Computation of melting temperature of nucleic
acid duplexes with rmelting
- Division of Germplasm Conservation, ICAR-National Bureau of Plant Genetic Resources, New Delhi.
- Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi.
Introduction
The R package rmelting is an interface to
the MELTING
5 program (Le Novère, 2001; Dumousseau et
al., 2012) to compute melting temperatures of nucleic acid
duplexes (DNA/DNA, DNA/RNA, RNA/RNA or 2’-O-MeRNA/RNA) along with other
thermodynamic parameters such as hybridisation enthalpy and entropy.
Melting temperatures are computed by Nearest-neighbour methods for short sequences or approximative estimation formulae for long sequences. Apart from these, multiple corrections are available to take into account the presence of Cations (Na, Tris, K and Mg) or denaturing agents (DMSO and formamide).
Installation
The package can be installed from Bioconductor as follows.
if (!"BiocManager" %in% rownames(installed.packages()))
install.packages("BiocManager")
BiocManager::install("rmelting")The development version can be installed from github as follows.
if (!require('devtools')) install.packages('devtools')
devtools::install_github("aravind-j/rmelting")Then the package can be loaded as follows.
Basic usage
Melting temperatures are computed in rmelting through
the core function melting which takes a number of arguments
(see ?melting). The following are the essential arguments
which are mandatory for computation.
sequence- 5’ to 3’ sequence of one strand of the nucleic acid duplex as a character string. Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL (Table 1). U and T are not considered identical.
Table 1: Recognized sequences
| Code | Type |
|---|---|
| A | Adenine |
| C | Cytosine |
| G | Guanine |
| T | Thymine |
| U | Uracil |
| I | Inosine |
| X_C | Trans azobenzenes |
| X_T | Cis azobenzenes |
| A* | Hydroxyadenine |
| AL | Locked nucleic acid |
| TL | ’’ |
| GL | ’’ |
| CL | ’’ |
Comp.sequence- Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s)
between the two strands. If not specified, it is computed as the
complement of
sequence. Self-complementarity insequenceis detected even though there may be (are) dangling end(s) andcomp.sequenceis computed.
- Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s)
between the two strands. If not specified, it is computed as the
complement of
nucleic.acid.conc- In molar concentration (M or mol L-1).
Na.conc, Mg.conc, Tris.conc, K.conc- At least one cation (Na, Mg, Tris, K) concentration is mandatory, the other agents(dNTP, DMSO, formamide) are optional.
hybridisation.type- The possible options for hybridisation type are as follows (Table 2).
Table 2: Hybridisation type options
| Option | Sequence | Complementary sequence |
|---|---|---|
dnadna |
DNA | DNA |
rnarna |
RNA | RNA |
dnarna |
DNA | RNA |
rnadna |
RNA | DNA |
mrnarna |
2-o-methyl RNA | RNA |
rnamrna |
RNA | 2-o-methyl RNA |
With these arguments, the melting temperature can be computed as follows.
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 73.35168Only the melting temperature is given as a console output. However, the output can be assigned to an object which contains the details of the environment, options and the thermodynamics results as a list.
# Get output as list
out <- melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)
# Environment output
out$Environment## $Sequence
## [1] "CAGTGAGACAGCAATGGTCG"
##
## $`Complementary sequence`
## [1] "GTCACTCTGTCGTTACCAGC"
##
## $`Nucleic acid concentration (M)`
## [1] 2e-06
##
## $`Hybridization type`
## [1] "dnadna"
##
## $`Na concentration (M)`
## [1] 1
##
## $`Mg concentration (M)`
## [1] 0
##
## $`Tris concentration (M)`
## [1] 0
##
## $`K concentration (M)`
## [1] 0
##
## $`dNTP concentration (M)`
## [1] 0
##
## $`DMSO concentration (%)`
## [1] 0
##
## $`Formamide concentration (M or %)`
## [1] 0
##
## $`Self complementarity`
## [1] FALSE
##
## $`Correction factor`
## [1] 4## $`Approximative formula`
## [1] NA
##
## $`Nearest neighbour model`
## [1] NA
##
## $`GU model`
## [1] NA
##
## $`Single mismatch model`
## [1] NA
##
## $`Tandem mismatch model`
## [1] NA
##
## $`Single dangling end model`
## [1] NA
##
## $`Double dangling end model`
## [1] NA
##
## $`Long dangling end model`
## [1] NA
##
## $`Internal loop model`
## [1] NA
##
## $`Single bulge loop model`
## [1] NA
##
## $`Long bulge loop model`
## [1] NA
##
## $`CNG repeats model`
## [1] NA
##
## $`Inosine bases model`
## [1] NA
##
## $`Hydroxyadenine bases model`
## [1] NA
##
## $`Azobenzenes model`
## [1] NA
##
## $`Locked nucleic acids model`
## [1] NA
##
## $`Ion correction method`
## [1] NA
##
## $`Na equivalence correction method`
## [1] NA
##
## $`DMSO correction method`
## [1] NA
##
## $`Formamide correction method`
## [1] NA
##
## $Mode
## [1] NA## $`Enthalpy (cal)`
## [1] -159000
##
## $`Entropy (cal)`
## [1] -430
##
## $`Enthalpy (J)`
## [1] -664620
##
## $`Entropy (J)`
## [1] -1797.4
##
## $`Melting temperature (C)`
## [1] 73.35168The command for the MELTING 5 java version is saved as an attribute
in the list out and can be retrieved as follows.
## [1] "-S CAGTGAGACAGCAATGGTCG -H dnadna -P 2e-06 -E Na=1 -T 60"Melting temperature computation
Melting temperature is computed by either approximative or nearest
neighbour methods according to the length of the oligonucleotide
sequences. For longer sequences (longer than the threshold value, the
threshold value set by size.threshold with the default
value 60) approximative method is used, while for others, nearest
neighbour method is used.
Approximative methods
The approximative method for computation can be specified by the
argument method.approx. The available methods are given in
Table 3.
Table 3: Details of approximative methods
| Formula | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01 |
DNA | No mismatch | Ahsen et al. (2001) |
che93 |
DNA | No mismatch; Na=0, Mg=0.0015, Tris=0.01, K=0.05 | Marmur and Doty (1962) |
che93corr |
DNA | No mismatch; Na=0, Mg=0.0015, Tris=0.01, K=0.05 | Marmur and Doty (1962) |
schdot |
DNA | No mismatch | Wetmur (1991), Marmur and Doty (1962), Chester and Marshak (1993), Schildkraut and Lifson (1965), Wahl et al. (1987), Britten et al. (1974), Hall et al. (1980) |
owe69 |
DNA | No mismatch | Owen et al. (1969), Frank-Kamenetskii (1971), Blake (1996), Blake and Delcourt (1998) |
san98 |
DNA | No mismatch | SantaLucia (1998), Ahsen et al. (2001) |
wetdna91* |
DNA | Wetmur (1991) | |
wetrna91* |
RNA | Wetmur (1991) | |
wetdnarna91* |
DNA/RNA | Wetmur (1991) |
Examples
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA:AGATTACACGACAATCTACATAGGTCTCTATCGGCTCGTATTTGAAGTTGTGTGCTCTGCAACTAACCTAAATTGGTATC
RNA:UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AAUUAGAGGCAGUAGAAAUUCGGCACCUCUCUGACAUCUGAACUUGUCCCCAUUCGCCUCCGUGCAUCCUAAGUGUAGUA
DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RNA:AGAUUACACGACAAUCUACAUAGGUCUCUAUCGGCUCGUAUUUGAAGUUGUGUGCUCUGCAACUAACCUAAAUUGGUAUC
# Long Nucleotide sequence
DNAseq <- c("TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG")
RNAseq <- c("UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU")
# Approximative method - default (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 87.82455# Approximative method - wetdna91 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "wetdna91")## [1] 87.82455# Approximative method - ahs01 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "ahs01")## [1] 87.325# Approximative method - che93 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "che93")## [1] 77.575# Approximative method - che93corr (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "che93corr")## [1] 79.0125# Approximative method - schdot (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "schdot")## [1] 89.4625# Approximative method - owe69 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "owe69")## [1] 100.96# Approximative method - san98 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1,
method.approx = "san98")## [1] 86.9# Approximative method - default (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 101.1745# Approximative method - wetrna91 (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1,
method.approx = "wetrna91")## [1] 101.1745# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1)## [1] 88.92455# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1,
method.approx = "wetdnarna91")## [1] 88.92455Nearest neighbour methods
Perfectly matching sequences
The nearest neighbour model for computation in case of perfectly
matching sequences can be specified by the argument
method.nn. The available methods are given in Table
4.
