The sangerseqR package provides basic functions for
importing and working with sanger sequencing data files. It currently
functions with Scf and ABIF files. The Scf file specification is an open
source, although somewhat limited, data file type. Several tools
designed to view and or edit chromatogram data can convert file types to
Scf. The ABIF file specification is a proprietary data storage file
specification for sequencing data generated by Applied Biosystems
machines. More information on each filetype can be found at the
following sites:
The objects and functions included in this package were developed as
part of the Poly Peak Parser web application (http://yost.genetics.utah.edu/software.php), which
automates the process of seperating ambiguous double peaks from Sanger
sequencing individuals containing heterozygous indels. This package
contains a complete working copy of the Poly Peak Parser web application
that can be run locally using the PolyPeakParser()
function. In addition to the web program, this package also provides
general objects and functions for working with Sanger sequencing
data.
This vignette will walk you through a typical workflow using two sequence files: 1) homozygous.scf and 2) heterozygous.ab1. As their names indicate, the first example contains results typical of sequencing from a PCR product of a homozygous individual or from a plasmid. The second example contains results from sequencing the same region in an individual with a small indel.
The first step of most workflows will be to upload data from a
sequencing results file. This can be done using one of three included
functions: read.abif(), read.scf() and
readsangerseq(). The first two functions directly import
all of the fields into abif and scf class
objects, respectively. These classes are meant as intermediate classes
and exist to allow the user to inspect the file contents, as file
contents may vary between basecallers and sequencing machines. Users
should generally use the readsangerseq() function. This
function automatically detects and reads in the file type and then
extracts the fields necessary to create a sangerseq class
object, which is used by all of the other functions in this package.
read.abif takes a single argument for the filename of
the abif file to be read. The resulting object contains three major
parts. The header, containing information on the file structure, the
directory, containing information on each of the data fields included in
the file, and the data fields. Here is an example:
hetab1 <- read.abif(system.file("extdata",
"heterozygous.ab1",
package="sangerseqR"))
str(hetab1, list.len=20)## Formal class 'abif' [package "sangerseqR"] with 3 slots
## ..@ header :Formal class 'abifHeader' [package "sangerseqR"] with 9 slots
## .. .. ..@ abif : chr "ABIF"
## .. .. ..@ version : int 101
## .. .. ..@ name : chr "tdir"
## .. .. ..@ number : int 1
## .. .. ..@ elementtype: int 1023
## .. .. ..@ elementsize: int 28
## .. .. ..@ numelements: int 130
## .. .. ..@ dataoffset : int 323971
## .. .. ..@ datahandle : int 0
## ..@ directory:Formal class 'abifDirectory' [package "sangerseqR"] with 7 slots
## .. .. ..@ name : chr [1:130] "AEPt" "AEPt" "APFN" "APXV" ...
## .. .. ..@ tagnumber : int [1:130] 1 2 2 1 1 1 1 1 1 1 ...
## .. .. ..@ elementtype: int [1:130] 4 4 18 19 19 19 2 5 4 4 ...
## .. .. ..@ elementsize: int [1:130] 2 2 1 1 1 1 1 4 2 2 ...
## .. .. ..@ numelements: int [1:130] 1 1 6 2 6 2 4503 1 1 1 ...
## .. .. ..@ datasize : int [1:130] 2 2 6 2 6 2 4503 4 2 2 ...
## .. .. ..@ dataoffset : int [1:130] 1113325568 1113325568 173231 838860800 163360 956301312 163366 0 65536 145752064 ...
