#Abstract
A number of recently developed next-generation sequencing based methods (e.g. PAR-CLIP, Bisulphite sequencing, RRBS) specifically induce nucleotide substitutions within the short reads with respect to the reference genome. wavClusteR provides functions for the analysis of the data obtained by such methods with a major focus on PAR-CLIP. The package leverages on experimentally induced substitutions to identify high confidence signals (e.g. RNA-binding sites) in the data. A wavClusteR workflow consists of two steps:
The package supports multicore computing. For a detailed description of the method please refer to Sievers et al., 2012; Comoglio et al., 2015.
#Preparing the input
wavClusteR expects a sorted and indexed BAM file as input. A streamlined workflow to generate the required input from a fastq file is outlined below (line 1 is pseudo code, replace it with the aligner specific syntax).
#ALIGN:
sample.fastq -> sample.sam
#CONVERT:
samtools view -b -S sample.sam -o sample.bam
#SORT:
samtools sort sample.bam sample_sorted
#INDEXING:
samtools index sample_sorted.bamsamtools view from SAMtoolssamtools sortsamtools index.##Example dataset
wavClusteR provides a chunk of a human Argonaute 2 (AGO2) PAR-CLIP data set from Kishore et al., 2011. Reads in the chunk map to the genomic interval chrX:23996166-24023263. This data set is used below to illustrate a workflow for PAR-CLIP data analysis.
#A workflow for PAR-CLIP data analysis
##Reading sorted BAM files
A sorted and indexed BAM file can be loaded into the R session with readSortedBam. This function extracts aligned reads, sequences and the mismatch MD field, and returns a GRanges object.
## Loading required package: GenomicRanges
## Loading required package: stats4
## Loading required package: BiocGenerics
## Loading required package: generics
##
## Attaching package: 'generics'
## The following objects are masked from 'package:base':
##
## as.difftime, as.factor, as.ordered, intersect, is.element, setdiff,
## setequal, union
##
## Attaching package: 'BiocGenerics'
## The following objects are masked from 'package:stats':
##
## IQR, mad, sd, var, xtabs
## The following object is masked from 'package:utils':
##
## data
## The following objects are masked from 'package:base':
##
## anyDuplicated, aperm, append, as.data.frame, basename, cbind,
## colnames, dirname, do.call, duplicated, eval, evalq, Filter, Find,
## get, grep, grepl, is.unsorted, lapply, Map, mapply, match, mget,
## order, paste, pmax, pmax.int, pmin, pmin.int, Position, rank,
## rbind, Reduce, rownames, sapply, saveRDS, scale, sequence, table,
## tapply, transform, unique, unsplit, which.max, which.min
## Loading required package: S4Vectors
##
## Attaching package: 'S4Vectors'
## The following object is masked from 'package:utils':
##
## findMatches
## The following objects are masked from 'package:base':
##
## expand.grid, I, unname
## Loading required package: IRanges
## Loading required package: Seqinfo
## Loading required package: Rsamtools
## Loading required package: Biostrings
## Loading required package: XVector
##
## Attaching package: 'Biostrings'
## The following object is masked from 'package:base':
##
## strsplit
filename <- system.file( "extdata", "example.bam", package = "wavClusteR" )
Bam <- readSortedBam(filename = filename)
Bam## GRanges object with 5358 ranges and 2 metadata columns:
