FALSE, parallel = FALSE ) ## S4 method for signature 'GRanges' truncateTxsPolyA( transcripts, polyA_sites, extend_3prime_end = 0, polyA_select = c("downstream", "upstream", "score"), transcript_id = "transcript_id", gene_id = "gene_id", exon_number = "exon_number", ignore_strand = FALSE, parallel = FALSE ) ## S4 method for signature 'GRangesList' truncateTxsPolyA( transcripts, polyA_sites, extend_3prime_end = 0, polyA_select = c("downstream", "upstream", "score"), transcript_id = "transcript_id", gene_id = "gene_id", exon_number = "exon_number", ignore_strand = FALSE, parallel = FALSE )truncateTxsPolyA( transcripts, polyA_sites, extend_3prime_end = 0, polyA_select = c("downstream", "upstream", "score"), transcript_id = "transcript_id", gene_id = "gene_id", exon_number = "exon_number", ignore_strand = FALSE, parallel = FALSE ) ## S4 method for signature 'GRanges' truncateTxsPolyA( transcripts, polyA_sites, extend_3prime_end = 0, polyA_select = c("downstream", "upstream", "score"), transcript_id = "transcript_id", gene_id = "gene_id", exon_number = "exon_number", ignore_strand = FALSE, parallel = FALSE ) ## S4 method for signature 'GRangesList' truncateTxsPolyA( transcripts, polyA_sites, extend_3prime_end = 0, polyA_select = c("downstream", "upstream", "score"), transcript_id = "transcript_id", gene_id = "gene_id", exon_number = "exon_number", ignore_strand = FALSE, parallel = FALSE )
transcripts |
A |
polyA_sites |
A |
extend_3prime_end |
Specifies how far (bp) 3' ends of transcripts should be extended when looking for overlapping polyA sites (default = 0). This enables capturing of polyA sites that occur downstream of annotated 3' ends. |
polyA_select |
Specifies which heuristic should be used to select the polyA site used to
truncate the transcripts if multiple overlapping polyA sites are found. By default
|
transcript_id |
(character) Name of the column in the metadata of |
gene_id, exon_number
|
(character) Optional names of columns in metadata of
|
ignore_strand |
(logical) Specifies whether the strand of polyA sites should be ignored when
looking for overlapping polyA sites. Default is |
parallel |
(logical) Triggers parallel computing using the |
Either a GRanges or
GRangesList object containing the truncated
transcripts.
truncateTxsPolyA(GRanges): Truncate transcripts of one gene provided as GRanges object
truncateTxsPolyA(GRangesList): Truncate transcripts of multiple genes provided as
GRangesList
library(GenomicRanges) # protein-coding exons of genes within chr11 region data("chr11_genes") target_genes <- split(chr11_genes, f = chr11_genes$gene_name) # only retain first 2 target genes, because truncating transcripts is currently computationally # quite costly. try using BiocParallel for parallelization (see ?truncateTxsPolyA). target_genes <- target_genes[1:2] # example polyA sites for these genes data("chr11_polyA_sites") # truncate target genes at most downstream polyA site (default) truncated_txs <- truncateTxsPolyA(target_genes, polyA_sites = chr11_polyA_sites) # change polyA selection to "score" (read coverage of polyA sites) and extend 3' end of target # genes by 50 bp (see ?truncateTxsPolyA). truncated_txs <- truncateTxsPolyA(target_genes, polyA_sites = chr11_polyA_sites, polyA_select = "score", extend_3prime_end = 50)library(GenomicRanges) # protein-coding exons of genes within chr11 region data("chr11_genes") target_genes <- split(chr11_genes, f = chr11_genes$gene_name) # only retain first 2 target genes, because truncating transcripts is currently computationally # quite costly. try using BiocParallel for parallelization (see ?truncateTxsPolyA). target_genes <- target_genes[1:2] # example polyA sites for these genes data("chr11_polyA_sites") # truncate target genes at most downstream polyA site (default) truncated_txs <- truncateTxsPolyA(target_genes, polyA_sites = chr11_polyA_sites) # change polyA selection to "score" (read coverage of polyA sites) and extend 3' end of target # genes by 50 bp (see ?truncateTxsPolyA). truncated_txs <- truncateTxsPolyA(target_genes, polyA_sites = chr11_polyA_sites, polyA_select = "score", extend_3prime_end = 50)
TsIO objects store TAP-seq Primer3 input and output.