## ..@ data :List of 130
## .. ..$ AEPt.1 : int 16988
## .. ..$ AEPt.2 : int 16988
## .. ..$ APFN.2 : chr "SeqA"
## .. ..$ APXV.1 : chr "2"
## .. ..$ APrN.1 : chr "SeqA"
## .. ..$ APrV.1 : chr "9"
## .. ..$ APrX.1 : chr "?xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"yes\"?>\n<AnalysisProtocolContainer doAnalysis=\"true\" na"| __truncated__
## .. ..$ ARTN.1 : int 0
## .. ..$ ASPF.1 : int 1
## .. ..$ ASPt.1 : int 2224
## .. ..$ ASPt.2 : int 2224
## .. ..$ AUDT.1 : int [1:1370] 64 126 65 54 55 79 81 183 49 123 ...
## .. ..$ B1Pt.1 : int 2223
## .. ..$ B1Pt.2 : int 2223
## .. ..$ BCTS.1 : chr "201306-13 17:26:28 -06:00"
## .. ..$ BufT.1 : int [1:1596] -27 -27 -27 -27 -27 -27 -27 -27 -27 -27 ...
## .. ..$ CMNT.1 : chr "ID:119209><WELL:G02>"
## .. ..$ CTID.1 : chr "bdt1735"
## .. ..$ CTNM.1 : chr "bdt1735"
## .. ..$ CTOw.1 : chr "aadamson"
## .. .. [list output truncated]
As you can see, the file is very long and contains a lot of Data fields (130 in this example). However, most of these contain run information and only a few are directly relevant to data analysis:
| Data Field | Description |
|---|---|
| DATA.9-DATA.12 | Vectors containing the signal intensities for each channel. |
| FWO.1 | A string containing the base corresponding to each channel. For example, if it is “ACGT”, then DATA.9 = A, DATA.10 = C, DATA.11 = G and DATA.12 = T. |
| PLOC.2 | Peak locations as an index of the trace vectors. |
| PBAS.1, PBAS.2 | Primary basecalls. PBAS.1 may contain bases edited in the original basecaller, while PBAS.2 always contains the basecaller’s calls. |
| P1AM.1 | Amplitude of primary basecall peaks. |
| P2BA.1 | (optional) Contains the secondary basecalls. |
| P2AM.1 | (optional) Amplitude of the secondary basecall peaks. |
Like read.abif, read.scf takes a single
argument with the filename. However, the data structure of the resulting
scf object is far less complicated, containing only a
header with file structure information, a matrix of the trace data
(@sample_points), a matrix of relative probabilities of
each base at each position (@sequence_probs), basecall
positions (@basecall_positions), basecalls
(@basecalls) and optionally a comments sections with the
run data (@comments). The last slot (@private)
is rarely used and impossible to interpret without knowing how it was
created.
## Formal class 'scf' [package "sangerseqR"] with 7 slots
## ..@ header :Formal class 'scfHeader' [package "sangerseqR"] with 14 slots
## .. .. ..@ scf : chr "scf"
## .. .. ..@ samples : int 16275
## .. .. ..@ samples_offset : int 128
## .. .. ..@ bases : int 722
## .. .. ..@ bases_left_clip : int 0
## .. .. ..@ bases_right_clip: int 0
## .. .. ..@ bases_offset : int 130328
## .. .. ..@ comments_size : int 1731
## .. .. ..@ comments_offset : int 138992
## .. .. ..@ version : num 300
## .. .. ..@ sample_size : int 2
## .. .. ..@ code_set : int 2
## .. .. ..@ private_size : int 0
## .. .. ..@ private_offset : int 140723
## ..@ sample_points : num [1:16275, 1:4] 187 190 199 220 255 304 354 389 404 402 ...
## ..@ sequence_probs : int [1:722, 1:4] 0 0 0 0 0 0 0 0 0 0 ...
## ..@ basecall_positions: int [1:722] 2 18 25 39 45 56 63 68 85 94 ...
## ..@ basecalls : chr "ARGKRAMMYWACTATAGGGCGGAATTGAATTTAGCGGCCGCGAATTCGCCCTTTGGCAAGAGAGCGACAGTCAGTCGGACTTACGAGTTGTTTTTACAGGCGCAATTCTTT"| __truncated__
## ..@ comments : chr "STRT6/21/2013\n18:04:27\nSTOP=6/21/2013\n20:02:45\nSIGN=G=124,A=134,T=204,C=159\nAEPt=16308\nAEPt=16308\nAPFN=S"| __truncated__
## ..@ private : raw [1:2] 00 31
The readsangerseq function is a convenience function
equivalent to sangerseq(read.abif(file)) or
sangerseq(read.scf(file)). It should generally be used when
the contents of the file do not need to be directly accessed because it
returns a sangerseq object, described below.
