| Title: | Tools for counting and visualising mutations in a target location |
|---|---|
| Description: | CrispRVariants provides tools for analysing the results of a CRISPR-Cas9 mutagenesis sequencing experiment, or other sequencing experiments where variants within a given region are of interest. These tools allow users to localize variant allele combinations with respect to any genomic location (e.g. the Cas9 cut site), plot allele combinations and calculate mutation rates with flexible filtering of unrelated variants. |
| Authors: | Helen Lindsay [aut, cre] |
| Maintainer: | Helen Lindsay <[email protected]> |
| License: | GPL-2 |
| Version: | 1.41.0 |
| Built: | 2026-07-04 23:02:29 UTC |
| Source: | https://github.com/bioc/CrispRVariants |
Breaks cigar strings into individual operations
.explodeCigarOpCombs(cigar, ops = GenomicAlignments::CIGAR_OPS).explodeCigarOpCombs(cigar, ops = GenomicAlignments::CIGAR_OPS)
cigar |
character(m) A vector of cigar strings |
ops |
character(n) Which operations should be kept? |
The operations, as a CharacterList
Exploded cigar operations with operation widths
Helen Lindsay
Internal CrispRVariants function for creating allele labels given variants and positions
Assume that the reference may be on the negative strand and regions are given with respect to the reference sequence.
.formatVarLabels( grl, labels, position = c("start", "end"), genome.to.pos = NULL, pos.to.lab = ":", as.string = TRUE ) .findMismatches( alns, ref.seq, ref.start, regions = NULL, strand = "+", min.pct = 0 ).formatVarLabels( grl, labels, position = c("start", "end"), genome.to.pos = NULL, pos.to.lab = ":", as.string = TRUE ) .findMismatches( alns, ref.seq, ref.start, regions = NULL, strand = "+", min.pct = 0 )
grl |
(GRangesList) A GRangesList of variants. The position of the variants is used in labels |
labels |
(character(n)) A vector of labels for each variant. In CrispRVariants, this is the size and type of the variant, e.g. "9D" for a 9 bp deletion. |
position |
One of "start" and "end". Determines whether the start or the end coordinate is used when labeling variants. |
genome.to.pos |
Optional named vector for transforming variant coordinates into another coordinate system (Default: NULL) |
pos.to.lab |
(character(1)) Character to join positions and labels (Default: ":", e.g. -3:9D) |
as.string |
Should individual variant labels be pasted into a single comma separated string when one alignment has multiple variants? (Default: TRUE) |
alns |
A GAlignments object, where the aligned sequences should span the reference sequence |
ref.seq |
A DNAString object, the sequence for comparison when checking for mismatches. The sequence does not necessarily have to match the mapping reference sequence. Must span all regions if regions are provided. |
ref.start |
(numeric(1)) The genomic start position of the reference sequence |
regions |
A GRanges object, regions to check for mismatches with coordinates relative to the reference sequence |
strand |
One of "+", "-" |
min.pct |
(numeric(1), between 0 and 100) Only return SNVs that occur at in least min.pct change, not any change at a position. |
A data frame of sequence indices, genomic position of mismatch and mismatch base
Manually specify x-tick locations and labels, as sometimes ggplot defaults are too dense. Used internally by CrispRVariants for creating alignment plot with plotAlignments.
.getAxisCoords( locations, labels = NULL, loc.boundaries = NULL, lab.boundaries = c(-1, 1), label.at = 5, min.tick.sep = 1 ).getAxisCoords( locations, labels = NULL, loc.boundaries = NULL, lab.boundaries = c(-1, 1), label.at = 5, min.tick.sep = 1 )
locations |
character(n) Actual x coordinates, or the desired range of the x coordinates. If labels are provided, all tick locations must be in locations and have a matching label. |
labels |
character(n) labels for the x axis ticks. Should be the same length as locations if provided. Note that if not all tick locations are included in locations, it must be possible to extrapolate labels from locations (Default: NULL) |
loc.boundaries |
numeric(i) Locations that must be included. (Default: NULL) |
lab.boundaries |
numeric(j) Labels that must be included. (Default: c(-1,1), for showing the cut sites). Boundaries must be in labels and have a matching tick location. |
label.at |
numeric(1) Add ticks when label modulo label.at is zero (Default = 5) |
min.tick.sep |
numeric(1) Minimum distance between ticks, excluding boundary ticks. (Default: 1) |
A list containing vectors named tick_locs and tick_labs
Helen Lindsay
create a vector of elements in outer interspersed with elements in inner. Similar to python zip. No element checking.
.intersperse(outer, inner).intersperse(outer, inner)
outer |
vector that will be the first and last elements |
inner |
vector that will join elements of outer |
A vector interspersing elements of outer and inner. If outer is c(a,b,c) and inner is c(d,e), returns c(a,d,b,e,c)
Helen Lindsay
CrispRVariants:::.intersperse(c(1:10), c(1:9)*10)CrispRVariants:::.intersperse(c(1:10), c(1:9)*10)
(.invertKeepRanges) Internal CrispRVariants function used by seqsToPartialAlns for checking arguments and getting region to delete. Returns FALSE if no region to delete found, or region to be deleted is entire target.
(.checkRelativeLocs) Shift keep to start at 1 if it is within the target
(.adjustRelativeInsLocs) Internal CrispRVariants function for shifting insertion locations relative to the target region when removing a segment of the alignments. Note that this function does not do input checking but assumes this has been done upstream. Insertions at the left border of a gap region are removed.
(.offsetIndices) Get indices of a vector grouped by "x", cumulatively adding offsets to each group according to "offset"
.invertKeepRanges(target, keep) .checkRelativeLocs(target, keep) .adjustRelativeInsLocs(target, keep, starts, gap_nchars) .offsetIndices(x, offset).invertKeepRanges(target, keep) .checkRelativeLocs(target, keep) .adjustRelativeInsLocs(target, keep, starts, gap_nchars) .offsetIndices(x, offset)
target |
The complete region spanned by the alignments (GRanges) |
keep |
Region to display, relative to the target region, i.e. not genomic coords (IRanges or GRanges) |
starts |
numeric(n) Insertion locations. When plotting, the insertion symbol appears at the left border of the start location. |
gap_nchars |
character(n) Number of letters added to when joining segments before each region in keep. If first base of keep is 1, the first entry of gap_nchars should be 0. |
x |
A vector of group lengths |
offset |
A vector of offset lengths matching x |
Gaps between keep (IRanges), or FALSE if no gap ranges found
insertion_sites (data.frame) with modified start column
Helen Lindsay
CrispRVariants:::.offsetIndices(rep(2,5), c(0:4)*10)CrispRVariants:::.offsetIndices(rep(2,5), c(0:4)*10)
This is an R implementation of Wibowo Arindrarto's abifpy.py trimming module, which itself implement's Richard Mott's trimming algorithm See https://github.com/bow/abifpy for more details.
abifToFastq( seqname, fname, outfname, trim = TRUE, cutoff = 0.05, min_seq_len = 20, offset = 33, recall = FALSE )abifToFastq( seqname, fname, outfname, trim = TRUE, cutoff = 0.05, min_seq_len = 20, offset = 33, recall = FALSE )
seqname |
name of sequence, to appear in fastq file |
fname |
filename of sequence in ab1 format |
outfname |
filename to append the fastq output to |
trim |
should low quality bases be trimmed from the ends? TRUE or FALSE |
cutoff |
probability cutoff |
min_seq_len |
minimum number of sequenced bases required in order to trim the read |
offset |
phred offset for quality scores |
recall |
Use sangerseqR to resolve the primary sequence if two sequences are present. May cause quality scores to be ignored. (Default: FALSE) |
Requires Bioconductor package SangerseqR
None. Sequences are appended to the outfname.
Helen Lindsay
# Running this code will write the fastq file to "IM2033.fastq" ab1_fname <- system.file("extdata", "IM2033.ab1", package = "CrispRVariants") abifToFastq("IM2033", ab1_fname, "IM2033.fastq")# Running this code will write the fastq file to "IM2033.fastq" ab1_fname <- system.file("extdata", "IM2033.ab1", package = "CrispRVariants") abifToFastq("IM2033", ab1_fname, "IM2033.fastq")
Extrapolates the mapping location of a read by assuming that the clipped regions should map adjacent to the mapped locations. This is not always a good assumption, particularly in the case of chimeric reads!
addClipped(bam, ...) ## S4 method for signature 'GAlignments' addClipped(bam, ...)addClipped(bam, ...) ## S4 method for signature 'GAlignments' addClipped(bam, ...)
bam |
A GAlignments object |
... |
additional arguments |
A GRanges representation of the extended
mapping locations
Helen Lindsay
Adds vertical dotted lines in intervals of three nucleotides. Codon frame is supplied, alignments are assumed not to span an intron-exon junction.
addCodonFrame(p, width, codon.frame)addCodonFrame(p, width, codon.frame)
p |
A ggplot object, typically from CrispRVariants:::makeAlignmentTilePlot |
width |
The number of nucleotides in the alignments |
codon.frame |
The leftmost starting location of the next codon - 1,2,or 3 |
A ggplot object with added vertical lines indicating the frame
Helen Lindsay
Function to access allele names
alleles(obj, ...) ## S4 method for signature 'CrisprSet' alleles(obj, ...)alleles(obj, ...) ## S4 method for signature 'CrisprSet' alleles(obj, ...)
obj |
An object containing variant alleles |
... |
additional arguments |
A data frame relating CIGAR strings to variant labels
Helen Lindsay
data("gol_clutch1") alleles <- alleles(gol)data("gol_clutch1") alleles <- alleles(gol)
Return alignments from an object that contains them. For a CrisprSet object, these are truncated, non-chimeric alignments
alns(obj, ...) ## S4 method for signature 'CrisprSet' alns(obj, ...)alns(obj, ...) ## S4 method for signature 'CrisprSet' alns(obj, ...)
obj |
An object containing aligned sequences |
... |
additional arguments |
A GAlignmentsList of consensus sequences on the positive strand.