TsIO( sequence_id, target_sequence, beads_oligo, reverse_primer, product_size_range, target_annot = NULL, primer_num_return = 5, min_primer_region = 100, primer_opt_tm = NA, primer_min_tm = NA, primer_max_tm = NA ) ## S4 method for signature 'TsIO' sequence_id(x) ## S4 replacement method for signature 'TsIO' sequence_id(x) <- value ## S4 method for signature 'TsIO' target_sequence(x) ## S4 replacement method for signature 'TsIO' target_sequence(x) <- value ## S4 method for signature 'TsIO' beads_oligo(x) ## S4 replacement method for signature 'TsIO' beads_oligo(x) <- value ## S4 method for signature 'TsIO' reverse_primer(x) ## S4 replacement method for signature 'TsIO' reverse_primer(x) <- value ## S4 method for signature 'TsIO' target_annot(x) ## S4 replacement method for signature 'TsIO' target_annot(x) <- value ## S4 method for signature 'TsIO' product_size_range(x) ## S4 replacement method for signature 'TsIO' product_size_range(x) <- value ## S4 method for signature 'TsIO' primer_num_return(x) ## S4 replacement method for signature 'TsIO' primer_num_return(x) <- value ## S4 method for signature 'TsIO' min_primer_region(x) ## S4 replacement method for signature 'TsIO' min_primer_region(x) <- value ## S4 method for signature 'TsIO' primer_opt_tm(x) ## S4 replacement method for signature 'TsIO' primer_opt_tm(x) <- value ## S4 method for signature 'TsIO' primer_min_tm(x) ## S4 replacement method for signature 'TsIO' primer_min_tm(x) <- value ## S4 method for signature 'TsIO' primer_max_tm(x) ## S4 replacement method for signature 'TsIO' primer_max_tm(x) <- value ## S4 method for signature 'TsIO' sequence_template(x) ## S4 method for signature 'TsIO' tapseq_primers(x) ## S4 method for signature 'TsIO' pcr_products(x)TsIO( sequence_id, target_sequence, beads_oligo, reverse_primer, product_size_range, target_annot = NULL, primer_num_return = 5, min_primer_region = 100, primer_opt_tm = NA, primer_min_tm = NA, primer_max_tm = NA ) ## S4 method for signature 'TsIO' sequence_id(x) ## S4 replacement method for signature 'TsIO' sequence_id(x) <- value ## S4 method for signature 'TsIO' target_sequence(x) ## S4 replacement method for signature 'TsIO' target_sequence(x) <- value ## S4 method for signature 'TsIO' beads_oligo(x) ## S4 replacement method for signature 'TsIO' beads_oligo(x) <- value ## S4 method for signature 'TsIO' reverse_primer(x) ## S4 replacement method for signature 'TsIO' reverse_primer(x) <- value ## S4 method for signature 'TsIO' target_annot(x) ## S4 replacement method for signature 'TsIO' target_annot(x) <- value ## S4 method for signature 'TsIO' product_size_range(x) ## S4 replacement method for signature 'TsIO' product_size_range(x) <- value ## S4 method for signature 'TsIO' primer_num_return(x) ## S4 replacement method for signature 'TsIO' primer_num_return(x) <- value ## S4 method for signature 'TsIO' min_primer_region(x) ## S4 replacement method for signature 'TsIO' min_primer_region(x) <- value ## S4 method for signature 'TsIO' primer_opt_tm(x) ## S4 replacement method for signature 'TsIO' primer_opt_tm(x) <- value ## S4 method for signature 'TsIO' primer_min_tm(x) ## S4 replacement method for signature 'TsIO' primer_min_tm(x) <- value ## S4 method for signature 'TsIO' primer_max_tm(x) ## S4 replacement method for signature 'TsIO' primer_max_tm(x) <- value ## S4 method for signature 'TsIO' sequence_template(x) ## S4 method for signature 'TsIO' tapseq_primers(x) ## S4 method for signature 'TsIO' pcr_products(x)
sequence_id |
Name ( |
target_sequence |
A |
beads_oligo |
Beads-oligo-dT sequence for the used droplet sequencing protocol (10x, Drop-seq). |
reverse_primer |
Reverse primer sequence used for all PCR reactions. |
product_size_range |