The sangerseq class is the backbone of the sangerseqR
package and contains the chromatogram data necesary to perform all other
functions. It can be created in two ways: from an abif or
scf object using the sangerseq method or
directly from an abif or scf file using readsangerseq.
#from a sequence file object
homosangerseq <- sangerseq(homoscf)
#directly from the file
hetsangerseq <- readsangerseq(system.file("extdata",
"heterozygous.ab1",
package="sangerseqR"))
str(hetsangerseq)## Formal class 'sangerseq' [package "sangerseqR"] with 7 slots
## ..@ primarySeqID : chr "From ab1 file"
## ..@ primarySeq :Formal class 'DNAString' [package "Biostrings"] with 5 slots
## .. .. ..@ shared :Formal class 'SharedRaw' [package "XVector"] with 2 slots
## .. .. .. .. ..@ xp :<pointer: (nil)>
## .. .. .. .. ..@ .link_to_cached_object:<environment: 0x563c47006888>
## .. .. ..@ offset : int 0
## .. .. ..@ length : int 605
## .. .. ..@ elementMetadata: NULL
## .. .. ..@ metadata : list()
## ..@ secondarySeqID: chr "From ab1 file"
## ..@ secondarySeq :Formal class 'DNAString' [package "Biostrings"] with 5 slots
## .. .. ..@ shared :Formal class 'SharedRaw' [package "XVector"] with 2 slots
## .. .. .. .. ..@ xp :<pointer: (nil)>
## .. .. .. .. ..@ .link_to_cached_object:<environment: 0x563c47006888>
## .. .. ..@ offset : int 0
## .. .. ..@ length : int 605
## .. .. ..@ elementMetadata: NULL
## .. .. ..@ metadata : list()
## ..@ traceMatrix : int [1:16215, 1:4] 0 0 0 1 2 4 4 2 1 0 ...
## ..@ peakPosMatrix : num [1:605, 1:4] 4 13 21 31 43 58 64 73 83 98 ...
## ..@ peakAmpMatrix : int [1:605, 1:4] 380 694 836 934 1367 1063 2072 1502 1234 539 ...
The slots are as follows:
| Slot | Description |
|---|---|
primarySeqID |
Identification of the primary Basecalls. |
primarySeq |
The primary Basecalls formatted as a DNAString object. |
secondarySeqID |
Identification of the secondary Basecalls. |
secondarySeq |
The secondary Basecalls formatted as a DNAString object. |
traceMatrix |
A numerical matrix containing 4 columns corresponding to the normalized signal values for the chromatogram traces. Column order = A,C,G,T. |
peakPosMatrix |
A numerical matrix containing the position of the maximum peak values for each base within each Basecall window. If no peak was detected for a given base in a given window, then “NA”. Column order = A,C,G,T. |
peakAmpMatrix |
A numerical matrix containing the maximum peak amplitudes for each base within each Basecall window. If no peak was detected for a given base in a given window, then 0. Column order = A,C,G,T. |
Accessor functions also exist for each slot in the sangerseq object.
Most of the accessors return the data in its native format, but the
primarySeq and secondarySeq accessors can
optionally return the data as a character string or a
DNAString class object from the Biostrings
package by setting string=TRUE or
string=FALSE, respectively. The DNAString
class contains several convenient functions for manipulating the
sequence, including generating the reverse compliment and performing
alignments. The Biostrings package is automatically loaded
with the sangerseq package, so all methods should be
available.