## seqnames ranges strand | qseq
## <Rle> <IRanges> <Rle> | <DNAStringSet>
## [1] chrX 24001819-24001844 - | CAGAGATAAA...TATTTTAAAG
## [2] chrX 24001819-24001843 - | CAGAGATAAA...ATATTTTAAG
## [3] chrX 24001834-24001863 - | ATATTTTAGA...ATTTTATTTA
## [4] chrX 24001836-24001865 - | TTTTTAAAGA...TTTATTTAAA
## [5] chrX 24001841-24001876 - | AAAGATTAAA...TTTTCTTCAT
## ... ... ... ... . ...
## [5354] chrX 24023018-24023051 - | GTTTCACAGC...AAAAATATGT
## [5355] chrX 24023018-24023051 - | GTTTCACAGC...AAAAATATGT
## [5356] chrX 24023019-24023051 - | TTTCACAGCG...AAAAATATGT
## [5357] chrX 24023019-24023051 - | TTTCACAGCG...AAAAATATGT
## [5358] chrX 24023067-24023090 - | CAAAGGCGCG...GGTTTATTTT
## tag.MD
## <character>
## [1] 26
## [2] 24A0
## [3] 8A21
## [4] 0A13A15
## [5] 24A11
## ... ...
## [5354] 10A23
## [5355] 10A23
## [5356] 9A23
## [5357] 9A23
## [5358] 9A14
## -------
## seqinfo: 25 sequences from an unspecified genome; no seqlengths
##Extracting informative genomic positions
Prior to model fitting, genome-wide substitutions need to be identified and filtered based on a coverage threshold. The getAllSub function identifies all genomic positions exhibiting at least one substitution and coverage above this threshold.
## Loading required package: doMC
## Considering substitutions, n = 497, processing in 1 chunks
## Warning: executing %dopar% sequentially: no parallel backend registered
## chunk #: 1
## considering the + strand
## Computing local coverage at substitutions...
## considering the - strand
## Computing local coverage at substitutions...
## GRanges object with 6 ranges and 3 metadata columns:
## seqnames ranges strand | substitutions coverage count
## <Rle> <IRanges> <Rle> | <character> <numeric> <integer>
## [1] chrX 24001959 - | TC 17 2
## [2] chrX 24001973 - | TC 17 12
## [3] chrX 24001977 - | TC 13 1
## [4] chrX 24002046 - | TC 10 1
## [5] chrX 24002057 - | TC 10 6
## [6] chrX 24002147 - | TC 22 3
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
The function returns a GRanges object specifying genomic position, strand, substitution type (e.g. “TC”: T in the reference genome; C in the read), strand-specific coverage and number of observed substitutions at the position.
###How to choose the coverage threshold?
The coverage threshold minCov defines the genomic
positions to be used for parameter estimation, thus providing a means to
tune the stringency of the analysis. Currently,
wavClusteR does not allow to learn this threshold from
the data. However, since the model is based on relative substitution
frequencies, the value of minCov will influence the
variance of the estimated parameters. Therefore, values smaller than
default (minCov=10) are not recommended.
##Inspecting the substitutions profile (diagnostic I)
Once all substitutions are computed, a diagnostic substitution profile can be plotted with plotSubstitutions.
The function returns a barplot showing the total number of genomic positions that exhibit a given type of substitution and highlights the substitution type that is expected to be generated by the experimental procedure. The percentage of substitution of this type is also shown. This plot can be readily used to assess the quality of the sequenced libraries and can be used to compare different data sets generated under the same experimental condition.
##Estimating the model
wavClusteR uses the identified genomic positions to learn a non-parametric mixture model discriminating PAR-CLIP-specific from extrinsic transitions. Model parameters are estimated by fitMixtureModel.
The function returns a list of:
As the small size of our example data set does not to estimate the model reliably, the mixture model for the entire AGO2 dataset has been precomputed and is provided by the package.
## List of 5
## $ l1: Named num 0.181
## ..- attr(*, "names")= chr "TC"
## $ l2: Named num 0.819
## ..- attr(*, "names")= chr "TC"
## $ p : num [1:999] 7.52 9.44 10.05 10.38 10.48 ...
## $ p1: num [1:999] 89.6 64.4 50.4 41.5 35.3 ...
## $ p2: num [1:999] 0 0 1.14 3.51 5 ...
##Inspecting the model fit (diagnostic II)
The model fit can be inspected using getExpInterval.
## $supportStart
## [1] 0.007
##
## $supportEnd
## [1] 0.98
The function returns two diagnostic plots. The first plot illustrates the estimated densities \(p\), \(p_1\) and \(p_2\), and log odds
\[ o=
The second plot shows the resulting posterior class probability, i.e. the probability that a given relative substitution frequency (RSF, horizontal axis) has been induced by PAR-CLIP. The area under the curve corresponding to the returned RSF interval is colored, and the RSF interval indicated. By default, getExpInterval returns the RSF interval according to the Bayes classifier, i.e. a posterior probability cutoff of 0.5. However, the user can specify a custom RSF interval:
By means of the rightProb and leftProb parameters, e.g.
## $supportStart
## [1] 0.076
##
## $supportEnd
## [1] 0.905By inspecting the posterior class probability density and passing the RSF interval boundaries when calling high-confidence substitutions (see point 6).