Table 4: Details of nearest neighbour methods for perfectly matching sequences
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
all97* |
DNA | Allawi and SantaLucia (1997) | |
bre86 |
DNA | Breslauer et al. (1986) | |
san04 |
DNA | SantaLucia and Hicks (2004) | |
san96 |
DNA | SantaLucia et al. (1996) | |
sug96 |
DNA | Sugimoto et al. (1996) | |
tan04 |
DNA | Tanaka et al. (2004) | |
fre86 |
RNA | Freier et al. (1986) | |
xia98* |
RNA | Xia et al. (1998) | |
sug95* |
DNA/ RNA | SantaLucia et al. (1996) | |
tur06* |
2’-O-MeRNA/ RNA | A sodium correction (san04) is
automatically applied to convert the entropy (Na = 0.1M) into the
entropy (Na = 1M) |
Kierzek et al. (2006) |
Examples
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
DNA:GTCACTCTGTCGTTACCAGC
RNA:CAGUGAGACAGCAAUGGUCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
DNA:CAGTGAGACAGCAATGGTCG
||||||||||||||||||||
RNA:GUCACUCUGUCGUUACCAGC
# Nearest neighbour method - default (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 73.35168# Nearest neighbour method - all97 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")## [1] 73.35168# Nearest neighbour method - bre86 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")## [1] 83.2203# Nearest neighbour method - san04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")## [1] 73.30191# Nearest neighbour method - san96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")## [1] 75.7102# Nearest neighbour method - sug96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")## [1] 78.17556# Nearest neighbour method - tan04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")## [1] 71.31413# Nearest neighbour method - default (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 86.77685# Nearest neighbour method - xia98 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")## [1] 86.77685# Nearest neighbour method - fre86 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")## [1] 83.81257# Nearest neighbour method - default (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "mrnarna", Na.conc = 1)## [1] 99.01986# Nearest neighbour method - tur06 (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "mrnarna", Na.conc = 1, method.nn = "tur06")## [1] 99.01986# Nearest neighbour method - default (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1)## [1] 66.77049# Nearest neighbour method - sug95 (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnarna", Na.conc = 1, method.nn = "sug95")## [1] 66.77049Self complementarity for perfect matching sequences or sequences with
dangling ends is detected automatically. However it can be enforced by
the argument force.self = TRUE.
Examples
DNA:CATATGGCCATATG
||||||||||||||
DNA:GTATACCGGTATAC
RNA:AUGUACAU
||||||||
RNA:UACAUGUA# Nearest neighbour method - default (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1)## [1] 56.00644# Nearest neighbour method - all97 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")## [1] 56.00644# Nearest neighbour method - bre86 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")## [1] 63.44605# Nearest neighbour method - san04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")## [1] 57.80792# Nearest neighbour method - san96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")## [1] 55.0921# Nearest neighbour method - sug96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")## [1] 59.06213# Nearest neighbour method - tan04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")## [1] 55.65824# Nearest neighbour method - default (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 30.27015# Nearest neighbour method - xia98 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")## [1] 30.27015# Nearest neighbour method - fre86 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")## [1] 31.48175GU wobble base pairs effect
The nearest neighbour model for computation in case of sequences with
GU wobble base pairs can be specified by the argument
method.GU. The available methods are given in Table
5.
Table 5: Details of methods for sequences with GU wobble base pairs
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
tur99 |
RNA | Mathews et al. (1999) | |
ser12* |
RNA | Chen et al. (2012) |
Examples
RNA:CCAGCGUCCU
||||||||||
RNA:GGTCGCAGGA# GU wobble base pairs effect - default (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1)## [1] 79.46955# GU wobble base pairs effect - ser12 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1, method.GU = "ser12")## [1] 79.46955# GU wobble base pairs effect - tur99 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
hybridisation.type = "rnarna", Na.conc = 1, method.GU = "tur99")## [1] 79.46955Single mismatch effect
The nearest neighbour model for computation in case of sequences with
a single mismatch can be specified by the argument
method.singleMM. The available methods are given in
Table 6.
Table 6: Details of methods for sequences with single mismatch
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
allsanpey* |
DNA | Allawi and SantaLucia (1997), Allawi and SantaLucia (1998a), Allawi and SantaLucia (1998b), Allawi and SantaLucia (1998c), Peyret et al. (1999) | |
wat11* |
DNA/RNA | Watkins et al. (2011) | |
tur06 |
RNA | Lu et al. (2006) | |
zno07* |
RNA | Davis and Znosko (2007) | |
zno08 |
RNA | At least one adjacent GU base pair. | Davis and Znosko (2008) |
Examples
DNA:CAACTTGATATTAATA
|||||||| |||||||
DNA:GTTGAACTCTAATTAT
RNA:GACAGGCUG
|||| ||||
RNA:CUGUGCGAC
DNA:CCATAACTACC
|||| ||||||
RNA:GGUAAUGAUGG# Single mismatch effect - default (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)## [1] 51.97499# Single mismatch effect - allsanpey (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.singleMM = "allsanpey")## [1] 51.97499# Single mismatch effect - default (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)## [1] 54.40363# Single mismatch effect - zno07 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "zno07")## [1] 54.40363# Single mismatch effect - zno08 (RNA/RNA)
melting(sequence = "CAGUACGUC", comp.sequence = "GUCGGGCAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "zno08")## [1] 38.26298# Single mismatch effect - tur06 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.singleMM = "tur06")## [1] 58.27825# Single mismatch effect - default (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna", Na.conc = 1)## [1] 40.32976# Single mismatch effect - wat11 (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna",
Na.conc = 1, method.singleMM = "wat11")## [1] 40.32976Tandem mismatches effect
The nearest neighbour model for computation in case of sequences with
tandem mismatches can be specified by the argument
method.tandemMM. The available methods are given in
Table 7.
Table 7: Details of methods for sequences with tandem mismatches
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
allsanpey* |
DNA | Only GT mismatches and TA/TG mismatches. | Allawi and SantaLucia (1997), Allawi and SantaLucia (1998a), Allawi and SantaLucia (1998b), Allawi and SantaLucia (1998c), Peyret et al. (1999) |
tur99* |
RNA | No adjacent GU or UG base pairs. | Mathews et al. (1999), Lu et al. (2006) |
Examples
DNA:GACGTTGGAC
|||| ||||
DNA:CTGCGGCCTG
RNA:GAGCGGAG
||| |||
RNA:CUCCACUC# Tandem mismatches effect - default (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)## [1] 50.20175# Tandem mismatches effect - allsanpey (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.tandemMM = "allsanpey")## [1] 50.20175# Tandem mismatches effect - default (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)## [1] 21.07224# Tandem mismatches effect - tur06 (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.tandemMM = "tur99")## [1] 21.07224Single dangling end effect
The nearest neighbour model for computation in case of sequences with
a single dangling end can be specified by the argument
method.single.dangle. The available methods are given in
Table 8.
Table 8: Details of methods for sequences with single dangling end
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
bom00* |
DNA | Bommarito et al. (2000) | |
sugdna02 |
DNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
sugrna02 |
RNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
ser08* |
RNA | Only 3’ UA, GU and UG terminal base pairs only 5’ UG and GU terminal base pairs. | O’Toole et al. (2006), Miller et al. (2008) |
Examples
DNA:-GTAGCTACA
||||||||
DNA:ACATCGATG-
RNA:-GGCGCUG
|||||||
RNA: CCGCGAC
DNA:-GGCGCUG
|||||||
RNA: CCGCGAC# Single dangling end effect - default (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 52.58935# Single dangling end effect - bom00 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.single.dangle = "bom00")## [1] 52.58935# Single dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.single.dangle = "sugdna02")## [1] 50.78548# Single dangling end effect - default (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 65.7647# Single dangling end effect - ser08 (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.dangle = "ser08")## [1] 65.7647# Single dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "-GGCGCUG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.dangle = "sugrna02")## [1] 65.7647Double dangling end effect
The nearest neighbour model for computation in case of sequences with
a double or secondary dangling ends can be specified by the argument
method.double.dangle. The available methods are given in
Table 9.
Table 9: Details of methods for sequences with double dangling ends
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
sugdna02* |
DNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
sugrna02 |
RNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
ser05 |
RNA | Depends on the available thermodynamic parameters for single dangling end. | O’Toole et al. (2005) |
ser06* |
RNA | O’Toole et al. (2006) |
Examples
DNA:--ATGCATAA
||||||
DNA:AATACGTA--
RNA:--AUGCAUAA
||||||
RNA:AAUACGUA--# Double dangling end effect - default (DNA/DNA)
melting(sequence = "--ATGCATAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 44.88615# Double dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "--ATGCATAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.double.dangle = "sugdna02")## [1] 44.88615# Double dangling end effect - default (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 42.79724# Double dangling end effect - ser06 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "ser06")## [1] 42.79724# Double dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "sugrna02")## [1] 41.82788# Double dangling end effect - ser05 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.double.dangle = "ser05")## [1] 42.78815Long dangling end effect
The nearest neighbour model for computation in case of sequences with
a double or secondary dangling ends can be specified by the argument
method.long.dangle. The available methods are given in
Table 10.