Numerical vector of length 2 specifying the desired length of the resulting amplicons. |
target_annot |
(optional) A |
primer_num_return |
How many forward primers should be designed? (default: 5) |
min_primer_region |
Minimum sequence length required for primer design. Mostly relevant in
case the sequence template is too short to allow the specified |
primer_opt_tm, primer_min_tm, primer_max_tm
|
Optimal, minumum and maximum primer melting temperature. |
x |
A |
value |
A valid value to assign to the chosen slot. |
tapseq_primers |
Slot where designed TAP-seq primers are stored. Not set by user. |
pcr_products |
Slot where PCR products of primers are stored. Not set by user. |
The TsIO class is based on the Boulder IO records used by Primer3 (Primer3 manual). These objects are used to store the sequence templates and parameters needed for TAP-seq primer design. Primers designed with Primer3 are also stored in the same TsIO objects.
Use TsIO() to construct a new TsIO object from scratch.
A TsIO object.
sequence_id(TsIO): Get sequence_id
sequence_id(TsIO) <- value: Set sequence_id
target_sequence(TsIO): Get target_sequence
target_sequence(TsIO) <- value: Set target_sequence
beads_oligo(TsIO): Get beads_oligo
beads_oligo(TsIO) <- value: Set beads_oligo
reverse_primer(TsIO): Get reverse_primer
reverse_primer(TsIO) <- value: Set reverse_primer
target_annot(TsIO): Get target_annot
target_annot(TsIO) <- value: Set target_annot
product_size_range(TsIO): Get product_size_range
product_size_range(TsIO) <- value: Set product_size_range
primer_num_return(TsIO): Get primer_num_return
primer_num_return(TsIO) <- value: Set primer_num_return
min_primer_region(TsIO): Get min_primer_region
min_primer_region(TsIO) <- value: Set min_primer_region
primer_opt_tm(TsIO): Get primer_opt_tm
primer_opt_tm(TsIO) <- value: Set primer_opt_tm
primer_min_tm(TsIO): Get primer_min_tm
primer_min_tm(TsIO) <- value: Set primer_min_tm
primer_max_tm(TsIO): Get primer_max_tm
primer_max_tm(TsIO) <- value: Set primer_max_tm
sequence_template(TsIO): Create sequence_template
tapseq_primers(TsIO): Get tapseq_primers
pcr_products(TsIO): Get pcr_products
http://primer3.org/manual.html for Primer3 manual.
# get example transcript sequence data("chr11_truncated_txs_seq") tx_seq <- chr11_truncated_txs_seq[[1]] tx_id <- names(chr11_truncated_txs_seq)[1] # 10x beads-oligo-dt sequence beads_oligo <- "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" # reverse primer used in all PCR reactions reverse_primer <- "CTACACGACGCTCTTCCGATCT" # create TsIO object obj <- TsIO(sequence_id = tx_id, target_sequence = tx_seq, beads_oligo = beads_oligo, reverse_primer = reverse_primer, product_size_range = c(350, 500)) # slot values can be accessed using accessor functions sequence_id(obj) sequence_id(obj) <- "Gene1" sequence_id(obj) # the sequence template (target sequence + reverse complement of beads-oligo-dt) for primer # design can be viewed as well sequence_template(obj)# get example transcript sequence data("chr11_truncated_txs_seq") tx_seq <- chr11_truncated_txs_seq[[1]] tx_id <- names(chr11_truncated_txs_seq)[1] # 10x beads-oligo-dt sequence beads_oligo <- "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" # reverse primer used in all PCR reactions reverse_primer <- "CTACACGACGCTCTTCCGATCT" # create TsIO object obj <- TsIO(sequence_id = tx_id, target_sequence = tx_seq, beads_oligo = beads_oligo, reverse_primer = reverse_primer, product_size_range = c(350, 500)) # slot values can be accessed using accessor functions sequence_id(obj) sequence_id(obj) <- "Gene1" sequence_id(obj) # the sequence template (target sequence + reverse complement of beads-oligo-dt) for primer # design can be viewed as well sequence_template(obj)
TsIOList class is a container to store multiple TsIO objects.
