| Title: | Quantify the Extent of Evolutionary Evidence in Molecular Sequences |
|---|---|
| Description: | Biological inferences obtained from molecular data are only as good as the extent of evolutionary signatures retained in the genetic data. Techniques available to quantify these signatures are largely targeted towards phylogeny reconstruction and they often rely on adhoc hypothesis tests of significance. I present a Bayesian function that assesses whether a set of genetic sequences are saturated. That is, it is useful for determining whether the evolutionary information in the sequences has eroded with time. Site specific Bayes factors are generated with respect to codon bases to allow for straightforward applications in extensive computational biology inquiries, including natural selection analyses. |
| Authors: | Hassan Sadiq [aut, cre, cph, fnd] (ORCID: <https://orcid.org/0000-0003-0192-7134>) |
| Maintainer: | Hassan Sadiq <[email protected]> |
| License: | GPL-3 + file LICENSE |
| Version: | 1.1.1 |
| Built: | 2026-06-22 22:08:20 UTC |
| Source: | https://github.com/bioc/queeems |
queeems PackageObtain citations of research outputs that may assist with understanding
and extending the applications of the queeems package.
aboutQueeems(cite=NULL)aboutQueeems(cite=NULL)
cite |
A strictly positive integer. |
Citations included are with respect to outputs that significantly use
the queeems package and that the package author contributes to.
The list will be extended as more outputs are published. When
cite = NULL is set (default), all the available citations are
listed. If the integer input for cite exceeds the number of
available citations, an error message is returned.
A text that contains citations associated with the queeems
package, as explained in Details.
Hassan Sadiq
aboutQueeems()aboutQueeems()
Obtain, from empirical molecular data, frequencies of each base (DNA, codon or amino acid) per data site.
baseFrequency(fastafile, basename="dna")baseFrequency(fastafile, basename="dna")
fastafile |
path to a FASTA format file that contains a protein sequence. |
basename |
identification of the protein constituent base. |
basename should be a character input and one of 'dna' (defualt),
'codon' or 'aa'. Any other input will trigger an error. A warning message
may also be returned if there is an indication of sequence-basename
mismatch. For example if 'dna' is specified for a protein sequence
saved in terms of amino acid bases.
A baseSummary object that contains a matrix of site-wise
base frequencies that are labelled with the corresponding base notation.
Hassan Sadiq
The baseSummary class for further description of the
output and other similar fuctions such as CnCs and
diffNucBinary. Sample FASTA files may also be accessed
using the queeemsExtdata function.
testData <- queeemsExtdata("PI.fasta") tested <- baseFrequency(testData, "codon") testedtestData <- queeemsExtdata("PI.fasta") tested <- baseFrequency(testData, "codon") tested
Ensure that numerical extracts from protein data are stored and handled elegantly.
Objects of this (baseSummary) class can be created by calls of
the form new("baseSummary", baseType, extantSize, seqsNumerics).
baseType:description of the bases that make up the corrsponding protein sequence.
extantSize:number of sequences in the protein data.
seqsNumerics:numerical data that describe the distribution of the primary bases in the captured protein sequences.
signature(object="baseSummary") useful output
highlights.
signature(bsumm="baseSummary") number of
protein sequences.
signature(bsumm="baseSummary") how protein
data positions must be interpreted.
signature(bsumm="baseSummary") numerical
summary of the empirical protein base distribution.
The baseType slot should be one of `aa`, `codon`
or `dna` depending on whether the protein sequence sites must
be analysed as 'amino acid', 'codon' or 'DNA' positions. The rows of the
element of the seqsNumerics slot are defined with respect to the
alphabetically ordered IUPAC abbreviations of the corresponding
baseType input. Each column of the matrix represents the relevant
protein site.
Hassan Sadiq
The baseFrequency function that returns baseSummary
objects.
proteinFile <- queeemsExtdata("PI.fasta") testEG <- baseFrequency(proteinFile, "codon") head( basecensus(testEG))[,seq(1,6)] datatype(testEG) nseqs(testEG) testEGproteinFile <- queeemsExtdata("PI.fasta") testEG <- baseFrequency(proteinFile, "codon") head( basecensus(testEG))[,seq(1,6)] datatype(testEG) nseqs(testEG) testEG
Converts a Biostrings::BStringSet object to a matrix of codons.
bstringCodons(bstringset)bstringCodons(bstringset)
bstringset |
A BStringSet object. |
A matrix of codon bases. Each column of the matrix will contain the site data and each row will hold the respective sequence that make up the input protein data.