Helen Lindsay
data("gol_clutch1") alns <- alns(gol)data("gol_clutch1") alns <- alns(gol)
Plots the gene structure, annotates this with the target location
annotateGenePlot( txdb, target, target.colour = "red", target.size = 1, gene.text.size = 10, panel.spacing = grid::unit(c(0.1, 0.1, 0.1, 0.1), "lines"), plot.title = NULL, all.transcripts = TRUE )annotateGenePlot( txdb, target, target.colour = "red", target.size = 1, gene.text.size = 10, panel.spacing = grid::unit(c(0.1, 0.1, 0.1, 0.1), "lines"), plot.title = NULL, all.transcripts = TRUE )
txdb |
A GenomicFeatures:TxDb object |
target |
Location of target (GRanges) |
target.colour |
Colour of box indicating targt region |
target.size |
Thickness of box indicating target region |
gene.text.size |
Size for figure label |
panel.spacing |
Unit object, margin size |
plot.title |
A title for the plot. If no plot.title is supplied, the title is the list of gene ids shown (default). If plot.title == FALSE, the plot will not have a title. |
all.transcripts |
If TRUE (default), all transcripts of genes overlapping the target are shown, including transcripts that do not themselves overlap the target. If FALSE, only the transcripts that overlap the target are shown. |
A ggplot2 plot of the transcript structures
Arranges 3 plots in two rows. The vertical margins of the left.plot and right.plot constrained to be equal
arrangePlots( top.plot, left.plot, right.plot, fig.height = NULL, col.wdth.ratio = c(2, 1), row.ht.ratio = c(1, 6), left.plot.margin = grid::unit(c(0.1, 0.2, 3, 0.2), "lines") )arrangePlots( top.plot, left.plot, right.plot, fig.height = NULL, col.wdth.ratio = c(2, 1), row.ht.ratio = c(1, 6), left.plot.margin = grid::unit(c(0.1, 0.2, 3, 0.2), "lines") )
top.plot |
ggplot grob, placed on top of the figure, spanning the figure width |
left.plot |
ggplot, placed in the second row on the left |
right.plot |
ggplot, placed in the second row on the right. y-axis labels are removed. |
fig.height |
Actual height for the figure. If not provided, figure height is the sum of the row.ht.ratio (Default: NULL) |
col.wdth.ratio |
Vector specifying column width ratio (Default: c(2, 1)) |
row.ht.ratio |
Vector specifying row height ratio (Default: c(1,6)) |
left.plot.margin |
Unit object specifying margins of left.plot. Margins of right.plot are constrained by the left.plot. |
The arranged plots
For signature "matrix", this function optionally does a very naive classification of variants by size. Frameshift variant combinations are those whose sum is not divisible by three. Intron boundaries are *NOT* considered, use with caution! For signature "CrisprSet", the function uses the VariantAnnotation package to localize variant alleles with respect to annotated transcripts. Variants are annotated as "coding" when they are coding in any transcript.
(signature("CrisprSet")) Groups variants by size and type and produces a barplot showing the variant spectrum for each sample. Accepts all arguments accepted by barplotAlleleFreqs for signature("matrix"). Requires package "VariantAnnotation"
signature("matrix") Accepts a matrix of allele counts, with rownames being alleles and column names samples.
barplotAlleleFreqs(obj, ...) ## S4 method for signature 'CrisprSet' barplotAlleleFreqs( obj, ..., txdb, min.freq = 0, include.chimeras = TRUE, group = NULL, palette = c("rainbow", "bluered") ) ## S4 method for signature 'matrix' barplotAlleleFreqs( obj, category.labels = NULL, group = NULL, bar.colours = NULL, group.colours = NULL, legend.text.size = 10, axis.text.size = 10, legend.symbol.size = 1, snv.label = "SNV", novar.label = "no variant", chimera.label = "Other", include.table = TRUE, classify = TRUE )barplotAlleleFreqs(obj, ...) ## S4 method for signature 'CrisprSet' barplotAlleleFreqs( obj, ..., txdb, min.freq = 0, include.chimeras = TRUE, group = NULL, palette = c("rainbow", "bluered") ) ## S4 method for signature 'matrix' barplotAlleleFreqs( obj, category.labels = NULL, group = NULL, bar.colours = NULL, group.colours = NULL, legend.text.size = 10, axis.text.size = 10, legend.symbol.size = 1, snv.label = "SNV", novar.label = "no variant", chimera.label = "Other", include.table = TRUE, classify = TRUE )
obj |
The object to be plotted |
... |
additional arguments |
txdb |
A transcript database object |
min.freq |
Include variants with at frequency least min.freq in at least one sample. (Default: 0, i.e. no cutoff) |
include.chimeras |
Should chimeric reads be included in results? (Default: TRUE) |
group |
A grouping factor for the columns in obj. Columns in the same group will be displayed in the same text colour (Default: NULL) |
palette |
Colour palette. Options are "rainbow", a quantitative palette (default) or "bluered", a gradient palette. |
category.labels |
Labels for each category, corresponding to the rows of obj. Only applicable when categories are provided, i.e. "classify" is FALSE. (Default: NULL) |
bar.colours |
Colours for the categories in the barplot. Colours must be provided if there are more than 6 different categories. |
group.colours |
Colours for the text labels for the experimental groups A set of 15 different colours is provided. |
legend.text.size |
The size of the legend text, in points. |
axis.text.size |
The size of the axis text, in points |
legend.symbol.size |
The size of the symbols in the legend |
snv.label |
The row label for single nucleotide variants |
novar.label |
The row label for non-variant sequences |
chimera.label |
The row label for chimeric (non-linearly aligned) variant alleles |
include.table |
Should a table of allele (variant combination) counts and total sequences be plotted? (Default: TRUE) |
classify |
If TRUE, performs a naive classification by size (Default:TRUE) |
A ggplot2 barplot of the allele distribution and optionally a table of allele counts
Helen Lindsay
data("gol_clutch1") barplotAlleleFreqs(variantCounts(gol)) # Just show the barplot without the counts table: barplotAlleleFreqs(variantCounts(gol), include.table = FALSE)data("gol_clutch1") barplotAlleleFreqs(variantCounts(gol)) # Just show the barplot without the counts table: barplotAlleleFreqs(variantCounts(gol), include.table = FALSE)
Given a set of alignments to a target region, finds read pairs. Compares insertion/deletion locations within pairs using the cigar string. Pairs with non-identical indels are excluded. Pairs with identical indels are collapsed to a single read, taking the consensus sequence of the pairs.
collapsePairs( alns, use.consensus = TRUE, keep.unpaired = TRUE, verbose = TRUE, ... )collapsePairs( alns, use.consensus = TRUE, keep.unpaired = TRUE, verbose = TRUE, ... )
alns |
A GAlignments object. We do not use GAlignmentPairs because amplicon-seq can result in pairs in non-standard pairing orientation. Must include BAM flag, must not include unmapped reads. |
use.consensus |
Should the consensus sequence be used if pairs have a mismatch? Setting this to be TRUE makes this function much slower (Default: TRUE) |
keep.unpaired |
Should unpaired and chimeric reads be included? (Default: TRUE) |
verbose |
Report statistics on reads kept and excluded |
... |
Additional items with the same length as alns, that should be filtered to match alns. |
The alignments, with non-concordant pairs removed and concordant pairs represented by a single read.
Helen Lindsay
Return consensus sequences of variant alleles. At present, chimeric alignments are not included.
consensusSeqs(obj, ...) ## S4 method for signature 'CrisprSet' consensusSeqs(obj, ..., top.n = NULL, min.freq = 0, min.count = 1)consensusSeqs(obj, ...) ## S4 method for signature 'CrisprSet' consensusSeqs(obj, ..., top.n = NULL, min.freq = 0, min.count = 1)
obj |
An object containing aligned sequences |
... |
additional arguments |
top.n |
(Integer n) If specified, return variants ranked at least n according to frequency across all samples (Default: 0, i.e. no cutoff) |
min.freq |
(Float n least one sample (Default: 0) |
min.count |
(Integer n) Return variants with count greater than n in at least one sample (Default: 0) |
A DNAStringSet of consensus sequences on the positive strand.
Helen Lindsay
data("gol_clutch1") seqs <- consensusSeqs(gol, sample = 2)data("gol_clutch1") seqs <- consensusSeqs(gol, sample = 2)
Counts the number of reads containing a deletion or insertion (indel) of any size in a set of aligned reads. For countDeletions and countInsertions Reads may be filtered according to whether they contain more than one indel of the same or different types.
countDeletions(alns, ...) ## S4 method for signature 'GAlignments' countDeletions( alns, ..., multi.del = FALSE, del.and.ins = FALSE, del.ops = c("D") ) countInsertions(alns, ...) ## S4 method for signature 'GAlignments' countInsertions( alns, ..., ins.and.del = FALSE, multi.ins = FALSE, del.ops = c("D") ) countIndels(alns) ## S4 method for signature 'GAlignments' countIndels(alns) indelPercent(alns) ## S4 method for signature 'GAlignments' indelPercent(alns)countDeletions(alns, ...) ## S4 method for signature 'GAlignments' countDeletions( alns, ..., multi.del = FALSE, del.and.ins = FALSE, del.ops = c("D") ) countInsertions(alns, ...) ## S4 method for signature 'GAlignments' countInsertions( alns, ..., ins.and.del = FALSE, multi.ins = FALSE, del.ops = c("D") ) countIndels(alns) ## S4 method for signature 'GAlignments' countIndels(alns) indelPercent(alns) ## S4 method for signature 'GAlignments' indelPercent(alns)
alns |
The aligned reads |
... |
extra arguments |
multi.del |
If TRUE, returns the exact number of deletions, i.e., if one read contains 2 deletions, it contributes 2 to the total count (default: FALSE) |
del.and.ins |
If TRUE, counts deletions regardless of whether reads also contain insertions. If FALSE, counts reads that contain deletions but not insertions (default: FALSE) |
del.ops |
Cigar operations counted as deletions. Default: c("D") |
ins.and.del |
If TRUE, counts insertions regardless of whether reads also contain deletions If FALSE, counts reads that contain insertions but not deletions (default: FALSE) |
multi.ins |
If TRUE, returns the exact number of insertions, i.e., if one read contains 2 insertions, it contributes 2 to the total count (default: FALSE) |
countDeletions: The number of reads containing a deletion (integer)
countInsertions: The number of reads containing an insertion (integer)
countIndels: The number of reads containing at least one insertion
indelPercent: The percentage of reads containing an insertion or deletion (numeric)
Helen Lindsay
bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) countDeletions(bam) countInsertions(bam) countIndels(bam) indelPercent(bam)bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) countDeletions(bam) countInsertions(bam) countIndels(bam) indelPercent(bam)
A ReferenceClass container for a single sample of alignments narrowed to a target region. Typically CrisprRun objects will not be accessed directly, but if necessary via a CrisprSet class which contains a list of CrisprRun objects. Note that the CrispRVariants plotting functions don't work on CrisprRun objects.
bam |
a GAlignments object containing (narrowed) alignments to the target region. Filtering of the bam should generally be done before initialising a CrisprRun object |
target |
The target location, a GRanges object |
genome.ranges |
A GRangesList of genomic coordinates for the cigar operations. If bam is a standard GAlignments object, this is equivalent to cigarRangesAlongReferenceSpace + start(bam) |
rc |
(reverse complement) Should the alignments be reverse complemented, i.e. displayed with respect to the negative strand? (Default: FALSE) |
name |
A name for this set of reads, used in plots if present (Default: NULL) |
chimeras |
Off-target chimeric alignments not in bam. (Default: empty) |
verbose |
Print information about initialisation progress (Default: FALSE) |
alnsA GAlignments object containing the narrowed reads. Note that if the alignments are represented with respect to the reverse strand, the "start" remains with repect to the forward strand, whilst the cigar and the sequence are reverse complemented.
nameThe name of the sample
cigar_labelsA vector of labels for the reads, based on the cigar strings, optionally renumbered with respect to a new zero point (e.g. the cut site) and shortened to only insertion and deletion locations. Set at initialisation of a CrisprSet object, but not at initialisation of a CrisprRun object.
chimerasChimeric, off-target alignments corresponding to alignments in alns
getCigarLabels(
target,
target.loc,
genome_to_target,
ref,
separate.snv,
rc,
match.label,
mismatch.label,
keep.ops = c("I", "D", "N"),
upstream = min(target.loc, 8),
downstream = min(6, width(ref) - target.loc + 1),
regions = NULL,
snv.regions = NULL
)Description: Sets the "cig_labels" field, returns the cigar labels.