Finally, the model can be used to produce further diagnostic plots. Particularly, the total number of reads exhibitng a given substitution and an RSF-based partitioning of genomic positions with substitutions can be obtained by
##Selecting high-confidence PAR-CLIP induced transitions
The RSF support is used to filter all observed transitions to define
a set of high-confidence, PAR-CLIP induced transitions. These are
identified by getHighConfSub. The function returns a
GRanges object with genomic position, strand, strand-specific coverage,
occurence (count), and relative substitution frequency (rsf) for each
high-confidence substitution. In a call to
getHighConfSub, the RSF interval returned by
getExpInterval can be supplied as support
argument directly
highConfSub <- getHighConfSub( countTable,
support = support,
substitution = "TC" )
head( highConfSub ) ## GRanges object with 6 ranges and 3 metadata columns:
## seqnames ranges strand | coverage count rsf
## <Rle> <IRanges> <Rle> | <numeric> <integer> <numeric>
## [1] chrX 24001959 - | 17 2 0.1176471
## [2] chrX 24001973 - | 17 12 0.7058824
## [3] chrX 24001977 - | 13 1 0.0769231
## [4] chrX 24002046 - | 10 1 0.1000000
## [5] chrX 24002057 - | 10 6 0.6000000
## [6] chrX 24002147 - | 22 3 0.1363636
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
or, alternatively, by specifying supportStart and
supportEnd, which define the range of RSF of interest.
highConfSub <- getHighConfSub( countTable,
supportStart = 0.2,
supportEnd = 0.7,
substitution = "TC" )
head( highConfSub )##Identifying protein binding sites (clusters)
Binding sites (clusters) are identified by getClusters. The function takes high-confidence substitution sites and the coverage function
## integer-Rle of length 24023090 with 914 runs
## Lengths: 24001818 15 2 5 ... 1 15 24
## Values : 0 2 3 4 ... 21 0 1
as an input. From package version 2.0, cluster boundaries are resolved using the Mini-Rank Norm (MRN) Comoglio et al., 2015, which is up to 10x faster and more sensitive than the previously adopted algorithm based on continuous wavelet transform of the coverage function Sievers et al., 2012. Briefly, the MRN algorithm finds an optimal cluster boundary for each high-confidence substitution by solving an optimization problem that integrates prior knowledge on the geometry of PAR-CLIP clusters. Two options are available:
Hard thresholding, i.e. the coverage function is denoised using a
global threshold. Empirically, minCov=1 worked well on all
tested datasets for which minCov = 10. Alternatively, 10%
of the mode of the coverage distribution at high-confidence
substitutions represents a possible choice.
clusters <- getClusters( highConfSub = highConfSub,
coverage = coverage,
sortedBam = Bam,
threshold = 1,
cores = 1 )## Computing start/end read positions
## Number of chromosomes exhibiting high confidence transitions: 1
## Loading required package: doMC
## ...Processing = chrX
## GRanges object with 184 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chrX 24001953-24001975 -
## [2] chrX 24001953-24001976 -
## [3] chrX 24001953-24001977 -
## [4] chrX 24002044-24002057 -
## [5] chrX 24002044-24002057 -
## ... ... ... ...
## [180] chrX 24006559-24006573 -
## [181] chrX 24006560-24006565 -
## [182] chrX 24007061-24007068 -
## [183] chrX 24007061-24007083 -
## [184] chrX 24007061-24007083 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengthsLocal thresholding, based on a global estimation of background levels via a Gaussian mixture model. Omitting the threshold parameter in the call to getClusters enables local thresholding
clusters <- getClusters( highConfSub = highConfSub,
coverage = coverage,
sortedBam = Bam,
cores = 1 )## Computing start/end read positions
## Learning background threshold by fitting a GMM
## Estimated threshold (% of maximum local coverage differences) from 184 sampled transitions: 5.26
## Number of chromosomes exhibiting high confidence transitions: 1
## Loading required package: doMC
## ...Processing = chrX
## GRanges object with 184 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chrX 24001953-24001959 -
## [2] chrX 24001963-24001973 -
## [3] chrX 24001972-24001977 -
## [4] chrX 24002044-24002057 -
## [5] chrX 24002046-24002057 -
## ... ... ... ...
## [180] chrX 24006569-24006574 -
## [181] chrX 24006569-24006574 -
## [182] chrX 24007062-24007068 -
## [183] chrX 24007073-24007076 -
## [184] chrX 24007074-24007077 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths##Merging clusters
Once the clusters are identified, the corresponding genomic regions can be merged in a strand-specific manner. Statistics for each merged cluster (a wavCluster), can be computed using filterClusters.