Hassan Sadiq
dataPath <- queeemsExtdata("PI.fasta") bstringdata <- readBStringSet(dataPath) testing <- bstringCodons(bstringdata) head(testing)[,seq(1,6)]dataPath <- queeemsExtdata("PI.fasta") bstringdata <- readBStringSet(dataPath) testing <- bstringCodons(bstringdata) head(testing)[,seq(1,6)]
Get details of citations that may further assist with understanding of package utility.
Objects of this (citing) class can be created by calls of the
form new("citing", citeText=...).
citeText:printable text that may be pasted directly as references into scientific write-ups.
signature(object = "citing") prints the input
text.
Hassan Sadiq
The aboutQueeems function that relies on the described class.
test <- aboutQueeems() is(test, "citing") testtest <- aboutQueeems() is(test, "citing") test
Crude counts of the number of synonymous or non-synonymous matches at each codon site of input empirical molecular data.
CnCs(bstringset, synonym=FALSE, diffceil=1)CnCs(bstringset, synonym=FALSE, diffceil=1)
bstringset |
Biostrings::Bstringset object that carries an empirical protein sequence. |
synonym |
logical entry that indicates whether synonymous
[ |
diffceil |
maximum number of nucleotide mismatches that is tolerated. |
Each element of the nscensus output provides information about the
respective codon site. Consider the case where synonym = TRUE. At
each site, the most frequent codon is identified as the wildtype base.
The number of spots at the site that are filled by separate but synonymous
codons to the wild-type is recorded. Ambiguities and/or missing
observations are ignored. Sites with zero counts are considered
non-informative. Observe that such sites are not necessarily invariant.
For example, a site with three unique non-synonymous codon bases will
only be informative when non-synonymous counts are sought, i.e. if
synonym = FALSE. The diffceil input implies the maximum,
not the exact, number of nucleotide mismatches allowed. For example,
diffceil = 1 (default) accommodates zero or one nucleotide
mismatches.
A cncsframe object that contains the following.
nscensus |
an array of integers that may be accessed with the
|
wildseq |
an array of the most frequent, i.e. the identified wild-type, codon at each site of the input molecular data. |
nstype |
a string that describes whether the entries of
|
maxdiff |
maximum number of nucleotide mismatches tolerated when comparing to the wild-type. |
invariants |
indices of invariant codon sites, after ambiguities and missingness have been accommodated. |
Hassan Sadiq
The cncsframe class that contains additional informationn
about how to access the output object. The nonSynonymous
and codonDissimilarity functions may be useful resources
for clarifications about the maxdiff entry.
indata <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "TGG-AGCGACCCCTTGTCTCAATAAAAATA") codonarray <- Biostrings::BStringSet(indata) tested <- CnCs(codonarray, FALSE, 3) testedindata <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "TGG-AGCGACCCCTTGTCTCAATAAAAATA") codonarray <- Biostrings::BStringSet(indata) tested <- CnCs(codonarray, FALSE, 3) tested
Obtain homogeneous entropy estimate for a set of homologous protein sequences, based on observed synonymous or non-synonymous codon diversities.
cncsentropy(fastafile, synonym=FALSE, diffceil=1, fml="shannon", ralpha=NA)cncsentropy(fastafile, synonym=FALSE, diffceil=1, fml="shannon", ralpha=NA)
fastafile |
path to a FASTA format file that contains a protein sequence. |
synonym |
logical entry that indicates whether synonymous
[ |
diffceil |
maximum number of nucleotide mismatches that
is tolerated. Default value is |
fml |
character input that can be one of |
ralpha |
a fraction between 0 and 1 that is needed for Renyi index calculation. |
Entropy calculations are largely functions of relative counts. See the
entropyindex function for the mathematical expressions
and some useful citations. Obtaining site-specific entropy values,
where the proportions represent the relative occurrence of the
protein bases per site, is not ambiguous. With respect to obtaining
a single entropy estimate for an entire alignment in terms of
synonymous and non-synonymous relationships, the process is less
straightforward. The proportions used for the calculations were
obtained as follows.
where represents the proportion of observed
synonymous substitutions at site and
is the number of observed synonymous
substitutions with reference to the most frequently occurring codon
at the site. For example, the expression for the corresponding
synonymous Shannon entropy for a protein sequence alignment then
becomes,
Similar explanation holds for estimates obtained with respect to non-synonymous substitutions or from using the Renyi approach.