Input parameters: target: (GRanges) the counting region. target.loc: The location of the cut site with respect to the target genome_to_target: A vector with names being genomic locations and values being locations with respect to the cut site separate.snv: Should single nucleotide variants be called? (Default: TRUE) match.label: Label for non-variant reads (Default: no variant) mismatch.label: Label for single nucleotide variants (Default: SNV) rc: Should the variants be displayed with respect to the negative strand? (Default: FALSE) keep.ops: CIGAR operations to remain in the variant label (usually indels) upstream: distance upstream of the cut site to call SNVs downstream: distance downstream of the cut site to call SNVs regions: IRanges(k) Regions for counting insertions and deletions. Insertions on the right border are not counted. snv.regions Regions for calling SNVS
getInsertionSeqs(target)Description: Return a table relating insertion sequences to alignment indices Input parameters:
Helen Lindsay
# readsToTarget with signature("GAlignments", "GRanges") returns a # CrisprRun object bam_fname <- system.file("extdata", "gol_F1_clutch_1_embryo_1_s.bam", package = "CrispRVariants") param <- Rsamtools::ScanBamParam(what = c("seq", "flag")) alns <- GenomicAlignments::readGAlignments(bam_fname, param = param, use.names = TRUE) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_run <- readsToTarget(alns, target = gd, reference = reference, name = "Sample name", target.loc = 17) # Alternatively, CrisprRun objects can be accessed from a CrisprSet object # e.g. crispr_set$crispr_runs[[1]]# readsToTarget with signature("GAlignments", "GRanges") returns a # CrisprRun object bam_fname <- system.file("extdata", "gol_F1_clutch_1_embryo_1_s.bam", package = "CrispRVariants") param <- Rsamtools::ScanBamParam(what = c("seq", "flag")) alns <- GenomicAlignments::readGAlignments(bam_fname, param = param, use.names = TRUE) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_run <- readsToTarget(alns, target = gd, reference = reference, name = "Sample name", target.loc = 17) # Alternatively, CrisprRun objects can be accessed from a CrisprSet object # e.g. crispr_set$crispr_runs[[1]]
A ReferenceClass container for holding a set of narrowed alignments,
each corresponding to the same target region. Individual samples are
represented as CrisprRun objects. CrisprRun objects with no on-target
reads are excluded.
CrisprSet objects are constructed with readsToTarget or
readsToTargets. For most use cases, a CrisprSet object should not
be initialized directly.
crispr.runs |
A list of CrisprRun objects, typically representing individual samples within an experiment |
reference |
The reference sequence, must be the same length as the target region |
target |
The target location (GRanges). Variants will be counted over this region. Need not correspond to the guide sequence. |
rc |
Should the alignments be reverse complemented, i.e. displayed w.r.t the reverse strand? (default: FALSE) |
names |
A list of names for each of the samples, e.g. for displaying in plots. If not supplied, the names of the crispr.runs are used, which default to the filenames of the bam files if available (Default: NULL) |
renumbered |
Should the variants be renumbered using target.loc as the zero point? If TRUE, variants are described by the location of their 5'-most base with respect to the target.loc. A 3bp deletion starting 5bp 5' of the cut site would be labelled as -5:3D (Default: TRUE) |
target.loc |
The location of the Cas9 cut site with respect to the supplied target. (Or some other central location). Can be displayed on plots and used as the zero point for renumbering variants. For a target region with the PAM location from bases 21-23, the target.loc is base 17 (default: 17) |
match.label |
Label for sequences with no variants (default: "no variant") |
mismatch.label |
Label for sequences with only single nucleotide variants (default: "SNV") |
bpparam |
A BiocParallel parameter object specifying how many cores to use. The parallelisable step is calling SNVs. Parallelisation is by sample. (default: SerialParam, i.e. no parallelization) |
verbose |
If true, prints information about initialisation progress (default: TRUE) |
crispr_runsA list of CrisprRun objects, typically corresponding to samples of an experiment.
refThe reference sequence for the target region, as a Biostrings::DNAString object
cigar_freqsA matrix of counts for each variant
targetThe target location, as a GRanges object
classifyCodingBySize(var_type, cutoff = 10)Description: This is a naive classification of variants as frameshift or in-frame Coding indels are summed, and indels with sum divisible by 3 are considered frameshift. Note that this may not be correct for variants that span an intron-exon boundary Input paramters: var_type: A vector of var_type. Only variants with var_type == "coding" are considered. Intended to work with classifyVariantsByLoc cutoff: Variants are divided into those less than and greater than "cutoff" (Default: 10) Result: A character vector with a classification for each variant allele
classifyVariantsByLoc(txdb, add_chr = TRUE, verbose = TRUE, ...)Description: Uses the VariantAnnotation package to look up the location of the variants. VariantAnnotation allows multiple classification tags per variant, this function returns a single tag. The following preference order is used: spliceSite > coding > intron > fiveUTR > threeUTR > promoter > intergenic
Input parameters: txdb: A BSgenome transcription database add_chr: Add "chr" to chromosome names to make compatible with UCSC (default: TRUE) verbose: Print progress (default: TRUE) ...: Filtering arguments for variantCounts
Return value: A vector of classification tags, matching the rownames of .self$cigar_freqs (the variant count table)
classifyVariantsByType(...)Description: Classifies variants as insertions, deletions, or complex (combinations). In development Input parameters: ... Optional arguments to "variantCounts" for filtering variants before classification Return value: A named vector classifying variant alleles as insertions, deletions, etc
consensusAlleles(
cig_freqs = .self$cigar_freqs,
return_nms = TRUE,
match.ops = c("M", "X", "=")
)Description: Get variants by their cigar string, make the pairwise alignments for the consensus sequence for each variant allele
Input parameters: cig_freqs: A table of variant allele frequencies (by default: .self$cigar_freqs, but could also be filtered) return_nms: If true, return a list of sequences and labels (Default:FALSE) match.ops: CIGAR operations for 1-1 alignments
Return: A DNAStringSet of the consensus sequences for the specified alleles, or a list containing the consensus sequences and names for the labels if return_nms = TRUE
filterUniqueLowQual(min_count = 2, max_n = 0, verbose = TRUE)Description: Deletes reads containing rare variant combinations and more than a minimum number of ambiguity characters within the target region. These are assumed to be alignment errors.
Input parameters: min_count: the number of times a variant combination must occur across all samples to keep (default: 2, i.e. a variant must occur at least twice in one or more samples to keep) max_n: maximum number of ambiguity ("N") bases a read with a rare variant combination may contain. (default: 0) verbose: If TRUE, print the number of sequences removed (default: TRUE)
filterVariants(
cig_freqs = NULL,
names = NULL,
columns = NULL,
include.chimeras = TRUE
)Description: Relabels specified variants in a table of variant allele counts as non-variant, e.g. variants known to exist in control samples. Accepts either a size, e.g. "1D", or a specific mutation, e.g. "-4:3D". For alleles that include one variant to be filtered and one other variant, the other variant will be retained. If SNVs are included, these will be removed entirely, but note that SNVs are only called in reads that do not contain an insertion/deletion variant
Input parameters: cig_freqs: A table of variant allele counts (Default: NULL, i.e. .self$cigar_freqs) names: Labels of variants alleles to remove (Default: NULL) columns: Indices or names of control samples. Remove all variants that occur in these columns. (Default: NULL) include.chimeras: Should chimeric reads be included? (Default: TRUE)
heatmapCigarFreqs(
as.percent = TRUE,
x.size = 8,
y.size = 8,
x.axis.title = NULL,
x.angle = 90,
min.freq = 0,
min.count = 0,
top.n = nrow(.self$cigar_freqs),
type = c("counts", "proportions"),
header = c("default", "counts", "efficiency"),
order = NULL,
alleles = NULL,
create.plot = TRUE,
...
)Description: Internal method for CrispRVariants:plotFreqHeatmap, optionally filters the table of variants, then a table of variant counts, coloured by counts or proportions.
Input parameters: as.percent: Should colours represent the percentage of reads per sample (TRUE) or the actual counts (FALSE)? (Default: TRUE) x.size: Font size for x axis labels (Default: 8) y.size: Font size for y axis labels (Default: 8) x.axis.title: Title for x axis min.freq: Include only variants with frequency at least min.freq in at least one sample min.count: Include only variants with count at least min.count in at least one sample top.n: Include only the n most common variants type: Should labels show counts or proportions? (Default: counts) header: What should be displayed in the header of the heatmap. Default: total count for type = "counts" or proportion of reads shown in the matrix for type = "proportions". If "counts" is selected, total counts will be shown for both types. "efficiency" shows the mutation efficiency (calculated with default settings) order: Reorder the columns according to this order (Default: NULL) alleles: Names of alleles to include. Selection of alleles takes place after filtering (Default: NULL). exclude: Names of alleles to exclude (Default: NULL) create.plot: Should the plot be created (TRUE, default), or the data used in the plot returned. ...: Extra filtering or plotting options
Return value: A ggplot2 plot object. Call "print(obj)" to display
See also: CrispRVariants::plotFreqHeatmap
makePairwiseAlns(cig_freqs = .self$cigar_freqs, ...)Description: Get variants by their cigar string, make the pairwise alignments for the consensus sequence for each variant allele
Input parameters: cig_freqs: A table of variant allele frequencies (by default: .self$cigar_freqs, but could also be filtered) ...: Extra arguments for CrispRVariants::seqsToAln, e.g. which symbol should be used for representing deleted bases
mutationEfficiency(
snv = c("non_variant", "include", "exclude"),
include.chimeras = TRUE,
exclude.cols = NULL,
group = NULL,
filter.vars = NULL,
filter.cols = NULL,
count.alleles = FALSE,
per.sample = TRUE,
min.freq = 0
)Description: Calculates summary statistics for the mutation efficiency, i.e. the percentage of reads that contain a variant. Reads that do not contain and insertion or deletion, but do contain a single nucleotide variant (snv) can be considered as mutated, non-mutated, or not included in efficiency calculations as they are ambiguous. Note: mutationEfficiency does not treat partial alignments differently
Input parameters: snv: One of "include" (consider reads with mismatches to be mutated), "exclude" (do not include reads with snvs in efficiency calculations), and "non_variant" (consider reads with mismatches to be non-mutated). include.chimeras: Should chimeras be counted as variants? (Default: TRUE) exclude.cols: A list of column names to exclude from calculation, e.g. if one sample is a control (default: NULL, i.e. include all columns) group: A grouping variable. Efficiency will be calculated per group, instead of for individual. Cannot be used with exclude.cols. filter.vars: Variants that should not be counted as mutations. filter.cols: Column names to be considered controls. Variants occuring in a control sample will not be counted as mutations. count.alleles: If TRUE, also report statistics about the number of alleles per sample/per group. (Default: FALSE) per.sample: Return efficiencies for each sample (Default: TRUE) min.freq: Minimum frequency for counting alleles. Does not apply to calculating efficiency. To filter when calculating efficiency, first use "variantCounts". (Default: 0, i.e. no filtering) Return value: A vector of efficiency statistics per sample and overall, or a matrix if a group is supplied.
plotVariants(
min.freq = 0,
min.count = 0,
top.n = nrow(.self$cigar_freqs),
alleles = NULL,
renumbered = .self$pars["renumbered"],
add.other = TRUE,
create.plot = TRUE,
plot.regions = NULL,
allow.partial = TRUE,
...