Table 10: Details of methods for sequences with long dangling ends
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
sugdna02* |
DNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
sugrna02* |
RNA | Only terminal poly A self complementary sequences. | Ohmichi et al. (2002) |
Examples
DNA:----GCATATGCAAAA
||||||||
DNA:AAAACGTATACG----
RNA:AAAAGCAUAUGC----
||||||||
RNA:----CGUAUACGAAAA# Long dangling end effect - default (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 55.69854# Long dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
Na.conc = 1, method.long.dangle = "sugdna02")## [1] 55.69854# Long dangling end effect - default (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 57.21314# Long dangling end effect - sugrna02 (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.long.dangle = "sugrna02")## [1] 57.21314Internal loop effect
The nearest neighbour model for computation in case of sequences with
an internal loop (more than two adjacent mismatches) can be specified by
the argument method.internal.loop. The available methods
are given in Table 11.
Table 11: Details of methods for sequences with internal loops
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
san04* |
DNA | Missing asymmetry penalty. Not tested with experimental results. | SantaLucia and Hicks (2004) |
tur06 |
RNA | Not tested with experimental results. | Lu et al. (2006) |
zno07* |
RNA | Only for 1x2 loop. | Badhwar et al. (2007) |
Examples
DNA:GCGATTGGCACTTTGGTGAAC
||||| ||||||||||||
DNA:CGCTACATATGAAACCACTTG
RNA:GACAC-GCUG
|||| ||||
RNA:CUGUAUCGAC# Internal loop effect - default (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 84.09052# Internal loop effect - san04 (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.internal.loop = "san04")## [1] 84.09052# Internal loop effect - default (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 45.98713# Internal loop effect - zno07 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.internal.loop = "zno07")## [1] 40.49012# Internal loop effect - tur06 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.internal.loop = "tur06")## [1] 45.98713Single bulge loop effect
The nearest neighbour model for computation in case of sequences with
a single bulge loop can be specified by the argument
method.single.bulge.loop. The available methods are given
in Table 12.
Table 12: Details of methods for sequences with single bulge loop
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
tan04* |
DNA | Tan and Chen (2007) | |
san04 |
DNA | Missing closing AT penalty. | SantaLucia and Hicks (2004) |
ser07 |
RNA | Less reliable results. Some missing parameters. | Blose et al. (2007) |
tur06* |
RNA | Lu et al. (2006) |
Examples
DNA:TCGATTAGCGACACAGG
|||||||| ||||||||
DNA:AGCTAATC-CTGTGTCC
RNA:GACUCUGUC
|||| ||||
RNA:CUGA-ACAG# Single bulge loop effect - default (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 71.12754# Single bulge loop effect - tan04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.single.bulge.loop = "tan04")## [1] 71.12754# Single bulge loop effect - san04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.single.bulge.loop = "san04")## [1] 62.0496# Single bulge loop effect - default (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 39.47787# Single bulge loop effect - tur06 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.bulge.loop = "tur06")## [1] 39.47787# Single bulge loop effect - ser07 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.single.bulge.loop = "ser07")## [1] 31.42849Long bulge loop effect
The nearest neighbour model for computation in case of sequences with
long bulge loop can be specified by the argument
method.long.bulge.loop. The available methods are given in
Table 13.
Table 13: Details of methods for sequences with long bulge loop
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
san04* |
DNA | Missing closing AT penalty. | SantaLucia and Hicks (2004) |
tur06* |
RNA | Not tested with experimental results. | Mathews et al. (1999), Lu et al. (2006) |
Examples
DNA:ATATGACGCCACAGCG
||||| ||||||||
DNA:TATAC---GGTGTCGC
RNA:AUAUGACGCCACAGCG
||||| ||||||||
RNA:UAUAC---GGUGUCGC# Long bulge loop effect - default (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 51.7104# Long bulge loop effect - san04 (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.long.bulge.loop = "san04")## [1] 51.7104# Long bulge loop effect - default (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 66.0497# Long bulge loop effect - tur06 (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.long.bulge.loop = "tur06")## [1] 66.0497CNG repeats effect
The nearest neighbour model for computation in case of sequences with
CNG repeats can be specified by the argument method.CNG.
The available methods are given in Table 14.
Table 14: Details of methods for sequences with CNG repeats
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
bro05* |
RNA | Self complementary sequences. 2 to 7 CNG repeats. | Broda et al. (2005) |
Examples
RNA:GCGGCGGCGGC
|||||||||||
RNA:CGCCGCCGCCG# CNG repeats effect - default (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 94.25719# CNG repeats effect - bro05 (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.CNG = "bro05")## [1] 94.25719Inosine bases effect
The nearest neighbour model for computation in case of sequences with
inosine bases (I) can be specified by the argument
method.inosine. The available methods are given in
Table 15.
Table 15: Details of methods for sequences with inosine bases
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
san05* |
DNA | Missing parameters for tandem base pairs containing inosine bases. | Watkins and SantaLucia (2005) |
zno07* |
RNA | Only IU base pairs. | Wright et al. (2007) |
Examples
DNA:CCGICTGTIGCG
||| |||| |||
DNA:GGCCGACACCGC
RNA:GCAICGC
||| |||
RNA:CGUUGCG# Inosine bases effect - default (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 65.36853# Inosine bases effect - san05 (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.inosine = "san05")## [1] 65.36853# Inosine bases effect - default (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1)## [1] 46.75042# Inosine bases effect - zno07 (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
Na.conc = 1, method.inosine = "zno07")## [1] 46.75042Hydroxyadenine bases effect
The nearest neighbour model for computation in case of sequences with
hydroxyadenine bases can be specified by the argument
method.hydroxyadenine. The available methods are given in
Table 16.
Table 16: Details of methods for sequences with hydroxyadenine bases
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
sug01* |
DNA | Only 5’ GA*C 3’and 5’ TA*A 3’ contexts. | Kawakami et al. (2001) |
Examples
*
DNA:AGAAATGACACGGTG
|||||||||||||||
DNA:TCTTTACCGTGCCAC# Hydroxyadenine bases effect - default (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 68.46041# Hydroxyadenine bases effect - sug01 (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.hydroxyadenine = "sug01")## [1] 68.46041Azobenzenes effect
The nearest neighbour model for computation in case of sequences with
azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) can
be specified by the argument method.azobenzenes. The
available methods are given in Table 17.
Table 17: Details of methods for sequences with azobenzenes
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
asa05* |
DNA | Less reliable results when the number of cis azobenzene increases. | Asanuma et al. (2005) |
Examples
C C C C C
DNA:CTXTTAAXGAAGXGAGAXTATAXCC
|| |||| |||| |||| |||| ||
DNA:GA AATT CTTC CTCT ATAT GG# Azobenzenes effect - default (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 47.85385# Azobenzenes effect - asa05 (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.azobenzenes = "asa05")## [1] 47.85385Single Locked nucleic acid effect
The nearest neighbour model for computation in case of sequences with
single locked nucleic acids can be specified by the argument
method.locked. The available methods are given in
Table 18.
Table 18: Details of methods for sequences with single locked nucleic acids
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
mct04 |
DNA | McTigue et al. (2004) | |
owc11* |
DNA | Owczarzy et al. (2011) |
Examples
L
DNA:CCATTGCTACC
|||||||||||
DNA:GGTAACGATGG# Single locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 63.48299# Single locked nucleic acids effect - mct04 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.locked = "mct04")## [1] 63.61426# Single locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.locked = "owc11")## [1] 63.48299Consecutive Locked nucleic acids effect
The nearest neighbour model for computation in case of sequences with
consecutive locked nucleic acids can be specified by the argument
method.consecutive.locked. The available methods are given
in Table 19.
Table 19: Details of methods for sequences with single locked nucleic acids
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
owc11* |
DNA | Owczarzy et al. (2011) |
Examples
LL
DNA:GACC
||||
DNA:CTGG# Consecutive locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "GALCLC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 12.94323# Consecutive locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "GALCLC",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.consecutive.locked = "owc11")## [1] 12.94323Consecutive Locked nucleic acids with a single mismatch effect
The nearest neighbour model for computation in case of sequences with
consecutive locked nucleic acids with single mismatch can be specified
by the argument method.consecutive.locked.singleMM. The
available methods are given in Table 20.
Table 20: Details of methods for sequences with single locked nucleic acids
| Model | Type | Limits/Remarks | Reference |
|---|---|---|---|
owc11* |
DNA | Owczarzy et al. (2011) |
Examples
LLL
DNA:GACGC
|| ||
DNA:CTTCG# Consecutive locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "GALCLGLC", comp.sequence = "CTTCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1)## [1] 0.2520424# Consecutive locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "GALCLGLC", comp.sequence = "CTTCG",
nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
Na.conc = 1, method.consecutive.locked.singleMM = "owc11")## [1] 0.2520424Corrections
Once the melting temperature is computed, a correction is applied to it according to the concentration of nucleic acids, cations and/or denaturing agents.
Nucleic acid concentration
For self complementary sequences (auto detected or specified by
force.self) it is 1. Otherwise it is 4 if the both strands
are present in equivalent amount and 1 if one strand is in excess.