A geneindex object.
Hassan Sadiq
Shannon, C. E. (1948). A Mathematical Theory of Communication, The Bell System Technical Journal 27(3): 379-423.
For further clarification about the operation of the cncsentropy
function and extensive understanding of the interpretation of its output,
consult the constituent CnCs and entropyindex
functions. There are also the codondifferindex and
molentropy functions that are capable of generating
site-wise indices without distinguishing between synonymous or
non-synonymous codon relationships.
sqdatm <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "CCC-AGCGACCCCTTGTCTCAATAAAAATA") codonData <- Biostrings::BStringSet(sqdatm) names(codonData) <- c("s1","s2","s3") testdna <- file.path(tempdir(), "testDna.fasta") Biostrings::writeXStringSet(codonData, testdna) testing <- cncsentropy(testdna, TRUE, 2, "shannon") print(testing)sqdatm <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "CCC-AGCGACCCCTTGTCTCAATAAAAATA") codonData <- Biostrings::BStringSet(sqdatm) names(codonData) <- c("s1","s2","s3") testdna <- file.path(tempdir(), "testDna.fasta") Biostrings::writeXStringSet(codonData, testdna) testing <- cncsentropy(testdna, TRUE, 2, "shannon") print(testing)
Facilitate smooth extraction and utility of outputs from synonymous and non-synonymous count analyses of molecular protein data.
Objects of this (cncsframe) class can be created by calls of
the form new("cncsframe", nscensus, wildseq, nstype, maxdiff,
invariants).
nscensus:site-wise counts of codons that are synonymous or non-synonymous to the wild-type codon.
wildseq:sequence that comprise of the most frequent codon at each site.
nstype:indication of the type, i.e. synonymous
or non-synonymous, of counts returned.
maxdiff:maximum number of nucleotide mismatch that is tolerated.
invariants:indices of the non-informative codon sites.
signature(object="cncsframe") snapshot of
output features.
signature(cNS="cncsframe") computational
approach, 'synonymous' or 'non-synonymous'.
signature(cNS="cncsframe") site-wise
counts of codons that are (non-)synonymous to the wild-type.
signature(cNS="cncsframe") maximum
number of nucleotide mismatch tolerated per codon pair.
signature(cNS="cncsframe") a vector
of the identified wild-type codon for each site of the input
protein data.
signature(cNS="cncsframe") locations
of sites that were detected to be non-informative.
Consult the CnCs function for more elaborate descriptions
of the slots and method outputs.
Hassan Sadiq
The CnCs function that returns cncsframe objects.
testsq <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "TGG-AGCGACCCCTTGTCTCAATAAAAATA") codonarray <- Biostrings::BStringSet(testsq) tested <- CnCs(codonarray, FALSE, 3) wildtriplets(tested) nsfreqs(tested) testedtestsq <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "TGG-AGCGACCCCTTGTCTCAATAAAAATA") codonarray <- Biostrings::BStringSet(testsq) tested <- CnCs(codonarray, FALSE, 3) wildtriplets(tested) nsfreqs(tested) tested
Obtain information entropy index for each codon site in a protein sequence, as a function of mismatches observed at nucleotide positions.
codondifferindex(fastafile, diffUnit=1, fml="shannon", ralpha=NA)codondifferindex(fastafile, diffUnit=1, fml="shannon", ralpha=NA)
fastafile |
path to a FASTA format file that contains a protein sequence. |
diffUnit |
number of nucleotide mismatches between codon pairs to use for the calculations. |
fml |
character input that can be one of |
ralpha |
a fraction between 0 and 1 that is needed for Renyi index calculation. |
An object of class siteindices.