## Loading required package: BSgenome.Hsapiens.UCSC.hg19
## Loading required package: BSgenome
## Loading required package: BiocIO
## Loading required package: rtracklayer
wavclusters <- filterClusters( clusters = clusters,
highConfSub = highConfSub,
coverage = coverage,
model = model,
genome = Hsapiens,
refBase = "T",
minWidth = 12)## Computing log odds...
## Refining cluster sizes...
## Combining clusters...
## Quantifying transitions within clusters...
## Computing statistics...
## | |== | 2% | |=== | 5% | |===== | 7% | |====== | 9% | |======== | 11% | |========== | 14% | |=========== | 16% | |============= | 18% | |============== | 20% | |================ | 23% | |================== | 25% | |=================== | 27% | |===================== | 30% | |====================== | 32% | |======================== | 34% | |========================= | 36% | |=========================== | 39% | |============================= | 41% | |============================== | 43% | |================================ | 45% | |================================= | 48% | |=================================== | 50% | |===================================== | 52% | |====================================== | 55% | |======================================== | 57% | |========================================= | 59% | |=========================================== | 61% | |============================================= | 64% | |============================================== | 66% | |================================================ | 68% | |================================================= | 70% | |=================================================== | 73% | |==================================================== | 75% | |====================================================== | 77% | |======================================================== | 80% | |========================================================= | 82% | |=========================================================== | 84% | |============================================================ | 86% | |============================================================== | 89% | |================================================================ | 91% | |================================================================= | 93% | |=================================================================== | 95% | |==================================================================== | 98% | |======================================================================| 100%
## Consolidating results...
## GRanges object with 44 ranges and 7 metadata columns:
## seqnames ranges strand | Ntransitions MeanCov NbasesInRef
## <Rle> <IRanges> <Rle> | <integer> <numeric> <integer>
## [1] chrX 24001950-24001980 - | 3 14.87097 12
## [2] chrX 24002044-24002057 - | 2 9.64286 4
## [3] chrX 24002139-24002161 - | 3 21.95652 8
## [4] chrX 24002323-24002352 - | 4 9.76667 11
## [5] chrX 24002670-24002687 - | 3 14.33333 7
## ... ... ... ... . ... ... ...
## [40] chrX 24005918-24005971 - | 5 15.1481 15
## [41] chrX 24006171-24006191 - | 3 11.1905 7
## [42] chrX 24006537-24006554 - | 3 32.0000 5
## [43] chrX 24006557-24006577 - | 3 26.8095 7
## [44] chrX 24007059-24007081 - | 3 16.3043 7
## CrossLinkEff Sequence SumLogOdds RelLogOdds
## <numeric> <character> <numeric> <numeric>
## [1] 0.25 CGGCTTGGGAAAAATTACCT.. 7.14200 0.595167
## [2] 0.50 CTAGGATTATTTGA 4.97271 1.243178
## [3] 0.38 TTAGGTAGAAAATAACCTCT.. 7.45739 0.932174
## [4] 0.36 AATATTGAAGTTATACGGTG.. 10.53464 0.957695
## [5] 0.43 TTAAATTATGAATTCTCA 7.79538 1.113626
## ... ... ... ... ...
## [40] 0.33 CAATGTTAGACCAATGGCTT.. 12.92271 0.861514
## [41] 0.43 AGGATGGAATCGCTGTAATGA 7.46896 1.066995
## [42] 0.60 GTGGAAGATGAGGTGATT 7.63260 1.526520
## [43] 0.43 ACCGGTGATAAACAATTTGTT 7.45765 1.065378
## [44] 0.43 TGCTGGTGAACATTCTGAAA.. 8.29820 1.185456
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
The function takes as input the following elements:
and it returns a GRanges object with the following metadata:
refBase (NbasesInRef)The relative log odds can be used to rank clusters according to statistical confidence.