Ion corrections
Melting temperature is computed initially for [Na+] = 1 M, after which a correction for the presence of cations ([Na+], [K+], [Tris+] and [Mg+]) is applied either directly on the computed melting temperature or on the computed entropy.
Th correction methods for cation concentration can be specified by
the argument correction.ion.
Sodium corrections
The available correction methods for sodium concentration are given in Table 21.
Table 21: Details of the corrections for sodium concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01 |
DNA | Na>0. | Ahsen et al. (2001) |
kam71 |
DNA | Na>0; Na>=0.069; Na<=1.02. | Frank-Kamenetskii (1971) |
marschdot |
DNA | Na>=0.069; Na<=1.02. | Marmur and Doty (1962), Blake and Delcourt (1998) |
owc1904 |
DNA | Na>0. (equation 19) | Owczarzy et al. (2004) |
owc2004 |
DNA | Na>0. (equation 20) | Owczarzy et al. (2004) |
owc2104 |
DNA | Na>0. (equation 21) | Owczarzy et al. (2004) |
owc2204* |
DNA | Na>0. (equation 22) | Owczarzy et al. (2004) |
san96 |
DNA | Na>=0.1. | SantaLucia et al. (1996) |
san04 |
DNA | Na>=0.05; Na<=1.1; Oligonucleotides inferior to 16 bases. | SantaLucia and Hicks (2004), SantaLucia (1998) |
schlif |
DNA | Na>=0.07; Na<=0.12. | Schildkraut and Lifson (1965) |
tanna06 |
DNA | Na>=0.001; Na<=1. | Tan and Chen (2006) |
tanna07* |
RNA or 2’-O-MeRNA/RNA | Na>=0.003; Na<=1. | Tan and Chen (2007) |
wet91 |
RNA, DNA and RNA/DNA | Na>0. | Wetmur (1991) |
# Na correction - default (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069)## [1] 56.70492# Na correction - owc2204 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2204")## [1] 56.70492# Na correction - ahs01 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "ahs01")## [1] 54.1569# Na correction - kam71 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "kam71")## [1] 51.72963# Na correction - marschdot (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "marschdot")## [1] 49.18075# Na correction - owc1904 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc1904")## [1] 56.18571# Na correction - owc2004 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2004")## [1] 56.67553# Na correction - owc2104 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "owc2104")## [1] 56.63967# Na correction - san96 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "san96")## [1] 53.01651# Na correction - san04 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "san04")## [1] 54.15157# Na correction - schlif (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "schlif")## [1] 48.25579# Na correction - tanna06 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "tanna06")## [1] 55.26711# Na correction - wet91 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, correction.ion = "wet91")## [1] 51.74573# Na correction - default (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069)## [1] 75.1552# Na correction - tanna07 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, correction.ion = "tanna07")## [1] 75.1552# Na correction - wet91 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, correction.ion = "wet91")## [1] 69.55572# Na correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069)## [1] 81.57763# Na correction - tanna07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, correction.ion = "tanna07")## [1] 81.57763# Na correction - default (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
Na.conc = 0.069)## [1] 62.08869# Na correction - wet91 (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
Na.conc = 0.069, correction.ion = "wet91")## [1] 62.08869Magnesium corrections
The available correction methods for magnesium concentration are given in Table 22.
Table 22: Details of the corrections for magnesium concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
owcmg08* |
DNA | Mg>=0.0005; Mg<=0.6. | Owczarzy et al. (2008) |
tanmg06 |
DNA | Mg>=0.0001; Mg<=1; Oligomer length superior to 6 base pairs. | Tan and Chen (2006) |
tanmg07* |
RNA or 2’-O-MeRNA/RNA | Mg>=0.1; Mg<=0.3. | Tan and Chen (2007) |
# Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015)## [1] 65.52043# Mg correction - owcmg08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015, correction.ion = "owcmg08")## [1] 65.52043# Mg correction - tanmg06 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Mg.conc = 0.0015, correction.ion = "tanmg06")## [1] 64.88082# Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Mg.conc = 0.0015)## [1] 82.0796# Mg correction - tanmg07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Mg.conc = 0.0015, correction.ion = "tanmg07")## [1] 82.0796# Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Mg.conc = 0.0015)## [1] 90.06842# Mg correction - tanmg07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Mg.conc = 0.0015, correction.ion = "tanmg07")## [1] 90.06842Mixed Sodium and Magnesium corrections
The available correction methods for mixed sodium magnesium concentration are given in Table 23.
Table 23: Details of the corrections for mixed sodium and magnesium concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
owcmix08* |
DNA | Mg>=0.0005; Mg<=0.6; Na+K+Tris/2>0. | Owczarzy et al. (2008) |
tanmix07 |
DNA, RNA or 2’-O-MeRNA/RNA | Mg>=0.1; Mg<=0.3; Na+K+Tris/2>=0.1; Na+K+Tris/2<=0.3. | Tan and Chen (2007) |
# Mixed Na & Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 65.83371# Mixed Na & Mg correction - owcmix08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "owcmix08")## [1] 65.83371# Mixed Na & Mg correction - tanmix07 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")## [1] 63.21723# Mixed Na & Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 79.40119# Mixed Na & Mg correction - tanmix07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")## [1] 79.40119# Mixed Na & Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 96.46186# Mixed Na & Mg correction - tanmix07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")## [1] 96.46186The ion correction by Owczarzy et al. (2008) is used by default according to the $\frac{[\textrm{Mg}^{2+}]^{0.5}}{[\textrm{Mon}^{+}]}$ ratio, where [Mon+] = Na+] + [Tris+] + [K+].
If,
- [K+] = 0, default sodium correction is used;
- Ratio < 0.22, default sodium correction is used;
- 0.22 ≤ Ratio < 6, default mixed Na and Mg correction is used and
- Ratio ≥ 6,default magnesium correction is used.
Note that [Tris+] is about half of the total tris buffer concentration.
Sodium equivalent concentration methods
The available correction methods for mixed sodium magnesium concentration are given in Table 24.
Table 24: Details of the methods for computation of sodium equivalent concentration in the presence of other ions
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01* |
DNA | Ahsen et al. (2001) | |
mit96 |
DNA | Mitsuhashi (1996) | |
pey00 |
DNA | Peyret (2000) |
# Na equivalent concentration method - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015)## [1] 65.83371# Na equivalent concentration method - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "ahs01")## [1] 65.83371# Na equivalent concentration method - mit96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "mit96")## [1] 65.83371# Na equivalent concentration method - pey00 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "pey00")## [1] 65.83371Denaturing agent corrections
These include melting temperature corrections for concentration of formamide and DMSO.
DMSO corrections
The available correction methods for DMSO concentration are given in Table 25.
Table 25: Details of the corrections for DMSO concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
ahs01* |
DNA | Not tested with experimental results. | Ahsen et al. (2001) |
cul76 |
DNA | Not tested with experimental results. | Cullen and Bick (1976) |
esc80 |
DNA | Not tested with experimental results. | Escara and Hutton (1980) |
mus81 |
DNA | Not tested with experimental results. | Musielski et al. (1981) |
# DMSO correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10)## [1] 65.40154# DMSO correction - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "ahs01")## [1] 65.40154# DMSO correction - cul76 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "cul76")## [1] 67.90154# DMSO correction - esc80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "esc80")## [1] 66.15154# DMSO correction - mus80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, DMSO.conc = 10, correction.DMSO = "mus81")## [1] 66.90154Formamide corrections
The available correction methods for formamide concentration are given in Table 26.
Table 26: Details of the corrections for formamide concentration
| Correction | Type | Limits/Remarks | Reference |
|---|---|---|---|
bla96* |
DNA | With formamide concentration in mol/L. | Blake (1996) |
lincorr |
DNA | With a % of formamide volume. | McConaughy et al. (1969), Record (1967), Casey and Davidson (1977), Hutton (1977) |
# Formamide correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 0.06)## [1] 72.74867# Formamide correction - bla96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 0.06, correction.formamide = "bla96")## [1] 72.74867# Formamide correction - lincorr (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
Na.conc = 1, formamide.conc = 10, correction.formamide = "lincorr")## [1] 66.40154Equivalent options in MELTING 5
The options in MELTING 5 command line equivalent to the arguments in
rmelting are given in Table 27.