Hassan Sadiq
This function is a combination of the operations of the
codonDissimilarity and the entropyindex
functions. The two referenced functions contain further discussions
about the diffUnit, fml and ralpha inputs. See
the siteindices class for an extensive detail about
how to work with the output object. The molentropy
function is an example of an alternative approach of estimating
site-wise entropy indices accessible within the queeems
package.
proteinFile <- queeemsExtdata("VertCOI.fasta") testEG <- codondifferindex(proteinFile, 1, "shannon") summary(testEG) print(testEG)proteinFile <- queeemsExtdata("VertCOI.fasta") testEG <- codondifferindex(proteinFile, 1, "shannon") summary(testEG) print(testEG)
Generates a matrix that contains numerical details of the distribution of bases at each codon position in a protein sequence.
codonDissimilarity(bstringset, diffUnit)codonDissimilarity(bstringset, diffUnit)
bstringset |
A BStringSet object. |
diffUnit |
An integer between the 0 and 3 interval. |
The input BStringSet object can be created with the
Biostrings::readBStringSet function. diffUnit
represents the number of nucleotide mismatches that is preferred. Let
the unique codons at each genetic sequence alignment site be denoted
as i = 1, 2, ..., k, where k can not be more than the
number of sequences that make up the data. For each i at the
different sites, a value of 1 is recored if any of the other codons
at the site differ from codon i by exactly diffUnit
nucleotide positions. The process is repeated independently for each
site and the outcome is entered into the corresponding column of the
output matrix. Note the special case of diffUnit=0. The
output will be a binary matrix. Row r column c of the
matrix will contain a 0 if codon r was observed at site
c of the input protein sequence.
A 61-by-nsites dissimilarity matrix that captures the site-wise
distribution of codon bases evident from the input protein data, where
nsites is the number of codon sites. As explained as part of
Details above, codon dissimilarity is determined by specified
degree of nucleotide mismatch.
Hassan Sadiq
queeemsExtdata that returns paths to the example
external DNA data that can be processed with the described function.
Biostrings::readBStringSet, a necessary feeder function may
also be a useful resource. The baseFrequency function
implicitly uses this function.
dataPath <- queeemsExtdata("PI.fasta") bstringdata <- readBStringSet(dataPath) testing <- codonDissimilarity(bstringdata, 1) head(testing)[,seq(1,6)]dataPath <- queeemsExtdata("PI.fasta") bstringdata <- readBStringSet(dataPath) testing <- codonDissimilarity(bstringdata, 1) head(testing)[,seq(1,6)]
Generate a binary matrix that identifies pairs of sense codons that differ by a specified degree.
diffNucBinary(diffUnit=1)diffNucBinary(diffUnit=1)
diffUnit |
A non-negative integer. Defaults to 1. |
diffUnit should ideally be a non-negative value that is less than
4. The codons are matched by nucleotide bases and their positions. For
example, comapring codon `ACA` and codon `CAA` will return
TRUE only when diffUnit = 2 in accordance with the
discrepancies at the first and the second nuleotide positions. Observe
that when diffUnit = 0, a logical diagonal matrix is returned.
A 61-by-61 logical matrix. TRUE will appear at the row and column
intersection of the sense codons that differ by the number of nucleotide
bases specified by diffUnit. FALSE will appear otherwise.
Hassan Sadiq
test1 <- diffNucBinary(1) head(test1)[,seq(1,6)]test1 <- diffNucBinary(1) head(test1)[,seq(1,6)]
Obtain indices that are useful for quantifying the degree of diversity contained in observed molecular prevalence count data.
entropyindex(countvector, nleaf, fml="shannon", ralpha=0.1)entropyindex(countvector, nleaf, fml="shannon", ralpha=0.1)
countvector |
integer vector of base frequencies. |
nleaf |
number of the extant branches of the tree that generated
the data reduced to |
fml |
character input that can be one of |
ralpha |
a fraction between 0 and 1 that is needed for Renyi index calculation. |
Molecular entropy estimation requires knowledge of the size of the leaves
on the phylogeny that generated the data. This is expected to be entered
into the function as nleaf. Let denote the vector
of base frequencies countvector and let n = nleaf. If
fml is set as "shannon", the diversity index is computed as:
where m n is the length of after
all zeros have been excluded and =
. When fml is set as
"renyi", then
where = ralpha.
A numeric estimate of the entropy index obtained for the input data.
Hassan Sadiq
Renyi, A. (1961). On Measures of Information and Entropy, Proceedings of the Fourth Berkeley Symposium on Mathematics, Statistics and Probability 1960 547-561.
Shannon, C. E. (1948). A Mathematical Theory of Communication, The Bell System Technical Journal 27(3): 379-423.
