Title: | Importing from tRNAdb and mitotRNAdb as GRanges objects |
---|---|
Description: | tRNAdbImport imports the entries of the tRNAdb and mtRNAdb (http://trna.bioinf.uni-leipzig.de) as GRanges object. |
Authors: | Felix G.M. Ernst [aut, cre] |
Maintainer: | Felix G.M. Ernst <[email protected]> |
License: | GPL-3 + file LICENSE |
Version: | 1.25.0 |
Built: | 2024-11-18 04:41:02 UTC |
Source: | https://github.com/bioc/tRNAdbImport |
title
TRNA_DB_URL TRNA_DB_URL_MT import.tRNAdb.id( tdbID, database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.mttRNAdb.id(mtdbID, dbURL = TRNA_DB_URL_MT, verbose = FALSE) import.tRNAdb.blast( blastSeq, database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.tRNAdb( organism = "", strain = "", taxonomyID = "", aminoacids = "", anticodons = "", sequences = list(), structures = list(), reference = "", comment = "", pubmed = "", genes = "", database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.mttRNAdb( organism = "", strain = "", taxonomyID = "", aminoacids = "", anticodons = "", sequences = list(), structures = list(), reference = "", comment = "", pubmed = "", genes = "", dbURL = TRNA_DB_URL_MT, verbose = FALSE ) tRNAdb2GFF(input)
TRNA_DB_URL TRNA_DB_URL_MT import.tRNAdb.id( tdbID, database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.mttRNAdb.id(mtdbID, dbURL = TRNA_DB_URL_MT, verbose = FALSE) import.tRNAdb.blast( blastSeq, database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.tRNAdb( organism = "", strain = "", taxonomyID = "", aminoacids = "", anticodons = "", sequences = list(), structures = list(), reference = "", comment = "", pubmed = "", genes = "", database = c("DNA", "RNA"), origin = c("allothers", "plastid", "mitochondrial"), dbURL = TRNA_DB_URL, verbose = FALSE ) import.mttRNAdb( organism = "", strain = "", taxonomyID = "", aminoacids = "", anticodons = "", sequences = list(), structures = list(), reference = "", comment = "", pubmed = "", genes = "", dbURL = TRNA_DB_URL_MT, verbose = FALSE ) tRNAdb2GFF(input)
tdbID |
a tRNAdb ID |
database |
"RNA" or "DNA" |
origin |
one ore more of "plastid", "mitochondrial" or "allothers" |
dbURL |
the URL of the tRNA db |
verbose |
whether to report verbose information from the httr2 calls |
mtdbID |
a mtRNAdb ID |
blastSeq |
a sequence to use for a blast search |
organism |
a organism name as a character string |
strain |
a strain information as a character string |
taxonomyID |
organism and strain information as a taxonom ID |
aminoacids |
a character vector of amino acids as a three letter code |
anticodons |
a character vector of anticodon sequences |
sequences |
a named (1-15) list of sequences, which are used for the search |
structures |
a named (1-15) list of structures, which are used for the
search. Please use the |
reference |
a reference as a character string |
comment |
a comment as a character string |
pubmed |
a pubmed ID |
genes |
a gene name as a character string |
input |
a GRanges object which passes the |
An object of class character
of length 1.
An object of class character
of length 1.
a GRanges object containing the information from the tRNA db
import.tRNAdb(organism = "Saccharomyces cerevisiae", aminoacids = c("Phe","Ala")) import.tRNAdb.id(tdbID = "tdbD00000785") import.tRNAdb.blast(blastSeq = "GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCA") import.mttRNAdb(organism = "Bos taurus", aminoacids = c("Phe","Ala")) import.mttRNAdb.id(mtdbID = "mtdbD00000900")
import.tRNAdb(organism = "Saccharomyces cerevisiae", aminoacids = c("Phe","Ala")) import.tRNAdb.id(tdbID = "tdbD00000785") import.tRNAdb.blast(blastSeq = "GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCA") import.mttRNAdb(organism = "Bos taurus", aminoacids = c("Phe","Ala")) import.mttRNAdb.id(mtdbID = "mtdbD00000900")
istRNAdbGRanges
checks whether a GRanges object contains the
information expected for a tRNAdb result.
istRNAdbGRanges(x) ## S4 method for signature 'GRanges' istRNAdbGRanges(x)
istRNAdbGRanges(x) ## S4 method for signature 'GRanges' istRNAdbGRanges(x)
x |
the |
a logical value
gr <- import.tRNAdb(organism = "Saccharomyces cerevisiae", aminoacids = c("Phe","Ala"), anticodons = c("GAA")) istRNAdbGRanges(gr)
gr <- import.tRNAdb(organism = "Saccharomyces cerevisiae", aminoacids = c("Phe","Ala"), anticodons = c("GAA")) istRNAdbGRanges(gr)
open.tdbID
is a wrapper for browseURL
and opens a tab for a
tRNAdb entry in a browser. Please note, that the tRNAdb server does not show
the entry right away without a session ID. open twice upon first use.
open_tdbID(tdbID, dbURL = TRNA_DB_URL) open_mtdbID(mtdbID, dbURL = TRNA_DB_URL_MT)
open_tdbID(tdbID, dbURL = TRNA_DB_URL) open_mtdbID(mtdbID, dbURL = TRNA_DB_URL_MT)
tdbID |
a tRNA db |
dbURL |
the URL for the tRNAdb |
mtdbID |
a mtRNA db |
opens a window in a default browser for tRNAdb entry selected
if(interactive()){ open_tdbID("tdbD00000785") open_mtdbID("mtdbD00000907") }
if(interactive()){ open_tdbID("tdbD00000785") open_mtdbID("mtdbD00000907") }
The tRNAdb and mttRNAdb (Jühling et al. 2009) is a compilation of tRNA sequences and tRNA genes. It is a follow up version of the database of Sprinzl et al. 2005.
Using 'tRNAdbImport' the tRNAdb can be accessed as outlined on the website [http://trna.bioinf.uni-leipzig.de/](http://trna.bioinf.uni-leipzig.de/) and the results are returned as a 'GRanges' object.
Please refer to the tRNAdbImport vignette for an example how to work and use the package: tRNAdbImport
Felix G M Ernst [aut]
Jühling F, Mörl M, Hartmann RK, Sprinzl M, Stadler PF, Pütz J. 2009. "tRNAdb 2009: compilation of tRNA sequences and tRNA genes." Nucleic Acids Research, Volume 37 (suppl_1): D159–162. doi:10.1093/nar/gkn772.
[import.tRNAdb()] for examples