Table 27: Arguments in rmelting and
their equivalent options in MELTING 5 command line.
rmelting |
MELTING 5 (command line) |
|---|---|
sequence |
-S |
comp.sequence |
-C |
nucleic.acid.conc |
-P |
hybridisation.type |
-H |
Na.conc |
-E |
Mg.conc |
-E |
Tris.conc |
-E |
K.conc |
-E |
dNTP.conc |
-E |
DMSO.conc |
-E |
formamide.conc |
-E |
size.threshold |
-T |
self |
-self |
correction.factor |
-F |
method.approx |
-am |
method.nn |
-nn |
method.GU |
-GU |
method.singleMM |
-sinMM |
method.tandemMM |
-tanMM |
method.single.dangle |
-sinDE |
method.double.dangle |
-secDE |
method.long.dangle |
-lonDE |
method.internal.loop |
-intLP |
method.single.bulge.loop |
-sinBU |
method.long.bulge.loop |
-lonBU |
method.CNG |
-CNG |
method.inosine |
-ino |
method.hydroxyadenine |
-ha |
method.azobenzenes |
-azo |
method.locked |
-lck |
method.consecutive.locked |
-tanLck |
method.consecutive.locked.singleMM |
-sinMMLck |
correction.ion |
-ion |
method.Naeq |
-naeq |
Batch computation
Melting temperature for multiple nucleic acid duplexes can be
computed using the meltingBatch function.
sequence <- c("CAAAAAG", "CAAAAAAG", "TTTTATAATAAA", "CCATCGCTACC",
"CAAACAAAG", "CCATTGCTACC", "CAAAAAAAG", "GTGAAC", "AAAAAAAA",
"CAACTTGATATTATTA", "CAAATAAAG", "GCGAGC", "GGGACC",
"CAAAGAAAG", "CTGACAAGTGTC", "GCGAAAAGCG")
meltingBatch(sequence, nucleic.acid.conc = 0.0004,
hybridisation.type = "dnadna", Na.conc = 1)## Environment.Sequence Environment.Complementary sequence
## [1,] "CAAAAAG" "GTTTTTC"
## [2,] "CAAAAAAG" "GTTTTTTC"
## [3,] "TTTTATAATAAA" "AAAATATTATTT"
## [4,] "CCATCGCTACC" "GGTAGCGATGG"
## [5,] "CAAACAAAG" "GTTTGTTTC"
## [6,] "CCATTGCTACC" "GGTAACGATGG"
## [7,] "CAAAAAAAG" "GTTTTTTTC"
## [8,] "GTGAAC" "CACTTG"
## [9,] "AAAAAAAA" "TTTTTTTT"
## [10,] "CAACTTGATATTATTA" "GTTGAACTATAATAAT"
## [11,] "CAAATAAAG" "GTTTATTTC"
## [12,] "GCGAGC" "CGCTCG"
## [13,] "GGGACC" "CCCTGG"
## [14,] "CAAAGAAAG" "GTTTCTTTC"
## [15,] "CTGACAAGTGTC" "GACTGTTCACAG"
## [16,] "GCGAAAAGCG" "CGCTTTTCGC"
## Environment.Nucleic acid concentration (M) Environment.Hybridization type
## [1,] "4e-04" "dnadna"
## [2,] "4e-04" "dnadna"
## [3,] "4e-04" "dnadna"
## [4,] "4e-04" "dnadna"
## [5,] "4e-04" "dnadna"
## [6,] "4e-04" "dnadna"
## [7,] "4e-04" "dnadna"
## [8,] "4e-04" "dnadna"
## [9,] "4e-04" "dnadna"
## [10,] "4e-04" "dnadna"
## [11,] "4e-04" "dnadna"
## [12,] "4e-04" "dnadna"
## [13,] "4e-04" "dnadna"
## [14,] "4e-04" "dnadna"
## [15,] "4e-04" "dnadna"
## [16,] "4e-04" "dnadna"
## Environment.Na concentration (M) Environment.Mg concentration (M)
## [1,] "1" "0"
## [2,] "1" "0"
## [3,] "1" "0"
## [4,] "1" "0"
## [5,] "1" "0"
## [6,] "1" "0"
## [7,] "1" "0"
## [8,] "1" "0"
## [9,] "1" "0"
## [10,] "1" "0"
## [11,] "1" "0"
## [12,] "1" "0"
## [13,] "1" "0"
## [14,] "1" "0"
## [15,] "1" "0"
## [16,] "1" "0"
## Environment.Tris concentration (M) Environment.K concentration (M)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## Environment.dNTP concentration (M) Environment.DMSO concentration (%)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## Environment.Formamide concentration (M or %)
## [1,] "0"
## [2,] "0"
## [3,] "0"
## [4,] "0"
## [5,] "0"
## [6,] "0"
## [7,] "0"
## [8,] "0"
## [9,] "0"
## [10,] "0"
## [11,] "0"
## [12,] "0"
## [13,] "0"
## [14,] "0"
## [15,] "0"
## [16,] "0"
## Environment.Self complementarity Environment.Correction factor
## [1,] "FALSE" "4"
## [2,] "FALSE" "4"
## [3,] "FALSE" "4"
## [4,] "FALSE" "4"
## [5,] "FALSE" "4"
## [6,] "FALSE" "4"
## [7,] "FALSE" "4"
## [8,] "FALSE" "4"
## [9,] "FALSE" "4"
## [10,] "FALSE" "4"
## [11,] "FALSE" "4"
## [12,] "FALSE" "4"
## [13,] "FALSE" "4"
## [14,] "FALSE" "4"
## [15,] "FALSE" "4"
## [16,] "FALSE" "4"
## Options.Approximative formula Options.Nearest neighbour model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.GU model Options.Single mismatch model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Tandem mismatch model Options.Single dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Double dangling end model Options.Long dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Internal loop model Options.Single bulge loop model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Long bulge loop model Options.CNG repeats model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Inosine bases model Options.Hydroxyadenine bases model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Azobenzenes model Options.Locked nucleic acids model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Ion correction method Options.Na equivalence correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.DMSO correction method Options.Formamide correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## Options.Mode Results.Enthalpy (cal) Results.Entropy (cal)
## [1,] NA "-47700" "-138.1"
## [2,] NA "-55600" "-160.3"
## [3,] NA "-78800" "-229.7"
## [4,] NA "-83500" "-227"
## [5,] NA "-64600" "-183.2"
## [6,] NA "-81100" "-222.5"
## [7,] NA "-63500" "-182.5"
## [8,] NA "-41200" "-117.5"
## [9,] NA "-50700" "-147.2"
## [10,] NA "-113800" "-323.6"
## [11,] NA "-62100" "-179.8"
## [12,] NA "-46000" "-124.8"
## [13,] NA "-40400" "-109.9"
## [14,] NA "-63700" "-181.3"
## [15,] NA "-90400" "-249.5"
## [16,] NA "-80300" "-218.6"
## Results.Enthalpy (J) Results.Entropy (J) Results.Melting temperature (C)
## [1,] "-199386" "-577.258" "31.7814953255144"
## [2,] "-232408" "-670.054" "38.1103863719918"
## [3,] "-329384" "-960.146" "44.5553259145469"
## [4,] "-349030" "-948.86" "67.2098590318261"
## [5,] "-270028" "-765.776" "47.400072116762"
## [6,] "-338998" "-930.05" "63.6040550863501"
## [7,] "-265430" "-762.85" "43.0400604037136"
## [8,] "-172216" "-491.15" "30.1735038367475"
## [9,] "-211926" "-615.296" "33.1415226764116"
## [10,] "-475684" "-1352.648" "59.6680431282422"
## [11,] "-259578" "-751.564" "40.2828264688437"
## [12,] "-192280" "-521.664" "48.2393469411973"
## [13,] "-168872" "-459.382" "41.9123740666287"
## [14,] "-266266" "-757.834" "45.9425910944819"
## [15,] "-377872" "-1042.91" "64.379329012421"
## [16,] "-335654" "-913.748" "65.7707030297917"
## Message
## [1,] NA
## [2,] NA
## [3,] NA
## [4,] NA
## [5,] NA
## [6,] NA
## [7,] NA
## [8,] NA
## [9,] NA
## [10,] NA
## [11,] NA
## [12,] NA
## [13,] NA
## [14,] NA
## [15,] NA
## [16,] NAComplementary sequences are computed by default, but need to be specified in case of mismatches, inosine(s) or hydroxyadenine(s) between the two strands.