Scaled multinomial likelihood estimator mnomLogl which
returns a scaled entropy. The seqSaturation relies heavily
on this function, while baseFrequency, CnCs
and codonDissimilarity are useful for transforming genetic
sequences into counts needed for the countvector input. Interested
users might consult the external vegan::diversity function
for alternative entropy estimation methods.
freqdata <- sample(seq(0,6), 20, replace=TRUE) tested <- entropyindex(freqdata, sum(freqdata)) testedfreqdata <- sample(seq(0,6), 20, replace=TRUE) tested <- entropyindex(freqdata, sum(freqdata)) tested
Generate unevenly discretised weights
fubarweights(nweights, wless1, weightmax, addzero)fubarweights(nweights, wless1, weightmax, addzero)
nweights |
number of weights. |
wless1 |
proportion of weights between the (0, 1) interval. |
weightmax |
maximum weight value. |
addzero |
logical input. |
For unevenly discretised weights that are all less than
such that of them lie within the (0, 1)
interval, the vector of weights is obtained as the following set of
values.
such that,
where
Further, equals zero if addzero = TRUE and it equals
one otherwise, is the input weightmax and is
the specified wless1.
A numeric vector of weights.
Hassan Sadiq
Murrell, B., Moola, S., Mabona, A., Weighill, T., Sheward, D., Kosakovsky Pond, S. L. and Scheffler, K. (2013) FUBAR: A Fast, Unconstrained Bayesian AppRoximation for Inferring Selection, Mol. Biol. Evol. 30(5): 1196-1205.
wVector1 <- fubarweights(20, 0.70, 50, FALSE) wVector2 <- fubarweights(20, 0.70, 50, TRUE) print(wVector1) print(wVector2)wVector1 <- fubarweights(20, 0.70, 50, FALSE) wVector2 <- fubarweights(20, 0.70, 50, TRUE) print(wVector1) print(wVector2)
Facilitates succinct handling of the global information entropy index estimated for an alignment of homologous protein sequences.
A geneindex object may be created with a call of the form
new("geneindex", eindex, noinfo, meth, alphaR, nbases, synonym).
eindex:single numeric entropy estimates obtained from genetic data.
noinfo:numeric vector that contains non-informative
positions of the molecular data that produced eindex.
meth:character entry that informs about the method
used to generate eindex from the original protein data.
alphaR:parameter for Renyi entropy calculations. Only
relevant if meth = "renyi" [default = NA].
nbases:number of base positions that make up the
protein data used to estimate eindex.
synonym:default = NA and only relevant if the
counts used to estimate eindex are with respect to
[non-]synonymous counts.
signature(object="geneindex") output highlights.
signature(sent="geneindex") value of the
alpha parameter used for Renyi entropy calculations.
signature(gent="geneindex") answers the
question: were synonymous codon counts used?.
signature(gent="geneindex") value of the
entropy estimate obtained for the genetic sequence.
signature(cNS="geneindex") positions of the
processed molecular data that are not informative.
signature(sent="geneindex") should
return the name of the method used to generate the entropy
estimate from the original molecular data.
signature(gent="geneindex") number of
base positions that constitute the analysed protein data.
The entry of the synonym slot is expected to be logical, if
specified. TRUE is set if the codon counts used to estimate
the eindex entry is with respect to synonymous counts and
should be FALSE if non-synonymous counts are used.
Hassan Sadiq
Variant of the nonvaries method is applied within
the baseSummary and the siteindices
classes.
The entropyindex function is a good reference
for discussions about the different entropy calculation
techniques accessible from the queeems package.
Functions that return outputs of the described
geneindex-class include cncsentropy.
geneFile <- queeemsExtdata("PI.fasta") testing <- cncsentropy(geneFile, FALSE, 1, "renyi", 0.04) print( nonvaries(testing)) print( class(testing)) print(testing)geneFile <- queeemsExtdata("PI.fasta") testing <- cncsentropy(geneFile, FALSE, 1, "renyi", 0.04) print( nonvaries(testing)) print( class(testing)) print(testing)
Obtain an approximate estimate of the log-likelihood for a random variable that is believed to have a multinomial distribution.
mnomLogl(countvector, pivector)mnomLogl(countvector, pivector)
countvector |
vector of non-negative observed frequencies. |
pivector |
theoretical population proportions that generated
the input |
Consider a discrere random variable
where, and . Then,
such that the log-likelihood expression may be simplified as follows.