This enables storing of Primer3 input and output for multiple target genes.
TsIOList(...) ## S4 method for signature 'TsIOList' sequence_id(x) ## S4 method for signature 'TsIOList' target_sequence(x) ## S4 method for signature 'TsIOList' sequence_template(x) ## S4 method for signature 'TsIOList' target_annot(x) ## S4 method for signature 'TsIOList' tapseq_primers(x) ## S4 method for signature 'TsIOList' pcr_products(x)TsIOList(...) ## S4 method for signature 'TsIOList' sequence_id(x) ## S4 method for signature 'TsIOList' target_sequence(x) ## S4 method for signature 'TsIOList' sequence_template(x) ## S4 method for signature 'TsIOList' target_annot(x) ## S4 method for signature 'TsIOList' tapseq_primers(x) ## S4 method for signature 'TsIOList' pcr_products(x)
... |
Multiple TsIO objects from which a TsIOList object should be created. |
x |
A |
A TsIOList object.
sequence_id(TsIOList): Get sequence_id
target_sequence(TsIOList): Get target_sequence
sequence_template(TsIOList): Create sequence_template
target_annot(TsIOList): Get target_annot
tapseq_primers(TsIOList): Get tapseq_primers
pcr_products(TsIOList): Get pcr_products
# get example transcript sequences data("chr11_truncated_txs_seq") txs_seqs <- chr11_truncated_txs_seq[1:2] txs_ids <- names(txs_seqs) # 10x beads-oligo-dt sequence beads_oligo <- "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" # reverse primer used in all PCR reactions reverse_primer <- "CTACACGACGCTCTTCCGATCT" # create TsIO objects tsio1 <- TsIO(sequence_id = txs_ids[1], target_sequence = txs_seqs[[1]], beads_oligo = beads_oligo, reverse_primer = reverse_primer, product_size_range = c(350, 500)) tsio2 <- TsIO(sequence_id = txs_ids[2], target_sequence = txs_seqs[[2]], beads_oligo = beads_oligo, reverse_primer = reverse_primer, product_size_range = c(350, 500)) # create TsIOList object obj <- TsIOList(tsio1 = tsio1, tsio2 = tsio2) # it's noteworthy to mention that when creating a TsIOList from a DNAStringSet of target # sequences, it's easier to use TAPseqInput() ?TAPseqInput # as with TsIO objects, some values can be accessed using accessor functions sequence_template(obj)# get example transcript sequences data("chr11_truncated_txs_seq") txs_seqs <- chr11_truncated_txs_seq[1:2] txs_ids <- names(txs_seqs) # 10x beads-oligo-dt sequence beads_oligo <- "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT" # reverse primer used in all PCR reactions reverse_primer <- "CTACACGACGCTCTTCCGATCT" # create TsIO objects tsio1 <- TsIO(sequence_id = txs_ids[1], target_sequence = txs_seqs[[1]], beads_oligo = beads_oligo, reverse_primer = reverse_primer, product_size_range = c(350, 500)) tsio2 <- TsIO(sequence_id = txs_ids[2], target_sequence = txs_seqs[[2]], beads_oligo = beads_oligo, reverse_primer = reverse_primer, product_size_range = c(350, 500)) # create TsIOList object obj <- TsIOList(tsio1 = tsio1, tsio2 = tsio2) # it's noteworthy to mention that when creating a TsIOList from a DNAStringSet of target # sequences, it's easier to use TAPseqInput() ?TAPseqInput # as with TsIO objects, some values can be accessed using accessor functions sequence_template(obj)