seq <- c("GCAUACG", "CAGUAGGUC", "CGCUCGC", "GAGUGGAG", "GACAGGCUG",
"CAGUACGUC", "GACAUCCUG", "GACCACCUG", "CAGAAUGUC", "GCGUCGC",
"CGUCCGG", "GACUCUCUG", "CAGCUGGUC", "GACUAGCUG", "CUCUGCUC",
"GCGUCCG", "GUCCGCG", "CGAUCAC", "GACUACCUG", "GACGAUCUG")
comp.seq <- c("CGUUUGC", "GUCGGCCAG", "GCGUGCG", "CUCUUCUC", "CUGUGCGAC",
"GUCGGGCAG", "CUGUUGGAC", "CUGGGGGAC", "GUCUGGCAG", "CGCUGCG",
"GCUGGCC", "CUGAUAGAC", "GUCGUUCAG", "CUGAGCGAC", "GAGUUGAG",
"CGCUGGC", "CUGGCGC", "GCUUGUG", "CUGAGGGAC", "CUGCCAGAC")
meltingBatch(sequence = seq, comp.seq = comp.seq, nucleic.acid.conc = 0.0004,
hybridisation.type = "rnarna", Na.conc = 1,
method.singleMM = "tur06")## Environment.Sequence Environment.Complementary sequence
## [1,] "GCAUACG" "CGUUUGC"
## [2,] "CAGUAGGUC" "GUCGGCCAG"
## [3,] "CGCUCGC" "GCGUGCG"
## [4,] "GAGUGGAG" "CUCUUCUC"
## [5,] "GACAGGCUG" "CUGUGCGAC"
## [6,] "CAGUACGUC" "GUCGGGCAG"
## [7,] "GACAUCCUG" "CUGUUGGAC"
## [8,] "GACCACCUG" "CUGGGGGAC"
## [9,] "CAGAAUGUC" "GUCUGGCAG"
## [10,] "GCGUCGC" "CGCUGCG"
## [11,] "CGUCCGG" "GCUGGCC"
## [12,] "GACUCUCUG" "CUGAUAGAC"
## [13,] "CAGCUGGUC" "GUCGUUCAG"
## [14,] "GACUAGCUG" "CUGAGCGAC"
## [15,] "CUCUGCUC" "GAGUUGAG"
## [16,] "GCGUCCG" "CGCUGGC"
## [17,] "GUCCGCG" "CUGGCGC"
## [18,] "CGAUCAC" "GCUUGUG"
## [19,] "GACUACCUG" "CUGAGGGAC"
## [20,] "GACGAUCUG" "CUGCCAGAC"
## Environment.Nucleic acid concentration (M) Environment.Hybridization type
## [1,] "4e-04" "rnarna"
## [2,] "4e-04" "rnarna"
## [3,] "4e-04" "rnarna"
## [4,] "4e-04" "rnarna"
## [5,] "4e-04" "rnarna"
## [6,] "4e-04" "rnarna"
## [7,] "4e-04" "rnarna"
## [8,] "4e-04" "rnarna"
## [9,] "4e-04" "rnarna"
## [10,] "4e-04" "rnarna"
## [11,] "4e-04" "rnarna"
## [12,] "4e-04" "rnarna"
## [13,] "4e-04" "rnarna"
## [14,] "4e-04" "rnarna"
## [15,] "4e-04" "rnarna"
## [16,] "4e-04" "rnarna"
## [17,] "4e-04" "rnarna"
## [18,] "4e-04" "rnarna"
## [19,] "4e-04" "rnarna"
## [20,] "4e-04" "rnarna"
## Environment.Na concentration (M) Environment.Mg concentration (M)
## [1,] "1" "0"
## [2,] "1" "0"
## [3,] "1" "0"
## [4,] "1" "0"
## [5,] "1" "0"
## [6,] "1" "0"
## [7,] "1" "0"
## [8,] "1" "0"
## [9,] "1" "0"
## [10,] "1" "0"
## [11,] "1" "0"
## [12,] "1" "0"
## [13,] "1" "0"
## [14,] "1" "0"
## [15,] "1" "0"
## [16,] "1" "0"
## [17,] "1" "0"
## [18,] "1" "0"
## [19,] "1" "0"
## [20,] "1" "0"
## Environment.Tris concentration (M) Environment.K concentration (M)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## [17,] "0" "0"
## [18,] "0" "0"
## [19,] "0" "0"
## [20,] "0" "0"
## Environment.dNTP concentration (M) Environment.DMSO concentration (%)
## [1,] "0" "0"
## [2,] "0" "0"
## [3,] "0" "0"
## [4,] "0" "0"
## [5,] "0" "0"
## [6,] "0" "0"
## [7,] "0" "0"
## [8,] "0" "0"
## [9,] "0" "0"
## [10,] "0" "0"
## [11,] "0" "0"
## [12,] "0" "0"
## [13,] "0" "0"
## [14,] "0" "0"
## [15,] "0" "0"
## [16,] "0" "0"
## [17,] "0" "0"
## [18,] "0" "0"
## [19,] "0" "0"
## [20,] "0" "0"
## Environment.Formamide concentration (M or %)
## [1,] "0"
## [2,] "0"
## [3,] "0"
## [4,] "0"
## [5,] "0"
## [6,] "0"
## [7,] "0"
## [8,] "0"
## [9,] "0"
## [10,] "0"
## [11,] "0"
## [12,] "0"
## [13,] "0"
## [14,] "0"
## [15,] "0"
## [16,] "0"
## [17,] "0"
## [18,] "0"
## [19,] "0"
## [20,] "0"
## Environment.Self complementarity Environment.Correction factor
## [1,] "FALSE" "4"
## [2,] "FALSE" "4"
## [3,] "FALSE" "4"
## [4,] "FALSE" "4"
## [5,] "FALSE" "4"
## [6,] "FALSE" "4"
## [7,] "FALSE" "4"
## [8,] "FALSE" "4"
## [9,] "FALSE" "4"
## [10,] "FALSE" "4"
## [11,] "FALSE" "4"
## [12,] "FALSE" "4"
## [13,] "FALSE" "4"
## [14,] "FALSE" "4"
## [15,] "FALSE" "4"
## [16,] "FALSE" "4"
## [17,] "FALSE" "4"
## [18,] "FALSE" "4"
## [19,] "FALSE" "4"
## [20,] "FALSE" "4"
## Options.Approximative formula Options.Nearest neighbour model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.GU model Options.Single mismatch model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Tandem mismatch model Options.Single dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Double dangling end model Options.Long dangling end model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Internal loop model Options.Single bulge loop model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Long bulge loop model Options.CNG repeats model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Inosine bases model Options.Hydroxyadenine bases model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Azobenzenes model Options.Locked nucleic acids model
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Ion correction method Options.Na equivalence correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.DMSO correction method Options.Formamide correction method
## [1,] NA NA
## [2,] NA NA
## [3,] NA NA
## [4,] NA NA
## [5,] NA NA
## [6,] NA NA
## [7,] NA NA
## [8,] NA NA
## [9,] NA NA
## [10,] NA NA
## [11,] NA NA
## [12,] NA NA
## [13,] NA NA
## [14,] NA NA
## [15,] NA NA
## [16,] NA NA
## [17,] NA NA
## [18,] NA NA
## [19,] NA NA
## [20,] NA NA
## Options.Mode Results.Enthalpy (cal) Results.Entropy (cal)
## [1,] NA "-47650" "-138.8"
## [2,] NA "-71130" "-200.5"
## [3,] NA "-57930" "-164.1"
## [4,] NA "-60570" "-176.6"
## [5,] NA "-79870" "-219.9"
## [6,] NA "-68380" "-194.5"
## [7,] NA "-73880" "-208.3"
## [8,] NA "-78430" "-218.3"
## [9,] NA "-59650" "-171.5"
## [10,] NA "-61330" "-173.8"
## [11,] NA "-58350" "-165.4"
## [12,] NA "-64570" "-184.7"
## [13,] NA "-70970" "-200.6"
## [14,] NA "-72010" "-203"
## [15,] NA "-58820" "-171"
## [16,] NA "-59840" "-169.6"
## [17,] NA "-59840" "-169.6"
## [18,] NA "-50210" "-148.3"
## [19,] NA "-70520" "-198.8"
## [20,] NA "-69730" "-198.2"
## Results.Enthalpy (J) Results.Entropy (J) Results.Melting temperature (C)
## [1,] "-199177" "-580.184" "30.1048299398322"
## [2,] "-297323.4" "-838.09" "51.8989532242754"
## [3,] "-242147.4" "-685.938" "44.3989325444856"
## [4,] "-253182.6" "-738.188" "37.5791954133529"
## [5,] "-333856.6" "-919.182" "62.1162425798375"
## [6,] "-285828.4" "-813.01" "48.141439592185"
## [7,] "-308818.4" "-870.694" "52.845957204839"
## [8,] "-327837.4" "-912.494" "58.2977096620104"
## [9,] "-249337" "-716.87" "41.08087522322"
## [10,] "-256359.4" "-726.484" "46.0633145887674"
## [11,] "-243903" "-691.372" "44.4380466975271"
## [12,] "-269902.6" "-772.046" "44.8840464672343"
## [13,] "-296654.6" "-838.508" "51.0196486690585"
## [14,] "-301001.8" "-848.54" "52.203376709706"
## [15,] "-245867.6" "-714.78" "37.5268181873443"
## [16,] "-250131.2" "-708.928" "45.2688421309843"
## [17,] "-250131.2" "-708.928" "45.2688421309843"
## [18,] "-209877.8" "-619.894" "28.1788644808993"
## [19,] "-294773.6" "-830.984" "51.6345164549562"
## [20,] "-291471.4" "-828.476" "48.8860141674642"
## Message
## [1,] NA
## [2,] NA
## [3,] NA
## [4,] NA
## [5,] NA
## [6,] NA
## [7,] NA
## [8,] NA
## [9,] NA
## [10,] NA
## [11,] NA
## [12,] NA
## [13,] NA
## [14,] NA
## [15,] NA
## [16,] NA
## [17,] NA
## [18,] NA
## [19,] NA
## [20,] NAFurther reading
Further details about algorithm, formulae and methods are available in the MELTING 5 documentation.