The expression can be shown to produce a maximum likelihod estimate of
by using a Lagrange multiplier that
imposes the constraint that ..
The scaled likelihood value estimated from the final expression presented in Details. The output should be a negative value.
Hassan Sadiq
Some other information retrieval functions within the queeems
package that are straightforwardly applicable to molecular protein data.
These include, cncsentropy and
seqSaturation. Functions such as baseFrequency,
CnCs and codonDissimilarity, that are needed
to obtain the counts required to successfully execute the described
mnomLogl, from a genetic sequences may also be consulted.
arbitraryCounts <- sample(40, 20) tempPis <- runif(20) arbitraryPis <- tempPis / sum(tempPis) tests <- mnomLogl(arbitraryCounts, arbitraryPis) print(tests)arbitraryCounts <- sample(40, 20) tempPis <- runif(20) arbitraryPis <- tempPis / sum(tempPis) tests <- mnomLogl(arbitraryCounts, arbitraryPis) print(tests)
Generate information entropy estimate independently for protein sequence sites.
molentropy(fastafile, basename="dna", fml="shannon", ralpha=NA)molentropy(fastafile, basename="dna", fml="shannon", ralpha=NA)
fastafile |
path to a FASTA format file that contains a protein sequence. |
basename |
specification of how the data must be encoded. It can
be |
fml |
character input that can be one of |
ralpha |
a fraction between 0 and 1 that is needed for Renyi index calculation. |
A siteindices object.
Hassan Sadiq
For further clarification about the operation of the molentropy
function and extensive understanding of the interpretation of its output,
consult the baseFrequency and entropyindex
functions. There is also the codondifferindex function
that can be used to generate site-wise entropy indices and the
cncsentropy function that is suitable for homogeneous
entropy estimation.
sqdatm <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "CCC-AGCGACCCCTTGTCTCAATAAAAATA") moleculeDta <- Biostrings::BStringSet(sqdatm) names(moleculeDta) <- c("s1","s2","s3") testprotein <- file.path(tempdir(), "testprotein.fasta") Biostrings::writeXStringSet(moleculeDta, testprotein) test1 <- molentropy(testprotein, "dna", "renyi", .35) test2 <- molentropy(testprotein, "codon", "shannon") print(test1) print(test2)sqdatm <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "CCC-AGCGACCCCTTGTCTCAATAAAAATA") moleculeDta <- Biostrings::BStringSet(sqdatm) names(moleculeDta) <- c("s1","s2","s3") testprotein <- file.path(tempdir(), "testprotein.fasta") Biostrings::writeXStringSet(moleculeDta, testprotein) test1 <- molentropy(testprotein, "dna", "renyi", .35) test2 <- molentropy(testprotein, "codon", "shannon") print(test1) print(test2)
Obtain frequencies of sense codons as a function of the frequencies of nucleotide bases
n2cFreqs(nucFracs)n2cFreqs(nucFracs)
nucFracs |
vector of nucleotide frequencies. |
This provides a straightforward way to generate codon frequencies as
described for the popular F3x4 model. For a given vector (nucFracs
= = ) of
nucleotide frequencies, each non-standardised sense codon frequency,
for i = 1, 2, ..., 61 is obtained as the product
the product of the nucleotide triplet that form the codon. For example, for
= , the unstandardised
codon frequency is estimated as . Please note that, if
the contents of the input vector are not named, the elements are assigned
base names (A, C, G, T) in order of appearance
in the input.
A numeric vector of codon frequencies that are standardised to sum to one, ordered and named in terms of the IUPAC nucleotide triplet nomenclature.