)Description: Internal method for CrispRVariants:plotAlignments, optionally filters the table of variants, then plots variants with respect to the reference sequence, collapsing insertions and displaying insertion sequences below the plot.
Input parameters: min.freq: i( in at least one sample min.count i (integer) include variants that occur at leas i times in at least one sample top.n: n (integer) Plot only the n most frequent variants (default: plot all) Note that if there are ties in variant ranks, top.n only includes ties with all members ranking <= top.n alleles: Alleles to include after filtering. Default NULL means use all alleles that pass filtering. renumbered: If TRUE, the x-axis is numbered with respect to the target (cut) site. If FALSE, x-axis shows genomic locations. (default: TRUE) add.other Add a blank row named "Other" for chimeric alignments, if there are any (Default: TRUE) create.plot Data is plotted if TRUE and returned without if FALSE. (Default: TRUE) plot.regions Subregion of the target to plot (Default: NULL) allow.partial Should partial alignments be allowed? (Default: TRUE) ... additional arguments for plotAlignments
Return value: A ggplot2 plot object. Call "print(obj)" to display
Helen Lindsay
readsToTarget and readsToTargets
for initialising a CrisprSet, CrisprRun container for sample data.
# Load the metadata table md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants") md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE) # Get bam filenames and their full paths bam_fnames <- sapply(md$bam.filename, function(fn){ system.file("extdata", fn, package = "CrispRVariants")}) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_set <- readsToTarget(bam_fnames, target = gd, reference = reference, names = md$experiment.name, target.loc = 17)# Load the metadata table md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants") md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE) # Get bam filenames and their full paths bam_fnames <- sapply(md$bam.filename, function(fn){ system.file("extdata", fn, package = "CrispRVariants")}) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_set <- readsToTarget(bam_fnames, target = gd, reference = reference, names = md$experiment.name, target.loc = 17)
Update default values for func with values from dot args
dispatchDots(func, ..., call = FALSE)dispatchDots(func, ..., call = FALSE)
func |
Function to call |
... |
dot args to pass to function |
call |
If TRUE, call the function with the argument list and return this result (Default: FALSE) |
A list of arguments to pass to func, or if call is TRUE, the result of calling func with these arguments.
Helen Lindsay
# Set up a function to dispatch dot arguments to: f <- function(a=1, b=2, c=3){ print(c(a,b,c)) } # Set up a function for passing dots: g <- function(...){ CrispRVariants:::dispatchDots(f, ...) } g(a = 5) g(a = 5, call = TRUE) # Unrelated arguments will not be passed on g(a = 5, d = 6)# Set up a function to dispatch dot arguments to: f <- function(a=1, b=2, c=3){ print(c(a,b,c)) } # Set up a function for passing dots: g <- function(...){ CrispRVariants:::dispatchDots(f, ...) } g(a = 5) g(a = 5, call = TRUE) # Unrelated arguments will not be passed on g(a = 5, d = 6)
Returns a GAlignments excluding reads based on either name and/or location
excludeFromBam(bam, exclude.ranges = GRanges(), exclude.names = NA)excludeFromBam(bam, exclude.ranges = GRanges(), exclude.names = NA)
bam |
a GAlignments object |
exclude.ranges |
Regions to exclude, as |
exclude.names |
A character vector of alignments names to exclude |
The bam minus the excluded regions
Helen Lindsay
Find chimeric reads, assuming that the GAlignments object does not contain multimapping reads. That is, read names that appear more than ones in the file are considered chimeras. Chimeric reads are reads that cannot be mapped as a single, linear alignment. Reads from structual rearrangements such as inversions can be mapped as chimeras. Note that the indices of all chimeric reads are returned, these are not separated into individual chimeric sets.
findChimeras(bam, by.flag = FALSE)findChimeras(bam, by.flag = FALSE)
bam |
A GAlignments object, must include names |
by.flag |
Can the chimeras be detected just using the supplementary alignment flag? (Default: FALSE). If TRUE, detects supplementary alignments and returns reads with the same name as a supplementary alignment (quicker). If FALSE, all alignments with duplicated names are returned. |
A vector of indices of chimeric sequences within the original bam
Helen Lindsay
plotChimeras for plotting chimeric alignment sets.
bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) chimera_indices <- findChimeras(bam) chimeras <- bam[chimera_indices]bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) chimera_indices <- findChimeras(bam) chimeras <- bam[chimera_indices]
Find single nucleotide variants (SNVs) above a specified frequency in a table of variants.
findSNVs(obj, ...) ## S4 method for signature 'CrisprSet' findSNVs(obj, ..., freq = 0.25, include.chimeras = TRUE)findSNVs(obj, ...) ## S4 method for signature 'CrisprSet' findSNVs(obj, ..., freq = 0.25, include.chimeras = TRUE)
obj |
An object containing variant counts |
... |
additional arguments |
freq |
minimum frequency snv to return (Default: 0.25) |
include.chimeras |
include chimeric reads when calculating SNV frequencies (Default: TRUE) |
A vector of SNVs and their frequencies
Helen Lindsay
Return chimeric alignments from a collection of aligned sequences
getChimeras(obj, ...) ## S4 method for signature 'CrisprSet' getChimeras(obj, ..., sample)getChimeras(obj, ...) ## S4 method for signature 'CrisprSet' getChimeras(obj, ..., sample)
obj |
An object containing aligned sequences |
... |
additional arguments |
sample |
The sample name or sample index to return |
A GAlignment object containing the chimeric read groups
Helen Lindsay
data("gol_clutch1") chimeras <- getChimeras(gol, sample = 2)data("gol_clutch1") chimeras <- getChimeras(gol, sample = 2)
Returns a table of insertion sequences present in a GAlignments object. This table is aggregated and used by plotAlignments.
getInsertionsTable(alns, pos = 1L)getInsertionsTable(alns, pos = 1L)
alns |
A GAlignments object |
pos |
(Integer(1)) The amount by which to shift genomic coordinates upstream to get coordinates relative to a display region |
A data frame of insertion sequences, genomic and relative locations
Helen Lindsay
This dataset is a subset of the crispant data for the golden gene used by Burger et al (submitted).
data(gol_clutch1)data(gol_clutch1)
A CrisprSet object countaining 8 samples
gol The variants as a CrisprSet object
A CrisprSet object named "gol"
Makes allele labels for insertion / deletion variants
indelLabels( alns, rc = FALSE, genome.to.pos = NULL, keep.ops = c("I", "D", "N"), regions = NULL, as.string = TRUE, ... )indelLabels( alns, rc = FALSE, genome.to.pos = NULL, keep.ops = c("I", "D", "N"), regions = NULL, as.string = TRUE, ... )
alns |
(GAligments) aligned reads for finding variants |
rc |
Should the variants be displayed with respect to the negative strand? (Default: FALSE) |
genome.to.pos |
A vector with names being genomic locations and values being positions to use in labels (Default: NULL) |
keep.ops |
CIGAR operations to remain in the variant label (usually indels) |
regions |
IRanges(k) Regions for counting insertions and deletions. Insertions on the right border are not counted. |
as.string |
Return labels as strings (Default: TRUE) |
... |
extra formatting arguments |
A vector of labels for alns
Helen Lindsay
Takes a matrix of characters, x and y locations and colours, creates a ggplot geom_tile plot with tiles labelled by the characters.
makeAlignmentTilePlot( m, ref, xlab, plot.text.size, axis.text.size, xtick.labs, xtick.breaks, tile.height )makeAlignmentTilePlot( m, ref, xlab, plot.text.size, axis.text.size, xtick.labs, xtick.breaks, tile.height )
m |
A matrix with column headings Var1: y location, Var2: x location, cols: tile fill colour, isref: transparency value text_cols: text colour |
ref |
The reference sequence, only used for checking the number of x-tick labels when x-tick breaks are not supplied |
xlab |
Label for the x axis |
plot.text.size |
Size for text within plot |
axis.text.size |
Size for text on axes |
xtick.labs |
x axis labels |
xtick.breaks |
Locations of x labels |
tile.height |
Controls whitespace between tiles |
A ggplot object
Helen Lindsay
Merges chimeric alignments where the individual segments border an unmapped region (a long deletion). If bases of the read are mapped to both ends of the gap, the multimapped reads are only included in the leftmost genomic segment. If there are more than max_unmapped unmapped bases between the mapped bases, the read is not considered mergeable. Currently experimental and only tested with reads mapped by bwa mem.