## 722-letter DNAString object
## seq: TTAACCCTCACTAAAAGGGAATTAGTCCTGCAGGTT...CGCTAAATTCAATTCCGCCCTATAGTWRKKTYMCYT
## [1] "ARGKRAMMYWACTATAGGGCGGAATTGAATTTAGCGGCCGCGAATTCGCCCTTTGGCAAGAGAGCGACAGTCAGTCGGACTTACGAGTTGTTTTTACAGGCGCAATTCTTTTTTTAGAATATTATACATTCATCTGGCTTTTTGGGTGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCCATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCACTTTACCAGTAAACCGCTGGCGGATCATGCGCTCTCCGGTGCGGCTGAAGCTGGTTTACACGCGGCGCTTGGACATCACCACCAGGCGGCTCATCTGCGCTCTTTCAAGGGTCTCGAGCCAGAGGAGGATGTTGAGGACGATCCTAAAGTTACATTAGAAGCTAAGGAGCTTTGGGATCAATTCCACAAAATTGGAACAGAAATGGTCATCACTAAATCAGGAAGGTAAGGTCTTTACATTATTTAACCTATTGAATGCTGCATAGGGTGATGTTATTATATTACTCCGCGAAGAGTTGGGTCTATTTTATCGTAAAATATACTTTACATTATAAAATATTGCTCGGTTAAAATTCAGATGTACTGGATGCTGACATAGCATCGAAGCCTCTAARGGCGAATTCGTTTAAACCTGCAGGACTAATTCCCTTTTAGTGAGGGTTAA"
Basic chromatogram plots can be made using the
chromatogram function. These plots are optimized for
printing, so they contain several rows to plot all of the data
simultaneously. The downside of this is that it can give an error if the
graphics device dimensions are not large enough. If this occurs, we
suggest you provide a filename in the command to save it to a pdf
automatically sized to fit everything. Several parameters can also be
set to affect how the plot appears. These are documented in the
chromatogram help file.
As shown in the chromatogram, secondary basecalls are sometimes
provided in ab1 files (Scf files are unable to show them). However, the
exact nature of these calls is inconsistent. In the heterozygous.ab1
file used here, it is any peak near the primary peak, no matter how
small. For example, base 100 (first base on the second line) has a
primary call of “C” and a secondary call of “A”, even though the A peak
is very small and likely noise. In homozygous sequencing results, these
calls should simply be ignored and are hidden in the chromatogram by
default (showcalls="primary"). When heterozygous regions of
the sequence are present, the makeBaseCalls can be used to
determine whether a particular peak is homozygous or heterozygous and
call the appropriate bases.
Let’s use the chromatogram we created in the previous section as an
example. The chromatogram contains a homozygous region from bases 1 to
approximately 160, but then breaks down into a series of double peaks
for the remainder of the chromatogram. This is due to an indel in one
allele of the sequenced region. makeBaseCalls can be used
to show this more clearly or to add the secondary basecalls if the data
file does not contain them. The function essentially divides the
sequence into a series of basecall windows and identifies the tallest
peak for each fluorescence channel within the window. These peaks are
converted to signal ratio to the tallest peak. A cutoff ratio is then
applied to determine if a peak is signal or noise. Peaks below this
ratio are ignored. Remaining peaks in each window are used to make
primary and secondary basecalls.
## Number of datapoints: 16215
## Number of basecalls: 604
##
## Primary Basecalls: AGGCGCTGGAGTGGGTTTGACGGCGCATTCTTTTTTTAGAGTATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCCATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCACTTTACCACCGAACCTCAGGCGAACGCTGGGCTCTCAGGCGCGCTCCAGGCCGGCTGACGCGGGGCGACTGGACGTGCCCGCAAGGCGCCTCCAGGGGGCTCTTCCGCGCTCCTTCAGGGATATCAGGCCGTAGGGGGCGATCCTGAACTATCCTTAAATGCCATTAAGCGCTGGGGTGCTTTGCGATCAATTGCACCAAATTGGGACATCACTGAATCTCGCTGGATCGGGCTGGACATGACTTAACCTATTTAAACCTGTAGAAGGCGGCGTAATGAGATTACTCTGCATAACTCTGGGACGAGTTGATCCTATATTATCCTTTACATTACATAACATTGTAAAATATTGATTCAGATGTATTGGGAGGTGCCGTANCCTCACGATACCTATAGAAAGCCTCT
##
## Secondary Basecalls: AGGGGCMGGGGTGAATTTGAAGGCGCATTCTTTTTTTAGACTATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACACTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCCATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCACTTTACCAGTAGGTCGCTGTAAGCTCATGCCGGATCCTGTGCTGCTGGATGTGGTTTAAACTCGTTTCTACGCGACCATTAGCCATCAGCACAKCTCCGCTCATTTAAGGGTTTCGAACCGGCGGGAGATAGTGAAGAATGTTGAAGAGGTACATAAGGATATAAGGGAATTTAAGAACAATTCGACTAAATTCGAAAAGAAATGATCAGAAATAGTCAAGAAAAATAAAGTAATTTAAGTTTTTTACATTATGTATGCTACTTAGTGTTATATTGGTTTATGTTATTATGATGAGTTGCGTATATTTTGGTGTATTATATAGTATACTATATTATATATTACTCGGTAAAACTCGGTTAAAACTCAGTTCTAATATANGATRGCTAGCCATCTAGAAAACCTCT
The resulting file now contains the maximum peak in the
@primarySeq slot and the second tallest peak, if it is
above the cutoff, in the @secondarySeq slot. If only one
peak is above the cutoff ratio, then this call matches the primary
basecall. If three peaks were above the cutoff ratio, then the peak with
the maximum amplitude is the primary basecall and an ambiguous base code
is used as the secondary basecall. The resulting chromatogram also shows
this:
Chromatogram of heterozygous sequencing results after making basecalls. Primary and secondary basecalls now match for homozygous peaks
Although makeBaseCalls has fixed the primary and
secondary peak calls. It still does not tell us anything about the
nature of the mutation. For this, we need to set the allele phase using
a reference base sequence from an online source or from another
sequencing run on a homozygous sample. The examples used in this
vignette are from heterozygous and homozygous siblings, so we will use
the primary basecalls from the homozygous sibling (loaded earlier) as
our reference. The beginnings and ends of these sequences do not need to
match, but the reference should ideally encompass the sequenced region.
setAllelePhase will then separate the primary and secondary
basecalls into reference and non-reference bases at each position and
set (@primarySeq) to the reference and
@secondarySeq to the non-reference allele.
ref <- subseq(primarySeq(homosangerseq, string=TRUE), start=30, width=500)
hetseqalleles <- setAllelePhase(hetcalls, ref, trim5=50, trim3=300)
hetseqalleles## Number of datapoints: 16215
## Number of basecalls: 604
##
## Primary Basecalls: AGGSGCHGGRGTGRRTTTGAMGGCGCATTCTTTTTTTAGASTATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCCATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCACTTTACCAGTAAACCGCTGGCGGATCATGCGCTCTCCGGTGCGGCTGAAGCTGGTTTACACGCGGCGCTTGGACATCACCACCAGGCGGCTCATCTGCGCTCTTTCAAGGGTCTCGAGCCAGAGGAGGATGTTGAGGACGATCCTAAAGTTACATTAGAAGCTAAGGAGCTTTGGGATCAATTCCACTAAATTGGAACAGAAATGGTCATCACTAAATCAGGAAGGTAAGGTCTTTACATTATTTAACCTATTKWAWSCTRYWKARKGYKRYRTWRKKWKATKWYWYTRYRWWRMKYTGSGWMKAKTTKRKYSTATWWTATMSTWTACWWTAYWWWAYATTRYWMRRTAWWRMTYSRKWWRWAYTSRGWKSTRMYRTANSMTVRCKAKMCMTMTAGAAARCCTCT
##
## Secondary Basecalls: AGGSGCHGGRGTGRRTTTGAMGGCGCATTCTTTTTTTAGASTATTATACATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACACTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCCATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCACTTTACCACCGGGTCTCAGTAAACCGCTGGCGGATCATGCGCTCTCCGGTGCGGCTGAAGCTGGTTTACACGCGGCGCTTGGACATCACCACCRGGCGGCTCATCTGCGCTCTTTCAAGGGTCTCGAGCCAGAGGAGGATGTTGAGGACGATCCTAAAGTTACATTAGAAGCTAAGGAGCTTTGGGATCAATTCCACAAAATTGGAACAGAAATGGTCATCACTAAATCAGGAAGGTAAGGTCTTTACATTATKWAWSCTRYWKARKGYKRYRTWRKKWKATKWYWYTRYRWWRMKYTGSGWMKAKTTKRKYSTATWWTATMSTWTACWWTAYWWWAYATTRYWMRRTAWWRMTYSRKWWRWAYTSRGWKSTRMYRTANSMTVRCKAKMCMTMTAGAAARCCTCT
At this point, we could plot the chromatogram again, but it is more
informative to align the resulting sequences to see how the alleles
differ. Since sangerseqR depends on
Biostrings, pairwiseAlignment can be used.