Hassan Sadiq
Goldman, N. and Yang, Z. (1994) A Codon-Based Model of Nucleotide Substitution for Protein-Coding DNA Sequences, Mol. Biol. Evol. 11(5): 725-736.
codonFrac1 <- n2cFreqs( c(A=0.3, C=0.1, G=0.4, T=0.2) ) codonFrac2 <- n2cFreqs( c(0.3, 0.1, 0.4, 0.2) ) print(codonFrac1) print(codonFrac2)codonFrac1 <- n2cFreqs( c(A=0.3, C=0.1, G=0.4, T=0.2) ) codonFrac2 <- n2cFreqs( c(0.3, 0.1, 0.4, 0.2) ) print(codonFrac1) print(codonFrac2)
Create a 61-by-61 symmetric logical matrix that indicates the sense codons that are synonymous or non-synonymous to the corresponding row or column codon.
nonSynonymous(synonym=FALSE, diffceil=1)nonSynonymous(synonym=FALSE, diffceil=1)
synonym |
logical input that indicates whether synonymous [TRUE] or non-synonymous [FALSE (default)] identifier is required. |
diffceil |
an interger that states the preferred maximum number of nucleotide mismatch. Set to 1 by default. |
diffceil should ideally be a non-negative value that is less than
4. The codons are matched by nucleotide bases and their positions. For
example, when diffceil = 2 and synonym = FALSE, the output
matrix column associated with codon 'AAA' will contain TRUE
for all codons that are non-synonymous to 'AAA' and that differ
from 'AAA' at not more than two nucleotide positions. Codons
that do not satisfy that criterion will be assigned FALSE. The
same interpretation applies to the respective rows of the output matrix
corresponding to the other sense codons. The output matrix is symmetric,
so all the interpretations hold similarly row-wise. The rows and columns
of the output matrix are arranged and labelled alphabetically with
respect to the IUPAC nucleotide triplet naming style.
A 61-by-61 logical matrix. See Details.
Hassan Sadiq
Explanations that accompany the diffNucBinary function
might provide better operational understanding.
testing <- nonSynonymous(FALSE, 2) head(testing)[,seq(1,6)]testing <- nonSynonymous(FALSE, 2) head(testing)[,seq(1,6)]
Saturation indices are often used, in molecular evolutionary studies, to determine whether the degree of genetic variation captured in a set of genetic sequences is likely to produce reliable inferences. Existing measures are largely designed to cater for analyses about phylogeny reconstruction. As a result, a single metric is usually obtained for an alignment of homologous sequences. When saturation is detected, it is common practice to exclude sequence positions believed to significantly influence the erosion of genetic variation. The suite of functions presented here are designed to facilitate a more informed exclusion technique by providing Bayesian saturation metric for each sequence position.
Bayes factors that measure the extent to which the recorded genetic data support an alternative hypothesis of saturation is estimated for each sequence position, in terms of codon bases. This approach avails an exciting opportunity for saturation indices to find use in other molecular evolutionary topics, including analyses of natural selection. Other independently useful functions are also part of the package, these include various molecular entropy quantifying functions.
Hassan Sadiq
Kass, R. E. and Raftery, A. E. (1995). Bayes Factors, Journal of American Statistical Association 90(430): 773-795.
Renyi, A. (1961). On Measures of Information and Entropy, Proceedings of the Fourth Berkeley Symposium on Mathematics, Statistics and Probability 1960 547-561.
Shannon, C. E. (1948). A Mathematical Theory of Communication, The Bell System Technical Journal 27(3): 379-423.
Xia, X., Xie, Z., Salemi, M., Chen, L. and Wang, Y. (2003). An Index of Substitution Saturation and its Application, Molecular Phylogenetics and Evolution 26(1): 1-7.
Obtain the paths to example protein sequences that are available,
as part of, and are used in some of the examples in, the queeems
package.
queeemsExtdata(filename=NULL)queeemsExtdata(filename=NULL)
filename |
A string of the name of one of the |
The external data sets accessible with this function include the,
II.fasta, PI.fasta and RTI.fasta DNA files as
well as their amino acid translates. That is, II_AA.fasta,
PI_AA.fasta and RTI_AA.fasta. The FASTA format
files all contain empirical HIV-1 protein sequences that were retrieved
from Murrell et al. (2012). Other files accessible from the folder
include the VertCOI.fasta: mitochondrial COI sequences from
eight vertebrates (Xia, 2018) and InvertebrateEF1a.fasta:
elongation factor-1a sequences from chelicerate, myriapod,
branchipod, hexapod, molluscan, annelid and malacostracan species. The
filename input may be specified as any of the listed filnames or
left as the default NULL value.