mergeChimeras( bam, chimera_idxs = NULL, verbose = TRUE, max_read_overlap = 10, max_unmapped = 4, name = NULL )mergeChimeras( bam, chimera_idxs = NULL, verbose = TRUE, max_read_overlap = 10, max_unmapped = 4, name = NULL )
bam |
A GenomicAlignments::GAlignments object |
chimera_idxs |
Indices of chimeric reads within bam |
verbose |
Should information about the number of mergeable alignments be printed? (Default: TRUE) |
max_read_overlap |
Maximum number of bases in a mergeable read that are aligned to two genomic locations (Default: 10) |
max_unmapped |
Maximum number of bases in a mergeable read that are unmapped and located between two mapped segments (Default: 4) |
name |
Name of the sample, used when reporting verbose output. |
A list of the merged and unmerged chimeric alignments
Helen Lindsay
Merge two CrisprSet objects sharing a reference and target location
mergeCrisprSets(x, y, ...) ## S4 method for signature 'CrisprSet,CrisprSet' mergeCrisprSets( x, y, ..., x.samples = NULL, y.samples = NULL, names = NULL, order = NULL )mergeCrisprSets(x, y, ...) ## S4 method for signature 'CrisprSet,CrisprSet' mergeCrisprSets( x, y, ..., x.samples = NULL, y.samples = NULL, names = NULL, order = NULL )
x |
A CrisprSet object |
y |
A second CrisprSet object |
... |
extra arguments |
x.samples |
A subset of column names or indices to keep from CrispRSet x (Default: NULL, i.e. keep all) |
y.samples |
A subset of column names or indices to keep from CrispRSet y (Default: NULL, i.e. keep all) |
names |
New names for the merged CrisprSet object (Default: NULL) |
order |
A list of sample names, matching the names in x and y, specifying the order of the samples in the new CrisprSet. (Not implemented yet) |
A merged CrisprSet object
Helen Lindsay
# Load the metadata table md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants") md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE) # Get bam filenames and their full paths bam_fnames <- sapply(md$bam.filename, function(fn){ system.file("extdata", fn, package = "CrispRVariants")}) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_set1 <- readsToTarget(bam_fnames[c(1:4)], target = gd, reference = reference, names = md$experiment.name[1:4], target.loc = 17) crispr_set2 <- readsToTarget(bam_fnames[c(5:8)], target = gd, reference = reference, names = md$experiment.name[5:8], target.loc = 17) mergeCrisprSets(crispr_set1,crispr_set2)# Load the metadata table md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants") md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE) # Get bam filenames and their full paths bam_fnames <- sapply(md$bam.filename, function(fn){ system.file("extdata", fn, package = "CrispRVariants")}) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_set1 <- readsToTarget(bam_fnames[c(1:4)], target = gd, reference = reference, names = md$experiment.name[1:4], target.loc = 17) crispr_set2 <- readsToTarget(bam_fnames[c(5:8)], target = gd, reference = reference, names = md$experiment.name[5:8], target.loc = 17) mergeCrisprSets(crispr_set1,crispr_set2)
Make variant labels for variants without an insertion or deletion
mismatchLabels( alns, target, ref.seq, regions = NULL, min.pct = 0, mismatch.label = "SNV", genome.to.pos = NULL, as.string = TRUE )mismatchLabels( alns, target, ref.seq, regions = NULL, min.pct = 0, mismatch.label = "SNV", genome.to.pos = NULL, as.string = TRUE )
alns |
A GAlignments object, where the aligned sequences should span the reference sequence |
target |
(GRanges(1)) The region for counting mismatches |
ref.seq |
A DNAString object, the sequence for comparison when checking for mismatches. The sequence does not necessarily have to match the mapping reference sequence. Must span all regions if regions are provided. |
regions |
A GRanges object, regions to check for mismatches with coordinates relative to the reference sequence |
min.pct |
(numeric(1), between 0 and 100) Only return SNVs that occur at in least min.pct change, not any change at a position. |
mismatch.label |
(character(1)) Label to append to the start of mismatch strings, if returning as a single string (Default: "SNV:") |
genome.to.pos |
Optional named vector for transforming variant coordinates into another coordinate system (Default: NULL) |
as.string |
Should individual variant labels be pasted into a single comma separated string when one alignment has multiple variants? (Default: TRUE) |
A data frame of sequence indices, genomic position of mismatch and mismatch base
Returns the percentage of sequences that contain at least one mutation.
mutationEfficiency(obj, ...) ## S4 method for signature 'CrisprSet' mutationEfficiency( obj, ..., snv = c("non_variant", "include", "exclude"), include.chimeras = TRUE, exclude.cols = NULL, filter.vars = NULL, filter.cols = NULL, group = NULL )mutationEfficiency(obj, ...) ## S4 method for signature 'CrisprSet' mutationEfficiency( obj, ..., snv = c("non_variant", "include", "exclude"), include.chimeras = TRUE, exclude.cols = NULL, filter.vars = NULL, filter.cols = NULL, group = NULL )
obj |
An object containing variant counts |
... |
additional arguments |
snv |
Single nucleotide variants (SNVs) may be considered as mutations ("include"), treated as ambiguous sequences and not counted at all ("exclude"), or treated as non-mutations, e.g. sequencing errors or pre-existing SNVs ("non_variant", default) |
include.chimeras |
Should chimeric alignments be counted as variants when calculating mutation efficiency (Default: TRUE |
exclude.cols |
A vector of names of columns in the variant counts table that will not be considered when counting mutation efficiency |
filter.vars |
Variants to remove before calculating efficiency. May be either a variant size, e.g. "1D", or a particular variant/variant combination, e.g. -5:3D |
filter.cols |
A vector of control sample names. Any variants present in the control samples will be counted as non-variant, unless they also contain another indel. Note that this is not compatible with counting snvs as variants. |
group |
A grouping vector. If provided, efficiency will be calculated per group (Default: NULL) |
A vector of efficiency statistics per sample and overall, or a matrix of efficiency statistics per group if a group is provided
Helen Lindsay
data("gol_clutch1") mutationEfficiency(gol)data("gol_clutch1") mutationEfficiency(gol)
Aligned reads are narrowed to the target region. In the case of reads with deletions spanning the boundaries of the target, reads are narrowed to the start of the deletion,
narrowAlignments(alns, target, ...) ## S4 method for signature 'GAlignments,GRanges' narrowAlignments( alns, target, ..., reverse.complement, minoverlap = NULL, verbose = FALSE, clipping.ops = c("S", "H"), match.ops = c("M", "X", "=") )narrowAlignments(alns, target, ...) ## S4 method for signature 'GAlignments,GRanges' narrowAlignments( alns, target, ..., reverse.complement, minoverlap = NULL, verbose = FALSE, clipping.ops = c("S", "H"), match.ops = c("M", "X", "=") )
alns |
A GAlignments object including a metadata column "seq" containing the sequence |
target |
A GRanges object |
... |
additional arguments |
reverse.complement |
Should the aligned reads be reverse complemented? |
minoverlap |
Minimum overlapping region between alignments and target. If not specified, alignments must span the entire target region. (Default: NULL) |
verbose |
(Default: FALSE) |
clipping.ops |
CIGAR operations corresponding to clipping (Default: c("S","H")) |
match.ops |
CIGAR operations corresponding to a match, i.e. a non-indel position (Default: c("M","X","=")) |
The narrowed alignments (GAlignments)
Helen Lindsay
bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) target <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") narrowAlignments(bam, target, reverse.complement = FALSE)bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) target <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") narrowAlignments(bam, target, reverse.complement = FALSE)
(signature("CrisprSet")) Wrapper for CrisprSet$plotVariants.
Optionally filters a CrisprSet frequency table, then plots variants.
More information in CrisprSet
(signature("DNAString")) Plots a set of pairwise alignments to a reference sequence.
Alignments should all be the same length as the reference sequences.
This is achieved by removing insertions with respect to the reference,
see seqsToAln.
Insertions are indicated by symbols in the plot and a table showing the
inserted sequences below the plot. The default options are intended for a
figure 6-8 inches wide, with figure height best chosen according to the number
of different variants and insertions to be displayed.
plotAlignments(obj, ...) ## S4 method for signature 'CrisprSet' plotAlignments( obj, ..., min.freq = 0, min.count = 1, top.n = 50, renumbered = obj$pars[["renumbered"]], add.other = TRUE, create.plot = TRUE ) ## S4 method for signature 'character' plotAlignments( obj, ..., alns, ins.sites, highlight.pam = TRUE, show.plot = FALSE, target.loc = 17, pam.start = NA, pam.end = NA, ins.size = 2, legend.cols = 3, xlab = NULL, xtick.labs = NULL, xtick.breaks = NULL, plot.text.size = 2, axis.text.size = 8, legend.text.size = 6, highlight.guide = TRUE, guide.loc = NULL, tile.height = 0.55, max.insertion.size = 20, min.insertion.freq = 5, line.weight = 1, legend.symbol.size = ins.size, add.other = FALSE, codon.frame = NULL, style = c("all", "mismatches") ) ## S4 method for signature 'DNAString' plotAlignments( obj, ..., alns, ins.sites, highlight.pam = TRUE, show.plot = FALSE, target.loc = 17, pam.start = NA, pam.end = NA, ins.size = 2, legend.cols = 3, xlab = NULL, xtick.labs = NULL, xtick.breaks = NULL, plot.text.size = 2, axis.text.size = 8, legend.text.size = 6, highlight.guide = TRUE, guide.loc = NULL, tile.height = 0.55, max.insertion.size = 20, min.insertion.freq = 5, line.weight = 1, legend.symbol.size = ins.size, add.other = FALSE, codon.frame = NULL )plotAlignments(obj, ...) ## S4 method for signature 'CrisprSet' plotAlignments( obj, ..., min.freq = 0, min.count = 1, top.n = 50, renumbered = obj$pars[["renumbered"]], add.other = TRUE, create.plot = TRUE ) ## S4 method for signature 'character' plotAlignments( obj, ..., alns, ins.sites, highlight.pam = TRUE, show.plot = FALSE, target.loc = 17, pam.start = NA, pam.end = NA, ins.size = 2, legend.cols = 3, xlab = NULL, xtick.labs = NULL, xtick.breaks = NULL, plot.text.size = 2, axis.text.size = 8, legend.text.size = 6, highlight.guide = TRUE, guide.loc = NULL, tile.height = 0.55, max.insertion.size = 20, min.insertion.freq = 5, line.weight = 1, legend.symbol.size = ins.size, add.other = FALSE, codon.frame = NULL, style = c("all", "mismatches") ) ## S4 method for signature 'DNAString' plotAlignments( obj, ..., alns, ins.sites, highlight.pam = TRUE, show.plot = FALSE, target.loc = 17, pam.start = NA, pam.end = NA, ins.size = 2, legend.cols = 3, xlab = NULL, xtick.labs = NULL, xtick.breaks = NULL, plot.text.size = 2, axis.text.size = 8, legend.text.size = 6, highlight.guide = TRUE, guide.loc = NULL, tile.height = 0.55, max.insertion.size = 20, min.insertion.freq = 5, line.weight = 1, legend.symbol.size = ins.size, add.other = FALSE, codon.frame = NULL )
obj |
The object to be plotted |
... |
Additional arguments |
min.freq |
i ( one sample (default: 0, i.e no frequency cutoff) |
min.count |
i (integer) only plot variants with count >= i in at least one sample (default: 0, i.e no count cutoff) |
top.n |
(integer) Plot only the n most frequent variants (default: 50) |
renumbered |
If TRUE, the x-axis is numbered with respect to the target (default: TRUE) |
add.other |
Add a blank row labelled "Other" to the plot, for combining with plotFreqHeatmap (default: TRUE (signature "CrisprSet") FALSE (signature "matrix")) |
create.plot |
Should the data be plotted? If false, returns the data used for plotting (Default: TRUE) |
alns |
A named character vector of aligned sequences, with insertions removed |
ins.sites |
A table of insertion_sites, which must include cols named "start", "cigar", "seq" and "count" for the start of the insertion in the corresponding sequence |
highlight.pam |
should location of PAM with respect to the target site be indicated by a box? (Default: TRUE) If TRUE, and pam.start and pam.end are not supplied, PAM is inferred from target.loc |
show.plot |
Should the plot be displayed (TRUE) or just returned as a ggplot object (FALSE). (Default: FALSE) |
target.loc |
The location of the zero point / cleavage location. Base n, where the zero point is between bases n and n+1 |
pam.start |
The first location of the PAM with respect to the reference. |
pam.end |
The last location of the PAM with respect to the reference. Default is two bases after the pam.start |
ins.size |
The size of the symbols representing insertions within the plot. |
legend.cols |
The number of columns in the legend. (Default:3) |
xlab |
A title for the x-axis (Default: NULL) |
xtick.labs |
Labels for the x-axis ticks (Default: NULL) |
xtick.breaks |
Locations for x-axis tick breaks (Default: NULL) |
plot.text.size |
The size of the text inside the plot |
axis.text.size |
The size of the axis labels |
legend.text.size |
The size of the legend labels |
highlight.guide |
Should the guide be indicated by a box in the reference sequence? (Default: TRUE) |
guide.loc |
The location of the guide region to be highlighted, as an IRanges object. Will be inferred from target.loc if highlight.guide = TRUE and no guide.loc is supplied, assuming the guide plus PAM is 23bp (Default: NULL) |
tile.height |
The height of the tiles within the plot. (Default: 0.55) |
max.insertion.size |
The maximum length of an insertion to be shown in the legend. If max.insertion.size = n, an insertion of length m > n will be annotated as "mI" in the figure. (Default: 20) |
min.insertion.freq |
Display inserted sequences with frequency at least x amongst the sequences with an insertion of this size and length (Default: 5) |
line.weight |
The line thickness for the vertical line indicating the zero point (cleavage site) and the boxes for the guide and PAM. (Default: 1) |
legend.symbol.size |
The size of the symbols indicating insertions in the legend. (Default: ins.size) |
codon.frame |
Codon position of the leftmost nucleotide. If provided, codon positions in the specified frame are indicated. (Default: NULL) |
style |
One of "all" (colour all tiles) and "mismatches" (colour only mismatch positions) |
A ggplot2 figure
Helen Lindsay
#Load a CrisprSet object and plot data("gol_clutch1") plotAlignments(gol)#Load a CrisprSet object and plot data("gol_clutch1") plotAlignments(gol)
Produces a dot plot of a set of chimeric alignments. For chimeric alignments, a single read is split into several, possibly overlapping alignmed blocks. Aligned sections of chimeric reads can be separated by large genomic distances, or on separate chromosomes. plotChimeras produces a dot plot, each aligned block highlighted, and chromosomes shown in different colours. Large gaps between aligned segments are collapsed and indicated on the plot with horizontal lines. The X-axis shows each base of the entire read. Note that the mapping to the fwd strand is shown if all strands agree. The chimeric alignments must be sorted!