pa <- pairwiseAlignment(primarySeq(hetseqalleles)[1:400],
secondarySeq(hetseqalleles)[1:400],
type="global-local")
writePairwiseAlignments(pa)## ########################################
## # Program: pwalign (version 1.9.1), a Bioconductor package
## # Rundate: Sat May 30 09:50:36 2026
## ########################################
## #=======================================
## #
## # Aligned_sequences: 2
## # 1: P1
## # 2: S1
## # Matrix: NA
## # Gap_penalty: 14.0
## # Extend_penalty: 4.0
## #
## # Length: 410
## # Identity: 387/410 (94.4%)
## # Similarity: NA/410 (NA%)
## # Gaps: 20/410 (4.9%)
## # Score: 649.2401
## #
## #
## #=======================================
##
## P1 1 AGGSGCHGGRGTGRRTTTGAMGGCGCATTCTTTTTTTAGASTATTATACA 50
## ||||||||||||||||||||||||||||||||||||||||||||||||||
## S1 1 AGGSGCHGGRGTGRRTTTGAMGGCGCATTCTTTTTTTAGASTATTATACA 50
##
## P1 51 TTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGA 100
## ||||||||||||||||||||||||||||||||||||||||||||||||||
## S1 51 TTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGA 100
##
## P1 101 ACGCTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCC 150
## || |||||||||||||||||||||||||||||||||||||||||||||||
## S1 101 ACACTATGGCTTATCACCCTTTTCACGCGCACAGGCCGGCCGACTTTCCC 150
##
## P1 151 ATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCAC 200
## ||||||||||||||||||||||||||||||||||||||||||||||||||
## S1 151 ATGTCAGCTTTCCTTGCGGCGGCTCAACCTTCGTTCTTTCCAGCGCTCAC 200
##
## P1 201 TTTACCA----------GTAAACCGCTGGCGGATCATGCGCTCTCCGGTG 240
## ||||||| |||||||||||||||||||||||||||||||||
## S1 201 TTTACCACCGGGTCTCAGTAAACCGCTGGCGGATCATGCGCTCTCCGGTG 250
##
## P1 241 CGGCTGAAGCTGGTTTACACGCGGCGCTTGGACATCACCACCAGGCGGCT 290
## |||||||||||||||||||||||||||||||||||||||||| |||||||
## S1 251 CGGCTGAAGCTGGTTTACACGCGGCGCTTGGACATCACCACCRGGCGGCT 300
##
## P1 291 CATCTGCGCTCTTTCAAGGGTCTCGAGCCAGAGGAGGATGTTGAGGACGA 340
## ||||||||||||||||||||||||||||||||||||||||||||||||||
## S1 301 CATCTGCGCTCTTTCAAGGGTCTCGAGCCAGAGGAGGATGTTGAGGACGA 350
##
## P1 341 TCCTAAAGTTACATTAGAAGCTAAGGAGCTTTGGGATCAATTCCACTAAA 390
## |||||||||||||||||||||||||||||||||||||||||||||| ||
## S1 351 TCCTAAAGTTACATTAGAAGCTAAGGAGCTTTGGGATCAATTCCACAAA- 399
##
## P1 391 TTGGAACAGA 400
## |
## S1 400 ---------A 400
##
##
## #---------------------------------------
## #---------------------------------------
In this vignette, we have walked you through the basic functions in
the sangerseqR package. This work is a work in progress and
we hope to improve its functionality. For example, improving the base
calling algorithm and adding an interactive chromatogram function. If
you have any suggestions or requested features, please email Jonathon
Hill at [email protected].