Citing rmelting
## To cite the R package 'rmelting' in publications use:
##
## Aravind, J. and Krishna, G. K. (2024). rmelting: R Interface to
## MELTING 5. R package version 1.23.0,
## https://aravind-j.github.io/rmelting/.
##
## A BibTeX entry for LaTeX users is
##
## @Manual{,
## title = {rmelting: R Interface to MELTING 5},
## author = {J. Aravind and G. K. Krishna},
## year = {2024},
## note = {R package version 1.23.0 https://aravind-j.github.io/rmelting/},
## }
##
## This free and open-source software implements academic research by the
## authors and co-workers. If you use it, please support the project by
## citing the package.Session Info
## R version 4.4.2 (2024-10-31)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.1 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=en_US.UTF-8
## [9] LC_ADDRESS=en_US.UTF-8 LC_TELEPHONE=en_US.UTF-8
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=en_US.UTF-8
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats graphics grDevices utils datasets methods base
##
## other attached packages:
## [1] rmelting_1.23.0 readxl_1.4.3
##
## loaded via a namespace (and not attached):
## [1] vctrs_0.6.5 cli_3.6.3 knitr_1.49 rlang_1.1.4
## [5] xfun_0.49 jsonlite_1.8.9 rJava_1.0-11 glue_1.8.0
## [9] buildtools_1.0.0 htmltools_0.5.8.1 maketools_1.3.1 sys_3.4.3
## [13] sass_0.4.9 fansi_1.0.6 rmarkdown_2.29 pander_0.6.5
## [17] cellranger_1.1.0 evaluate_1.0.1 jquerylib_0.1.4 tibble_3.2.1
## [21] fastmap_1.2.0 yaml_2.3.10 lifecycle_1.0.4 compiler_4.4.2
## [25] Rcpp_1.0.13-1 pkgconfig_2.0.3 digest_0.6.37 R6_2.5.1
## [29] utf8_1.2.4 pillar_1.9.0 Rdpack_2.6.2 rbibutils_2.3
## [33] magrittr_2.0.3 bslib_0.8.0 tools_4.4.2 cachem_1.1.0References
Ahsen, N. von, Wittwer, C. T., and Schütz, E. (2001). Oligonucleotide
melting temperatures under PCR conditions:
Nearest-neighbor corrections for Mg2+,
deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with
comparison to alternative empirical formulas. Clinical
Chemistry 47, 1956–1961. Available at: http://clinchem.aaccjnls.org/content/47/11/1956.
Allawi, H. T., and SantaLucia, J. (1997). Thermodynamics and
NMR of internal G·T mismatches in
dna. Biochemistry 36, 10581–10594. doi:10.1021/bi962590c.
Allawi, H. T., and SantaLucia, J. (1998a). Nearest neighbor
thermodynamic parameters for internal G·A
mismatches in DNA. Biochemistry 37, 2170–2179.
doi:10.1021/bi9724873.
Allawi, H. T., and SantaLucia, J. (1998b). Nearest-neighbor
thermodynamics of internal A·C mismatches in
dna: Sequence dependence and pH effects.
Biochemistry 37, 9435–9444. doi:10.1021/bi9803729.
Allawi, H. T., and SantaLucia, J. (1998c). Thermodynamics of internal
C·T mismatches in DNA.
Nucleic Acids Research 26, 2694–2701. doi:10.1093/nar/26.11.2694.
Asanuma, H., Matsunaga, D., and Komiyama, M. (2005). Clear-cut
photo-regulation of the formation and dissociation of the
DNA duplex by modified oligonucleotide involving multiple
azobenzenes. Nucleic Acids Symposium Series, 35–36. doi:10.1093/nass/49.1.35.
Badhwar, J., Karri, S., Cass, C. K., Wunderlich, E. L., and Znosko, B.
M. (2007). Thermodynamic characterization of RNA duplexes
containing naturally occurring 1 × 2 nucleotide internal loops.
Biochemistry 46, 14715–14724. doi:10.1021/bi701024w.
Blake, R. D. (1996). “Denaturation of DNA,” in
Encyclopedia of molecular biology and molecular medicine, ed.
R. A. Meyers (Weinheim, Germany: VCH Verlagsgesellschaft), 1–19.
Blake, R. D., and Delcourt, S. G. (1998). Thermal stability of
DNA. Nucleic Acids Research 26, 3323–3332. doi:10.1093/nar/26.14.3323.
Blose, J. M., Manni, M. L., Klapec, K. A., Stranger-Jones, Y., Zyra, A.
C., Sim, V., et al. (2007). Non-nearest-neighbor dependence of stability
for RNA bulge loops based on the complete set of group i
single nucleotide bulge loops. Biochemistry 46, 15123–15135.
doi:10.1021/bi700736f.
Bommarito, S., Peyret, N., and SantaLucia, J. (2000). Thermodynamic
parameters for DNA sequences with dangling ends.
Nucleic Acids Research 28, 1929–1934. doi:10.1093/nar/28.9.1929.
Breslauer, K. J., Frank, R., Blöcker, H., and Marky, L. A. (1986).
Predicting DNA duplex stability from the base sequence.
Proceedings of the National Academy of Sciences 83, 3746.
doi:10.1073/pnas.83.11.3746.
Britten, R. J., Graham, D. E., and Neufeld, B. R. (1974). Analysis of
repeating DNA sequences by reassociation. Methods in
Enzymology 29, 363–418. doi:10.1016/0076-6879(74)29033-5.
Broda, M., Kierzek, E., Gdaniec, Z., Kulinski, T., and Kierzek, R.
(2005). Thermodynamic stability of RNA structures formed by
CNG trinucleotide repeats. Implication for
prediction of RNA structure. Biochemistry 44,
10873–10882. doi:10.1021/bi0502339.
Casey, J., and Davidson, N. (1977). Rates of formation and thermal
stabilities of RNA:DNA and
DNA:DNA duplexes at high concentrations of
formamide. Nucleic Acids Research 4, 1539–1552. doi:10.1093/nar/4.5.1539.
Chen, J. L., Dishler, A. L., Kennedy, S. D., Yildirim, I., Liu, B.,
Turner, D. H., et al. (2012). Testing the nearest neighbor model for
canonical rna base pairs: Revision of GU
parameters. Biochemistry 51, 3508–3522. doi:10.1021/bi3002709.
Chester, N., and Marshak, D. R. (1993). Dimethyl sulfoxide-mediated
primer Tm reduction: A method for analyzing
the role of renaturation temperature in the polymerase chain reaction.
Analytical Biochemistry 209, 284–290. doi:10.1006/abio.1993.1121.
Cullen, B. R., and Bick, M. D. (1976). Thermal denaturation of
DNA from bromodeoxyuridine substituted cells. Nucleic
Acids Research 3, 49–62. doi:10.1093/nar/3.1.49.
Davis, A. R., and Znosko, B. M. (2007). Thermodynamic characterization
of single mismatches found in naturally occurring RNA.
Biochemistry 46, 13425–13436. doi:10.1021/bi701311c.
Davis, A. R., and Znosko, B. M. (2008). Thermodynamic characterization
of naturally occurring RNA single mismatches with
G-U nearest neighbors. Biochemistry
47, 10178–10187. doi:10.1021/bi800471z.
Dumousseau, M., Rodriguez, N., Juty, N., and Le Novère, N. (2012).
MELTING, a flexible platform to predict the melting
temperatures of nucleic acids. BMC Bioinformatics 13, 101.
doi:10.1186/1471-2105-13-101.
Escara, J. F., and Hutton, J. R. (1980). Thermal stability and
renaturation of DNA in dimethyl sulfoxide solutions:
Acceleration of the renaturation rate. Biopolymers
19, 1315–1327. doi:10.1002/bip.1980.360190708.
Frank-Kamenetskii, M. D. (1971). Simplification of the empirical
relationship between melting temperature of DNA, its
GC content and concentration of sodium ions in solution.
Biopolymers 10, 2623–2624. doi:10.1002/bip.360101223.
Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M.
H., Neilson, T., et al. (1986). Improved free-energy parameters for
predictions of RNA duplex stability. Proceedings of the
National Academy of Sciences 83, 9373. doi:10.1073/pnas.83.24.9373.
Hall, T. J., Grula, J. W., Davidson, E. H., and Britten, R. J. (1980).
Evolution of sea urchin non-repetitive DNA. Journal of
Molecular Evolution 16, 95–110. doi:10.1007/BF01731580.
Hutton, J. R. (1977). Renaturation kinetics and thermal stability of
DNA in aqueous solutions of formamide and urea. Nucleic
Acids Research 4, 3537–3555. doi:10.1093/nar/4.10.3537.