plotChimeras( chimeric.alns, max.gap = 10, tick.sep = 20, text.size = 10, title.size = 16, gap.pad = 20, legend.title = "Chromosome", xangle = 90, wrt.forward = FALSE, annotate.within = 20, annotations = GenomicRanges::GRanges() )plotChimeras( chimeric.alns, max.gap = 10, tick.sep = 20, text.size = 10, title.size = 16, gap.pad = 20, legend.title = "Chromosome", xangle = 90, wrt.forward = FALSE, annotate.within = 20, annotations = GenomicRanges::GRanges() )
chimeric.alns |
A GAlignments object containing only the chimeric reads to be plotted |
max.gap |
If aligned segments are separated by more than max.gap, |
tick.sep |
How many bases should separate tick labels on plot. Default 20. |
text.size |
Size of X and Y tick labels on plot. Default 12 |
title.size |
Size of X and Y axis labels on plot. Default 16 |
gap.pad |
How much should aligned blocks be separated by? (Default: 20) |
legend.title |
Title for the legend. Default "Chromosome" |
xangle |
Angle for x axis text (Default 90, i.e vertical) |
wrt.forward |
Should chimeric alignments where all members map to the negative strand be displayed with respect to the forward strand, i.e. as the cigar strand is written (TRUE), or the negative strand (FALSE) (Default: FALSE) |
annotate.within |
annot_aln ranges in "annotations" within n bases of a chimeric alignment (Default 50) |
annotations |
A list of GRanges. Any that overlap with the chimeric alignments are highlighed in the plot. |
A ggplot2 dotplot of the chimeric alignments versus the reference sequence
Helen Lindsay
findChimeras for finding chimeric alignment sets.
bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) # Choose a single chimeric read set to plot: chimeras <- bam[names(bam) == "AB3092"] # This read aligns in 3 pieces, all on chromosome 18. # The plot shows the alignment annot_alns a small duplication and # a long gap. plotChimeras(chimeras)bam_fname <- system.file("extdata", "gol_F1_clutch_2_embryo_4_s.bam", package = "CrispRVariants") bam <- GenomicAlignments::readGAlignments(bam_fname, use.names = TRUE) # Choose a single chimeric read set to plot: chimeras <- bam[names(bam) == "AB3092"] # This read aligns in 3 pieces, all on chromosome 18. # The plot shows the alignment annot_alns a small duplication and # a long gap. plotChimeras(chimeras)
Creates a heatmap from a matrix of counts or proportions, where tiles are coloured by the proportion and labeled with the value.
plotFreqHeatmap(obj, ...) ## S4 method for signature 'matrix' plotFreqHeatmap( obj, ..., col.sums = NULL, header = NA, header.name = "Total", group = NULL, group.colours = NULL, as.percent = TRUE, x.axis.title = NULL, x.size = 6, y.size = 8, x.angle = 90, legend.text.size = 6, plot.text.size = 3, line.width = 1, x.hjust = 1, legend.position = "right", x.labels = NULL, legend.key.height = grid::unit(1, "lines") ) ## S4 method for signature 'CrisprSet' plotFreqHeatmap( obj, ..., top.n = 50, min.freq = 0, min.count = 1, type = c("counts", "proportions"), order = NULL, alleles = NULL )plotFreqHeatmap(obj, ...) ## S4 method for signature 'matrix' plotFreqHeatmap( obj, ..., col.sums = NULL, header = NA, header.name = "Total", group = NULL, group.colours = NULL, as.percent = TRUE, x.axis.title = NULL, x.size = 6, y.size = 8, x.angle = 90, legend.text.size = 6, plot.text.size = 3, line.width = 1, x.hjust = 1, legend.position = "right", x.labels = NULL, legend.key.height = grid::unit(1, "lines") ) ## S4 method for signature 'CrisprSet' plotFreqHeatmap( obj, ..., top.n = 50, min.freq = 0, min.count = 1, type = c("counts", "proportions"), order = NULL, alleles = NULL )
obj |
A matrix of counts with rows = feature, columns = sample |
... |
additional arguments |
col.sums |
Alternative column sums to be used for calculating the tile colours if as.percent = TRUE, e.g. if "obj" is a subset of a larger data set. If "NULL" (default), the column sums of "obj" are used. |
header |
Alternative column titles, e.g. column sums for the unfiltered data set when obj is a subset. If set to "NA", column sums of obj are displayed. If "NULL", no header is displayed (Default: NA). |
header.name |
Label for the header row (Default: "Total") |
group |
Grouping factor for columns. If supplied, columns are ordered to match the levels (Default: NULL) |
group.colours |
Colours for column groups, should match levels of "group". If "NULL", groups are coloured differently (Default: NULL) |
as.percent |
Should colours represent the percentage of reads per sample (TRUE) or the actual counts (FALSE)? (Default: TRUE) |
x.axis.title |
A title for the x-axis. (Default: NULL) |
x.size |
Font size for x-labels (Default: 16) |
y.size |
Font size for y-labels (Default: 16) |
x.angle |
Angle for x-labels (Default: 90, i.e. vertical) |
legend.text.size |
Font size for legend (Default: 16) |
plot.text.size |
Font size counts within plot (Default: 3) |
line.width |
Line thickness of title box' |
x.hjust |
Horizontal justification of x axis labels (Default: 1) |
legend.position |
The position of the legend (Default: right) |
x.labels |
X-axis labels (Default: NULL, column.names of the matrix, doesn't do anything at the moment) |
legend.key.height |
The height of the legend key, as a "unit" object.
(See |
top.n |
Show the n top ranked variants. Note that if the nth and n+1th variants have equal rank, they will not be shown. (Default: 50) |
min.freq |
i ( one sample (Default: 0, i.e no frequency cutoff) |
min.count |
i (integer) only plot variants with count >= i in at least one sample (default: 0, i.e no count cutoff) |
type |
Plot either "counts" or "proportions" |
order |
A list of column names or indices specifying the order of the columns in the plot |
alleles |
A list of alleles to include. Can be used to display only alleles of interest or to order the alleles. The default value NULL means all alleles passing the frequency cut offs will be included. |
The ggplot2 plot of the variant frequencies
#Load a CrisprSet object for plotting data("gol_clutch1") # Plot the frequency heatmap plotFreqHeatmap(gol)#Load a CrisprSet object for plotting data("gol_clutch1") # Plot the frequency heatmap plotFreqHeatmap(gol)
Combines a plot of transcript structure, alleles aligned with respect to a reference genome and a heatmap of counts or proportions of each allele in a set of data.
plotVariants(obj, ...) ## S4 method for signature 'CrisprSet' plotVariants( obj, ..., txdb = NULL, add.chr = TRUE, plotAlignments.args = list(), plotFreqHeatmap.args = list() )plotVariants(obj, ...) ## S4 method for signature 'CrisprSet' plotVariants( obj, ..., txdb = NULL, add.chr = TRUE, plotAlignments.args = list(), plotFreqHeatmap.args = list() )
obj |
The object to be plotted |
... |
extra arguments for plot layout |
txdb |
GenomicFeatures:TxDb object (default: NULL) |
add.chr |
If target chromosome does not start with "chr", e.g. "chr5", add the "chr" prefix. (Default:TRUE) |
plotAlignments.args |
Extra arguments for plotAlignments |
plotFreqHeatmap.args |
Extra arguments for plotFreqHeatmap |
A ggplot2 plot of the variants
arrangePlots for general layout options
and annotateGenePlot for options relating
to the transcript plot.