##Post-processing of the binding sites
wavClusteR provides a number of functions (summarized in the table below) for post-processing of the identified binding sites.
| Task | Function | Output format |
|---|---|---|
| Export all identified substitutions or high-confidence substitutions | exportHighConfSub | BED |
| Export clusters | exportClusters | BED |
| Export coverage function | exportCoverage | BigWig |
| Visualize the size distribution of wavClusters | plotSizeDistribution | histogram |
| Annotate clusters with respect to genomic features (e.g. CDS, introns, 3’-UTRs, 5’-UTRs) in a strand-specific manner | annotateClusters | dot chart, vector |
| Compute metagene profiles of wavClusters, where the density of wavClusters is represented as a function of a reference genomic coordinates | getMetaGene | line plot, vector |
| Compute metaTSS profiles based on all aligned reads in the input BAM file | line plot, vector | |
| Visualize wavClusteR statistics and meta data to learn pairwise relationships between variables | plotStatistics | pairs plot |
###Exporting substitutions, wavClusters and coverage function
High-confidence substitutions can be exported with
exportHighConfSub( highConfSub = highConfSub,
filename = "hcTC.bed",
trackname = "hcTC",
description = "hcTC" )where trackname and description set the
corresponding attributes in the UCSC BED file. By replacing
highConfSub with another set of substitutions (e.g. all
identified substitutions of a given type), those can be exported
likewise.
wavClusters can be exported with
exportClusters( clusters = wavclusters,
filename = "wavClusters.bed",
trackname = "wavClusters",
description = "wavClusters" )and the coverage function can be exported with
###Annotating binding sites
wavClusters can be annotated with respect to genomic features using annotateClusters. This function generates a strand-specific dot chart representing wavClusters annotation. annotateClusters takes as an input the wavClusters and a transcriptDB object containing transcript annotations. The latter can be generated using makeTxDbFromUCSC (GenomicFeatures package)
and is automatically downloaded by annotateClusters if missing.
Then, the annotateClusters can be called as follows
Four dot charts are returned by the function showing the percentage of clusters mapping to different transcript features localized on the same (sense) or on the opposite (antisense) strand, the relative sequence length of different compartments relative to the total transcriptome length and the normalized enrichment of clusters across functional compartments.
Note: multiple hits, i.e. wavClusters that overlap with more than one genomic feature, are reported as “multiple”, whereas wavClusters that map outside of the considered features are labeled as “other”. The latter are then annotated with respect to features on the antisense strand.
###Computing cluster metagene profiles
A graphical representation of the density of wavClusters as a function of a binning of genomic coordinates across all annotated genes can be obtained using the getMetaGene function.
getMetaGene( clusters = wavclusters,
txDB = txDB,
upstream = 1e3,
downstream = 1e3,
nBins = 40,
nBinsUD = 10,
minLength = 1,
plot = TRUE,
verbose = TRUE ) In this example, genes were divided in 40 bins (nBins)
and an upstream/downstream region spanning 1kb
was considered. This region was subdivided in 10 bins
(nBinsUD). No restriction on gene length was applied
(minLength). getMetaGene returns a numeric
vector of length nBins + 2*nBinsUD with
normalized counts, which can be used, for instance, to compare the
distribution of wavClusters across several PAR-CLIP samples.
In addition to metagene profiles, meta transcription start site (TSS) profiles based on all mapped reads can be generated using getMetaTSS.
getMetaTSS( sortedBam = Bam,
txDB = txDB,
upstream = 1e3,
downstream = 1e3,
nBins = 40,
unique = FALSE,
plot = TRUE,
verbose = TRUE ) Here, the upstream and downstream
parameters control the width of the window to be considered, and
nBins controls the resolution of the profile. If
unique=TRUE, then overlapping windows are discarded.
getMetaTSS returns a numeric vector of length
nBins with normalized read counts.