Kawakami, J., Kamiya, H., Yasuda, K., Fujiki, H., Kasai, H., and
Sugimoto, N. (2001). Thermodynamic stability of base pairs between
2-hydroxyadenine and incoming nucleotides as a determinant of nucleotide
incorporation specificity during replication. Nucleic Acids
Research 29, 3289–3296. doi:10.1093/nar/29.16.3289.
Kierzek, E., Mathews, D. H., Ciesielska, A., Turner, D. H., and Kierzek,
R. (2006). Nearest neighbor parameters for
Watson-Crick complementary heteroduplexes
formed between 2’-O-methyl RNA and
RNA oligonucleotides. Nucleic Acids Research 34,
3609–3614. doi:10.1093/nar/gkl232.
Le Novère, N. (2001). MELTING, computing the melting
temperature of nucleic acid duplex. Bioinformatics 17,
1226–1227. doi:10.1093/bioinformatics/17.12.1226.
Lu, Z. J., Turner, D. H., and Mathews, D. H. (2006). A set of nearest
neighbor parameters for predicting the enthalpy change of
RNA secondary structure formation. Nucleic Acids
Research 34, 4912–4924. doi:10.1093/nar/gkl472.
Marmur, J., and Doty, P. (1962). Determination of the base composition
of deoxyribonucleic acid from its thermal denaturation temperature.
Journal of Molecular Biology 5, 109–118. doi:10.1016/S0022-2836(62)80066-7.
Mathews, D. H., Sabina, J., Zuker, M., and Turner, D. H. (1999).
Expanded sequence dependence of thermodynamic parameters improves
prediction of RNA secondary structure. Journal of
Molecular Biology 288, 911–940. doi:10.1006/jmbi.1999.2700.
McConaughy, B. L., Laird, Cd., and McCarthy, B. J. (1969). Nucleic acid
reassociation in formamide. Biochemistry 8, 3289–3295. doi:10.1021/bi00836a024.
McTigue, P. M., Peterson, R. J., and Kahn, J. D. (2004).
Sequence-dependent thermodynamic parameters for locked nucleic acid
(LNA)-DNA duplex formation.
Biochemistry 43, 5388–5405. doi:10.1021/bi035976d.
Miller, S., Jones, L. E., Giovannitti, K., Piper, D., and Serra, M. J.
(2008). Thermodynamic analysis of 5’ and 3’ single- and 3’
double-nucleotide overhangs neighboring wobble terminal base pairs.
Nucleic Acids Research 36, 5652–5659. doi:10.1093/nar/gkn525.
Mitsuhashi, M. (1996). Technical report: Part 1.
Basic requirements for designing optimal oligonucleotide
probe sequences. Journal of Clinical Laboratory Analysis 10,
277–284. doi:10/cw9bn6.
Musielski, H., Mann, W., Laue, R., and Michel, S. (1981). Influence of
dimethylsulfoxide on transcription by bacteriophage
T3-induced RNA polymerase. Zeitschrift für
allgemeine Mikrobiologie 21, 447–456. doi:10.1002/jobm.19810210606.
O’Toole, A. S., Miller, S., Haines, N., Zink, M. C., and Serra, M. J.
(2006). Comprehensive thermodynamic analysis of 3’ double-nucleotide
overhangs neighboring Watson-Crick terminal
base pairs. Nucleic Acids Research 34, 3338–3344. doi:10.1093/nar/gkl428.
O’Toole, A. S., Miller, S., and Serra, M. J. (2005). Stability of 3’
double nucleotide overhangs that model the 3’ ends of siRNA. RNA 11, 512–516. doi:10.1261/rna.7254905.
Ohmichi, T., Nakano, S., Miyoshi, D., and Sugimoto, N. (2002). Long
RNA dangling end has large energetic contribution to duplex
stability. Journal of the American Chemical Society 124,
10367–10372. doi:10.1021/ja0255406.
Owczarzy, R., Moreira, B. G., You, Y., Behlke, M. A., and Walder, J. A.
(2008). Predicting stability of DNA duplexes in solutions
containing magnesium and monovalent cations. Biochemistry 47,
5336–5353. doi:10.1021/bi702363u.
Owczarzy, R., You, Y., Groth, C. L., and Tataurov, A. V. (2011).
Stability and mismatch discrimination of locked nucleic
acid–DNA duplexes. Biochemistry 50, 9352–9367.
doi:10.1021/bi200904e.
Owczarzy, R., You, Y., Moreira, B. G., Manthey, J. A., Huang, L.,
Behlke, M. A., et al. (2004). Effects of sodium ions on DNA
duplex oligomers: Improved predictions of melting
temperatures. Biochemistry 43, 3537–3554. doi:10.1021/bi034621r.
Owen, R., Hill, L., and Lapage, S. (1969). Determination of
DNA base compositions from melting profiles in dilute
buffers. Biopolymers 7, 503–516. doi:10.1002/bip.1969.360070408.
Peyret, N. (2000). Prediction of nucleic acid hybridization:
Parameters and algorithms. Available at: http://elibrary.wayne.edu/record=2760965.
Peyret, N., Seneviratne, P. A., Allawi, H. T., and SantaLucia, J.
(1999). Nearest-Neighbor Thermodynamics and
NMR of DNA Sequences with
Internal A·A,
C·C, G·G, and
T·T Mismatches.
Biochemistry 38, 3468–3477. doi:10.1021/bi9825091.
Record, M. T. (1967). Electrostatic effects on polynucleotide
transitions. I. Behavior at neutral pH. Biopolymers 5, 975–992. doi:10.1002/bip.1967.360051010.
SantaLucia, J. (1998). A unified view of polymer, dumbbell, and
oligonucleotide DNA nearest-neighbor thermodynamics.
Proceedings of the National Academy of Sciences 95, 1460.
doi:10.1073/pnas.95.4.1460.
SantaLucia, J., and Hicks, D. (2004). The thermodynamics of
DNA structural motifs. Annual Review of Biophysics and
Biomolecular Structure 33, 415–440. doi:10.1146/annurev.biophys.32.110601.141800.
SantaLucia, John, Allawi, H. T., and Seneviratne, P. A. (1996). Improved
nearest-neighbor parameters for predicting DNA duplex
stability. Biochemistry 35, 3555–3562. doi:10.1021/bi951907q.
Schildkraut, C., and Lifson, S. (1965). Dependence of the melting
temperature of DNA on salt concentration.
Biopolymers 3, 195–208. doi:10.1002/bip.360030207.
Sugimoto, N., Nakano, S., Yoneyama, M., and Honda, K. (1996). Improved
thermodynamic parameters and helix initiation factor to predict
stability of DNA duplexes. Nucleic Acids Research
24, 4501–4505. doi:10.1093/nar/24.22.4501.
Tan, Z.-J., and Chen, S.-J. (2006). Nucleic acid helix stability:
Effects of salt concentration, cation valence and size, and
chain length. Biophysical Journal 90, 1175–1190. doi:10.1529/biophysj.105.070904.
Tan, Z.-J., and Chen, S.-J. (2007). RNA helix stability in
mixed Na(+)/Mg(2+) solution. Biophysical
Journal 92, 3615–3632. doi:10.1529/biophysj.106.100388.
Tanaka, F., Kameda, A., Yamamoto, M., and Ohuchi, A. (2004).
Thermodynamic parameters based on a nearest-neighbor model for
DNA sequences with a single-bulge loop.
Biochemistry 43, 7143–7150. doi:10.1021/bi036188r.
Wahl, G. M., Barger, S. L., and Kimmel, A. R. (1987). Molecular
hybridization of immobilized nucleic acids: Theoretical
concepts and practical considerations. Methods in Enzymology
152, 399–407. doi:10.1016/0076-6879(87)52046-8.
Watkins, N. E., Kennelly, W. J., Tsay, M. J., Tuin, A., Swenson, L.,
Lee, H.-R., et al. (2011). Thermodynamic contributions of single
internal rA·dA, rC·dC, rG·dG and rU·dT mismatches in
RNA/DNA duplexes. Nucleic Acids
Research 39, 1894–1902. doi:10/cdm4jh.
Watkins, N. E., and SantaLucia, J. (2005). Nearest-neighbor
thermodynamics of deoxyinosine pairs in DNA duplexes.
Nucleic Acids Research 33, 6258–6267. doi:10.1093/nar/gki918.
Wetmur, J. G. (1991). DNA probes: Applications
of the principles of nucleic acid hybridization. Critical Reviews in
Biochemistry and Molecular Biology 26, 227–259. doi:10.3109/10409239109114069.
Wright, D. J., Rice, J. L., Yanker, D. M., and Znosko, B. M. (2007).
Nearest neighbor parameters for inosine·uridine pairs in
RNA duplexes. Biochemistry 46, 4625–4634. doi:10.1021/bi0616910.
Xia, T., SantaLucia, J., Burkard, M. E., Kierzek, R., Schroeder, S. J.,
Jiao, X., et al. (1998). Thermodynamic parameters for an expanded
nearest-neighbor model for formation of RNA duplexes with
Watson-Crick base pairs. Biochemistry
37, 14719–14735. doi:10.1021/bi9809425.