#Load a CrisprSet object for plotting data("gol_clutch1") #Load the transcript db. This is a subset of the Ensembl Danio Rerio v73 gtf # for the region 18:4640000-4650000 which includes the targeted gol gene library(GenomicFeatures) fn <- system.file("extdata", "Danio_rerio.Zv9.73.gol.sqlite", package = "CrispRVariants") txdb <- loadDb(fn) # Plot the variants p <- plotVariants(gol, txdb = txdb) #In the above plot, the bottom margin is too large, the legend is #cut off, and the text within the plots should be larger. #These issues can be fixed with some adjustments: p <- plotVariants(gol, txdb = txdb, plotAlignments.args = list(plot.text.size = 4, legend.cols = 2), plotFreqHeatmap.args = list(plot.text.size = 4), left.plot.margin = grid::unit(c(0.1,0.2,0.5,1), "lines"))#Load a CrisprSet object for plotting data("gol_clutch1") #Load the transcript db. This is a subset of the Ensembl Danio Rerio v73 gtf # for the region 18:4640000-4650000 which includes the targeted gol gene library(GenomicFeatures) fn <- system.file("extdata", "Danio_rerio.Zv9.73.gol.sqlite", package = "CrispRVariants") txdb <- loadDb(fn) # Plot the variants p <- plotVariants(gol, txdb = txdb) #In the above plot, the bottom margin is too large, the legend is #cut off, and the text within the plots should be larger. #These issues can be fixed with some adjustments: p <- plotVariants(gol, txdb = txdb, plotAlignments.args = list(plot.text.size = 4, legend.cols = 2), plotFreqHeatmap.args = list(plot.text.size = 4), left.plot.margin = grid::unit(c(0.1,0.2,0.5,1), "lines"))
Function for determining whether reads should be oriented to the target strand, always displayed on the positive strand, or oriented to
rcAlns(target.strand, orientation)rcAlns(target.strand, orientation)
target.strand |
The target strand (one of "+","-","*") |
orientation |
One of "target", "opposite" and "positive" (Default: "target") |
A logical value indicating whether reads should be reverse complemented
Helen Lindsay
Short reads amplified with PCR primers should start and end at defined positions. However, the ends of an aligned read may be clipped as sequencing technologies are prone to making errors at the start and end. readsByPCRPrimer extrapolates the genomic location of entire reads from their aligned sections by adding clipped sections, then finds near exact matches to a set of PCR primers. Note that this is not always a good assumption, and is misleading in the case of chimeric reads where sections clipped in one part of a chimera are aligned in another.
readsByPCRPrimer(bam, primers, ...) ## S4 method for signature 'GAlignments,GRanges' readsByPCRPrimer( bam, primers, ..., tolerance = 0, verbose = TRUE, ignore.strand = TRUE, allow.partial = TRUE, chimera.idxs = NULL ) ## S4 method for signature 'GRanges,GRanges' readsByPCRPrimer( bam, primers, ..., tolerance = 0, verbose = TRUE, ignore.strand = TRUE, allow.partial = TRUE, chimera.idxs = NULL )readsByPCRPrimer(bam, primers, ...) ## S4 method for signature 'GAlignments,GRanges' readsByPCRPrimer( bam, primers, ..., tolerance = 0, verbose = TRUE, ignore.strand = TRUE, allow.partial = TRUE, chimera.idxs = NULL ) ## S4 method for signature 'GRanges,GRanges' readsByPCRPrimer( bam, primers, ..., tolerance = 0, verbose = TRUE, ignore.strand = TRUE, allow.partial = TRUE, chimera.idxs = NULL )
bam |
A set of aligned reads |
primers |
A set of ranges that the unclipped reads may map to |
... |
Additional arguments |
tolerance |
Number of bases by which reads and primers may differ at each end (Default: 0) |
verbose |
Print number of full and partial matches (Default: TRUE) |
ignore.strand |
Passed to |
allow.partial |
Should reads that do not match the PCR boundaries, but map to a region covered by only one primer be considered matches? (Default: TRUE) |
chimera.idxs |
Indices of chimeric reads within the bam. If specified, chimeras overlapping multiple pcr primers will be removed. |
A Hits object where "query" is the index with
respect to bam and "subject" is the index with respect to the primers.
Helen Lindsay
Trims aligned reads to one or several target regions, optionally reverse complementing the alignments.
readsToTarget(reads, target, ...) ## S4 method for signature 'GAlignments,GRanges' readsToTarget( reads, target, ..., reverse.complement = TRUE, chimeras = NULL, collapse.pairs = FALSE, use.consensus = FALSE, store.chimeras = FALSE, verbose = TRUE, name = NULL, minoverlap = NULL, orientation = c("target", "opposite", "positive") ) ## S4 method for signature 'GAlignmentsList,GRanges' readsToTarget( reads, target, ..., reference = reference, names = NULL, reverse.complement = TRUE, target.loc = 17, chimeras = NULL, collapse.pairs = FALSE, use.consensus = FALSE, orientation = c("target", "opposite", "positive"), minoverlap = NULL, verbose = TRUE ) ## S4 method for signature 'character,GRanges' readsToTarget( reads, target, ..., reference, reverse.complement = TRUE, target.loc = 17, exclude.ranges = GRanges(), exclude.names = NA, chimeras = c("count", "exclude", "ignore", "merge"), collapse.pairs = FALSE, use.consensus = FALSE, orientation = c("target", "opposite", "positive"), names = NULL, minoverlap = NULL, verbose = TRUE ) readsToTargets(reads, targets, ...) ## S4 method for signature 'character,GRanges' readsToTargets( reads, targets, ..., references, primer.ranges = NULL, target.loc = 17, reverse.complement = TRUE, collapse.pairs = FALSE, use.consensus = FALSE, ignore.strand = TRUE, names = NULL, bpparam = BiocParallel::SerialParam(), orientation = c("target", "opposite", "positive"), chimera.to.target = 5, verbose = TRUE ) ## S4 method for signature 'GAlignmentsList,GRanges' readsToTargets( reads, targets, ..., references, primer.ranges = NULL, target.loc = 17, reverse.complement = TRUE, collapse.pairs = FALSE, use.consensus = FALSE, ignore.strand = TRUE, names = NULL, bpparam = BiocParallel::SerialParam(), chimera.to.target = 5, orientation = c("target", "opposite", "positive"), verbose = TRUE )readsToTarget(reads, target, ...) ## S4 method for signature 'GAlignments,GRanges' readsToTarget( reads, target, ..., reverse.complement = TRUE, chimeras = NULL, collapse.pairs = FALSE, use.consensus = FALSE, store.chimeras = FALSE, verbose = TRUE, name = NULL, minoverlap = NULL, orientation = c("target", "opposite", "positive") ) ## S4 method for signature 'GAlignmentsList,GRanges' readsToTarget( reads, target, ..., reference = reference, names = NULL, reverse.complement = TRUE, target.loc = 17, chimeras = NULL, collapse.pairs = FALSE, use.consensus = FALSE, orientation = c("target", "opposite", "positive"), minoverlap = NULL, verbose = TRUE ) ## S4 method for signature 'character,GRanges' readsToTarget( reads, target, ..., reference, reverse.complement = TRUE, target.loc = 17, exclude.ranges = GRanges(), exclude.names = NA, chimeras = c("count", "exclude", "ignore", "merge"), collapse.pairs = FALSE, use.consensus = FALSE, orientation = c("target", "opposite", "positive"), names = NULL, minoverlap = NULL, verbose = TRUE ) readsToTargets(reads, targets, ...) ## S4 method for signature 'character,GRanges' readsToTargets( reads, targets, ..., references, primer.ranges = NULL, target.loc = 17, reverse.complement = TRUE, collapse.pairs = FALSE, use.consensus = FALSE, ignore.strand = TRUE, names = NULL, bpparam = BiocParallel::SerialParam(), orientation = c("target", "opposite", "positive"), chimera.to.target = 5, verbose = TRUE ) ## S4 method for signature 'GAlignmentsList,GRanges' readsToTargets( reads, targets, ..., references, primer.ranges = NULL, target.loc = 17, reverse.complement = TRUE, collapse.pairs = FALSE, use.consensus = FALSE, ignore.strand = TRUE, names = NULL, bpparam = BiocParallel::SerialParam(), chimera.to.target = 5, orientation = c("target", "opposite", "positive"), verbose = TRUE )
reads |
A GAlignments object, or a character vector of the filenames |
target |
A GRanges object specifying the range to narrow alignments to |
... |
Extra arguments for initialising CrisprSet |
reverse.complement |
(Default: TRUE) Should the alignments be oriented to match the strand of the target? If TRUE, targets located strand and targets on the negative strand with respect to the negative strand. If FALSE, the parameter 'orientation' must be set to determine the orientation. 'reverse.complement' will be replaced by 'orientation' in a later release. |
chimeras |
Flag to determine how chimeric reads are treated. One of "ignore", "exclude", and "merge". Default "count", "merge" not implemented yet |
collapse.pairs |
If reads are paired, should pairs be collapsed? (Default: FALSE) Note: only collapses primary alignments, and assumes that there is only one primary alignment per read. |
use.consensus |
Take the consensus sequence for non-matching pairs? If FALSE, the sequence of the first read is used. Can be very slow. (Default: FALSE) |
store.chimeras |
Should chimeric reads be stored? (Default: FALSE) |
verbose |
Print progress and statistics (Default: TRUE) |
name |
An experiment name for the reads. (Default: NULL) |
minoverlap |
Minimum number of bases the aligned read must share with the target site. If not specified, the aligned read must completely span the target region. (Default: NULL) |
orientation |
One of "target" (reads are displayed on the same strand as the target) "opposite" (reads are displayed on the opposite) strand from the target or "positive" (reads are displayed on the forward strand regardless of the strand of the target) (Default:"target") |
reference |
The reference sequence |
names |
Experiment names for each bam file. If not supplied, filenames are used. |
target.loc |
The zero point for renumbering (Default: 17) |
exclude.ranges |
Ranges to exclude from consideration, e.g. homologous to a pcr primer. |
exclude.names |
Alignment names to exclude |
targets |
A set of targets to narrow reads to |
references |
A set of reference sequences matching the targets. References for negative strand targets should be on the negative strand. |
primer.ranges |
A set of GRanges, corresponding to the targets. Read lengths are typically greater than target regions, and it can be that reads span multiple targets. If primer.ranges are available, they can be used to assign such reads to the correct target. |
ignore.strand |
Should strand be considered when finding overlaps?
(See |
bpparam |
A BiocParallel parameter for parallelising across reads.