###Computing the size distribution of wavClusters
The size distribution of wavClusters can be visualized by
## `geom_smooth()` using method = 'loess' and formula = 'y ~ x'
###Visualizing wavCluster statistics and meta data
Cluster statistics can be plotted as pairs plot using
#Session Info
## R version 4.6.0 (2026-04-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] BSgenome.Hsapiens.UCSC.hg19_1.4.3 BSgenome_1.81.0
## [3] rtracklayer_1.73.0 BiocIO_1.23.3
## [5] wavClusteR_2.47.0 Rsamtools_2.29.0
## [7] Biostrings_2.81.2 XVector_0.53.0
## [9] GenomicRanges_1.65.0 Seqinfo_1.3.0
## [11] IRanges_2.47.2 S4Vectors_0.51.3
## [13] BiocGenerics_0.59.6 generics_0.1.4
## [15] BiocStyle_2.41.0
##
## loaded via a namespace (and not attached):
## [1] DBI_1.3.0 bitops_1.0-9
## [3] httr2_1.2.2 gridExtra_2.3
## [5] biomaRt_2.69.0 rlang_1.2.0
## [7] magrittr_2.0.5 ade4_1.7-24
## [9] matrixStats_1.5.0 compiler_4.6.0
## [11] RSQLite_3.53.1 mgcv_1.9-4
## [13] GenomicFeatures_1.65.0 txdbmaker_1.9.0
## [15] png_0.1-9 vctrs_0.7.3
## [17] stringr_1.6.0 pkgconfig_2.0.3
## [19] crayon_1.5.3 fastmap_1.2.0
## [21] dbplyr_2.5.2 backports_1.5.1
## [23] labeling_0.4.3 rmarkdown_2.31
## [25] UCSC.utils_1.9.0 bit_4.6.0
## [27] xfun_0.58 cachem_1.1.0
## [29] cigarillo_1.3.0 seqinr_4.2-44
## [31] GenomeInfoDb_1.49.1 jsonlite_2.0.0
## [33] progress_1.2.3 blob_1.3.0
## [35] DelayedArray_0.39.3 BiocParallel_1.47.0
## [37] prettyunits_1.2.0 parallel_4.6.0
## [39] cluster_2.1.8.2 R6_2.6.1
## [41] bslib_0.11.0 stringi_1.8.7
## [43] RColorBrewer_1.1-3 rpart_4.1.27
## [45] jquerylib_0.1.4 Rcpp_1.1.1-1.1
## [47] SummarizedExperiment_1.43.0 iterators_1.0.14
## [49] knitr_1.51 base64enc_0.1-6
## [51] BiocBaseUtils_1.15.1 splines_4.6.0
## [53] Matrix_1.7-5 nnet_7.3-20
## [55] tidyselect_1.2.1 rstudioapi_0.18.0
## [57] abind_1.4-8 yaml_2.3.12
## [59] codetools_0.2-20 curl_7.1.0
## [61] lattice_0.22-9 tibble_3.3.1
## [63] withr_3.0.2 Biobase_2.73.1
## [65] KEGGREST_1.53.0 S7_0.2.2
## [67] evaluate_1.0.5 foreign_0.8-91
## [69] BiocFileCache_3.3.0 mclust_6.1.2
## [71] filelock_1.0.3 pillar_1.11.1
## [73] BiocManager_1.30.27 MatrixGenerics_1.25.0
## [75] checkmate_2.3.4 foreach_1.5.2
## [77] RCurl_1.98-1.18 hms_1.1.4
## [79] ggplot2_4.0.3 scales_1.4.0
## [81] glue_1.8.1 Hmisc_5.2-5
## [83] maketools_1.3.2 tools_4.6.0
## [85] sys_3.4.3 data.table_1.18.4
## [87] GenomicAlignments_1.49.0 buildtools_1.0.0
## [89] XML_3.99-0.23 grid_4.6.0
## [91] AnnotationDbi_1.75.0 colorspace_2.1-2
## [93] nlme_3.1-169 htmlTable_2.5.0
## [95] restfulr_0.0.16 Formula_1.2-5
## [97] cli_3.6.6 rappdirs_0.3.4
## [99] S4Arrays_1.13.0 dplyr_1.2.1
## [101] gtable_0.3.6 sass_0.4.10
## [103] digest_0.6.39 SparseArray_1.13.2
## [105] rjson_0.2.23 htmlwidgets_1.6.4
## [107] farver_2.1.2 memoise_2.0.1
## [109] htmltools_0.5.9 lifecycle_1.0.5
## [111] httr_1.4.8 bit64_4.8.2
## [113] MASS_7.3-65
#References
Comoglio, F., Sievers, C. & Paro, R. (2015) Sensitive and highly resolved inidentification of RNA-protein interaction sites in PAR-CLIP data. BMC Bioinformatics, 16, 32
Langmead,B., Trapnell,C., Pop,M. & Salzberg,S.L. (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25
Kishore, S. et al. (2011) A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nature Methods 8(7), 559-564
Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F. & Paro, R. (2012) Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Res 40(2), e160