Default: no parallelisation. (See |
chimera.to.target |
Number of bases that may separate a chimeric read set from the target.loc for it to be assigned to the target. (Default: 5) |
(signature("GAlignments", "GRanges")) A CrisprRun object
(signature("character", "GRanges")) A CrisprSet object
Helen Lindsay
# Load the metadata table md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants") md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE) # Get bam filenames and their full paths bam_fnames <- sapply(md$bam.filename, function(fn){ system.file("extdata", fn, package = "CrispRVariants")}) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_set <- readsToTarget(bam_fnames, target = gd, reference = reference, names = md$experiment.name, target.loc = 17)# Load the metadata table md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants") md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE) # Get bam filenames and their full paths bam_fnames <- sapply(md$bam.filename, function(fn){ system.file("extdata", fn, package = "CrispRVariants")}) reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG") gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399), strand = "+") crispr_set <- readsToTarget(bam_fnames, target = gd, reference = reference, names = md$experiment.name, target.loc = 17)
Includes options for excluding reads either by name or range. The latter is useful if chimeras are excluded. Reads are excluded before chimeras are detected, thus a chimeric read consisting of two sections, one of which overlaps an excluded region, will not be considered chimeric. Chimeric reads can be ignored, excluded, which means that all sections of a chimeric read will be removed, or merged, which means that chimeras will be collapsed into a single read where possible. (Not implemented yet) If chimeras = "merge", chimeric reads are merged if all segments
readTargetBam( file, target, exclude.ranges = GRanges(), exclude.names = NA, chimera.to.target = 5, chimeras = c("count", "ignore", "exclude", "merge"), max.read.overlap = 10, max.unmapped = 4, by.flag = TRUE, verbose = TRUE )readTargetBam( file, target, exclude.ranges = GRanges(), exclude.names = NA, chimera.to.target = 5, chimeras = c("count", "ignore", "exclude", "merge"), max.read.overlap = 10, max.unmapped = 4, by.flag = TRUE, verbose = TRUE )
file |
The name of a bam file to read in |
target |
A GRanges object containing a single target range |
exclude.ranges |
A GRanges object of regions that should not be counted, e.g. primer or cloning vector sequences that have a match in the genome |
exclude.names |
A vector of read names to exclude. |
chimera.to.target |
Maximum distance between endpoints of chimeras and target.loc for assigning chimeras to targets (default: 5) |
chimeras |
Flag to determine how chimeric reads are treated. One of "ignore", "exclude", "count" and "merge". Default "ignore". |
max.read.overlap |
Maximum number of bases mapped to two positions for chimeras to be merged (Default: 10) |
max.unmapped |
Maximum number of bases that are unmapped for chimeras to be merged (Default: 4) |
by.flag |
Is the supplementary alignment flag set? Used for identifying chimeric alignments, function is much faster if TRUE. Not all aligners set this flag. If FALSE, chimeric alignments are identified using read names (Default: TRUE) |
verbose |
Print stats about number of alignments read and filtered. (Default: TRUE) |
A GenomicAlignments::GAlignment obj
Reconstruct the reference sequence from alignments reads using the CIGAR
refFromAlns(alns, location, ...) ## S4 method for signature 'GAlignments,ANY' refFromAlns(alns, location, ..., keep.names = FALSE) ## S4 method for signature 'GAlignments,GRanges' refFromAlns(alns, location, ...)refFromAlns(alns, location, ...) ## S4 method for signature 'GAlignments,ANY' refFromAlns(alns, location, ..., keep.names = FALSE) ## S4 method for signature 'GAlignments,GRanges' refFromAlns(alns, location, ...)
alns |
Alignments to use for inferring the reference sequence |
location |
The location to infer the reference for. |
... |
additional arguments |
keep.names |
Should read names be added to the result if present? (Default: FALSE) |
The reference sequences corresponding to the provided alignments
A DNAStringSet (signature = c("GAlignments", "ANY"))
A DNAString (signature = c("GAlignments", "GRanges"))
Helen Lindsay
bam <- system.file("extdata", "bam/ab1_ptena_wildtype_looking_embryo_1_s.bam", package = "CrispRVariants") alns <- GenomicAlignments::readGAlignments(bam, param = Rsamtools::ScanBamParam(tag = "MD", what = "seq")) # To get the reference sequence from the a given location: location <- GenomicRanges::GRanges("chr17", IRanges::IRanges(23648420,23648430)) refFromAlns(alns, location = location)bam <- system.file("extdata", "bam/ab1_ptena_wildtype_looking_embryo_1_s.bam", package = "CrispRVariants") alns <- GenomicAlignments::readGAlignments(bam, param = Rsamtools::ScanBamParam(tag = "MD", what = "seq")) # To get the reference sequence from the a given location: location <- GenomicRanges::GRanges("chr17", IRanges::IRanges(23648420,23648430)) refFromAlns(alns, location = location)
For example, the string "20M5D15M" would become "15M5D20M"
reverseCigar(cigars)reverseCigar(cigars)
cigars |
the cigar strings. |
The reversed cigar string
Finds and removes sets of chimeric read alignments that overlap more than one guide, i.e. that cannot be unambiguously assigned to a single guide.
rmMultiPCRChimera(readnames, pcrhits, chimera_idxs, ...) ## S4 method for signature 'character,Hits,integer' rmMultiPCRChimera(readnames, pcrhits, chimera_idxs, ..., verbose = TRUE)rmMultiPCRChimera(readnames, pcrhits, chimera_idxs, ...) ## S4 method for signature 'character,Hits,integer' rmMultiPCRChimera(readnames, pcrhits, chimera_idxs, ..., verbose = TRUE)
readnames |
A set of read names, used for identifying chimeric read sets |
pcrhits |
A mapping between indices of reads and a set of pcr primers |
chimera_idxs |
location of chimeric reads within the bam |
... |
Additional arguments |
verbose |
Display information about the chimeras (Default: TRUE) |
pcrhits, with chimeric reads mapping to different primers omitted.
Helen Lindsay
select CIGAR operations in a region of interest.
selectOps(cigar, ...) ## S4 method for signature 'character' selectOps( cigar, ..., ops = GenomicAlignments::CIGAR_OPS, op.regions = NULL, pos = 1L )selectOps(cigar, ...) ## S4 method for signature 'character' selectOps( cigar, ..., ops = GenomicAlignments::CIGAR_OPS, op.regions = NULL, pos = 1L )
cigar |
CIGAR strings |
... |
Extra arguments (Not currently used) |
ops |
CIGAR operations to consider (Default: all) |
op.regions |
(GRanges) Return operations only in these regions |
pos |
An offset for the cigar ranges |
A GRanges list of opertion locations in reference space with a metadata column for the operation width in query space.
Helen Lindsay
Creates a one-to-one text alignment of a set of cigar strings with respect to the reference sequence by collapsing insertions and introducing gaps across deletions.
When genomic coordinates for the alignment start and the target region are provided, aligned sequences are cropped to the target region
Given a character vector of pairwise alignments and a region to display, trims alignments to the display regions, joined by a separator "join". Alignments should be equal length, e.g. created by seqsToAln
seqsToAln( cigar, dnaseq, target, del_char = "-", aln_start = NULL, reverse_complement = FALSE, allow_partial = FALSE ) selectAlnRegions( alns, reference, target, keep, join = "/ %s /", border.gaps = FALSE )seqsToAln( cigar, dnaseq, target, del_char = "-", aln_start = NULL, reverse_complement = FALSE, allow_partial = FALSE ) selectAlnRegions( alns, reference, target, keep, join = "/ %s /", border.gaps = FALSE )
cigar |
A list of cigar strings to align |
dnaseq |
The set of sequences corresponding to the cigars, as Biostrings::DNAStrings |
target |
The target region to return, as GRanges. Sequences overlapping the target region are trimmed to exactly match it. |
del_char |
The character to represent deleted bases. Default "-" |
aln_start |
Genomic start locations of aligned sequences. Should be used in conjunction with target_start and target_end. |
reverse_complement |
(Default: FALSE) |
allow_partial |
Are alignments that do not span the target region allowed? (Default: FALSE) |
alns |
Character vector of pairwise alignments, with insertions removed |
reference |
Reference sequence |
keep |
Region to display, relative to the target region, i.e. not genomic coords (IRanges or GRanges) |
join |
character(1) String used for joining alignment segments. Can accept a placeholder to fill in the number of bases deleted with " deleted |
border.gaps |
(logical(1)) Should bases deleted from the borders be shown? (Default: FALSE) |
The sequences with insertions collapsed and deletions padded
A list of the truncated alignments (alns) and reference (ref)
Helen Lindsay
Sets tile colours for plotAlignments with a
DNA alphabet
setDNATileColours(m)setDNATileColours(m)
m |
A matrix with a column named "value" of the characters at each tile position. |
A matrix with additional columns specifying tile and text colours
Helen Lindsay
Sets tile colours for plotAlignments with a
DNA alphabet.
setMismatchTileColours(m)setMismatchTileColours(m)
m |
A data frame of nucleotides and plotting locations, e.g. created
by |
A matrix with additional columns specifying tile and text colours
Helen Lindsay
Orders and transforms a reference sequence and a set of aligned sequences
into long format, i.e. one observation (tile position) per row. Used internally by
plotAlignments.
transformAlnsToLong(ref, alns, add.other = FALSE)transformAlnsToLong(ref, alns, add.other = FALSE)
ref |
The reference sequence |
alns |
Character vector of aligned sequences |
add.other |
Add a blank row labelled "Other" (Default: FALSE) |
A matrix of characters and plotting locations
Helen Lindsay
Returns a matrix of counts where rows are sequence variants and columns are samples
variantCounts(obj, ...) ## S4 method for signature 'CrisprSet' variantCounts( obj, ..., top.n = NULL, min.freq = 0, min.count = 1, include.chimeras = TRUE, include.nonindel = TRUE, result = "counts", filter.vars = NULL )variantCounts(obj, ...) ## S4 method for signature 'CrisprSet' variantCounts( obj, ..., top.n = NULL, min.freq = 0, min.count = 1, include.chimeras = TRUE, include.nonindel = TRUE, result = "counts", filter.vars = NULL )
obj |
An object containing variant counts |
... |
Additional arguments |
top.n |
(Integer n) If specified, return variants ranked at least n according to frequency across all samples (Default: 0, i.e. no cutoff) |
min.freq |
(Float n least one sample (Default: 0) |
min.count |
(Integer n) Return variants with count greater than n in at least one sample (Default: 0) |
include.chimeras |
Should chimeric reads be included in the counts table? (Default: TRUE) |
include.nonindel |
Should sequences without indels be returned? (Default:TRUE) |
result |
Return variants as either counts ("counts", default) or proportions ("proportions") |
filter.vars |
Labels of variants alleles to remove (Default: NULL) |
A matrix of counts where rows are variants and columns are samples
Helen Lindsay
data("gol_clutch1") #Return a matrix of the 5 most frequent variants variantCounts(gol, top.n = 5)data("gol_clutch1") #Return a matrix of the 5 most frequent variants variantCounts(gol, top.n = 5)
Used by abifToFastq to write sanger sequences to fastq format As abifToFastq appends output to files, writeFastq checks that sequence names are unique. This function is faster with checking switched off.
writeFastq(outf, vals, allow_spaces = FALSE, check = TRUE)writeFastq(outf, vals, allow_spaces = FALSE, check = TRUE)
outf |
Name of fastq file to append sequence |
vals |
A list containing entries named "seq" (sequence) and "quals" (quality scores, in ASCII format) |
allow_spaces |
Should spaces in the sequence name be substituted with underscores? TRUE or FALSE |
check |
Check whether reads with the same name already exist in the output fastq. (Default: TRUE) |
None. The sequences in "vals" are written to outf
Helen Lindsay