The reverse transcriptase isolates [RTI.fasta] contain 205 codon
sites and 476 sequences. Following Murrell et al. (2012), this corresponds
to a subset [codon sites 41 to 245] of the original (Rhee et al, 2003,
de Oliveira et al,, 2010) data. The protease isolate [PI.fasta]
file contains 99 codon sites and 122 protein sequences. The integrase
isolates [II.fasta] comprise 295 sequences and 288 codon sites.
All the cited HIV-1 data sets contain pre- and post-treatment sequences.
A string that corresponds to the full path of the data saved with the
specified filename input. If filename is left as its default
NULL value, a list of all the names of all the sequence files that
are included with the queeems package are listed.
Hassan Sadiq
Rhee, S.-Y., Gonzales, M. J., Kantor, R., et al. (2003). Human Immunodeficiency Virus Reverse Transcriptase and Protease Sequence Database, Nucleic Acids Research 31(1):298-303.
de Oliveira, T., Shafer, R. W., Seebregts, C., et al. (2010). Public Database for HIV Drug Resistance in Southern Africa, Nature 464(7289):673.
Murrell, B., de Oliveira, T., Seebregts, C., et al. (2012). Modeling HIV-1 Drug Resistance as Episodic Directional Selection, PLoS Computational Biology 8(5):e1002507.
Xia, X. (2018). DAMBE7: New and Improved Tools for Data Analysis in Molecular Biology and Evolution, Molecular Biology and Evolution 35(6):1550-1552.
See applications of this function as part of bstringCodons.
test0 <- queeemsExtdata() print(test0) test1 <- queeemsExtdata("II.fasta") print(test1)test0 <- queeemsExtdata() print(test0) test1 <- queeemsExtdata("II.fasta") print(test1)
Allow for neat and efficient handling of outputs from Bayesian site-wise substitution saturation analyses.
Creating saturateBF objects may be achieved with calls stated as
follows: new("saturateBF", bf.pv, nuLL, altLL, noInfo, nsites).
bf.pv:numeric vector of the Bayes factors estimated independently for each molecular data site.
nuLL:log-likelihood recorded for each data site based on the null parameters of the corresponding saturation analyses.
altLL:estimates of the log-likelihood obtained for each data site, using the parameters of the alternative hypothesis.
noInfo:site indices of the analysed protein data sites that are observed to be invariant.
nsites:number of base sites that make up the original molecular data.
bfcutoff:Bayes factor threshold for determining significance.
sspi:tolerated proportion of saturated sites to use for overall hypotheses statements.
signature(object="saturateBF") self-explanatory
output highlights.
signature(object="saturateBF") interesting
Bayesian-informed saturation statistics in properly labelled
data frame.
signature(cNS="saturateBF") vector that
contains indices of the sites in the analysed protein data that
were invariant.
signature(gent="saturateBF") number of base
locations that makeup the molecular data used for the saturation
analyses.
signature(satube="saturateBF") Bayes factor
estimates obtained for each data site.
signature(satube="saturateBF") estimates of the
log-likelihood computed using the parameters of the null
hypothesis, for each base site separately.
signature(satube="saturateBF") log-likelihood
estimates for each data site as obtained from application of the
parameters of the alternative hypothesis.
signature(satube="saturateBF") a positive
fraction that specifies the value to use when conducting
hypotheses tests for overall saturation.
signature(satube="saturateBF") Bayes
factor threshold value that determines when to infer saturation.
Hassan Sadiq
The seqSaturation function
that produces objects of this class.
geneFile <- queeemsExtdata("II.fasta") examine <- seqSaturation(geneFile, "A", 5, 0.4, 5) examinegeneFile <- queeemsExtdata("II.fasta") examine <- seqSaturation(geneFile, "A", 5, 0.4, 5) examine
Extract targetted base sites from molecular sequence data.
seqfilter(fastafile, deadsites, basename="dna", write=FALSE)seqfilter(fastafile, deadsites, basename="dna", write=FALSE)
fastafile |
full path to the file that contains the sequence that needs to be subsetted. |
deadsites |
integer indices of the base locations that should be
removed from the sequence in |
basename |
one of |
write |
optional full path to a file where the output sequence should be saved. |
If entered, write should be the full path to the file where the
data is expected to be saved. The input is not always interpreted as
logical. If write = FALSE is entered (default), no file will be
saved. However, write = TRUE will save the edited sequence output
in a file named `TRUE` in the working directory.
The extracted molecular sequence data as a Biostrings::BStringSet
object. If write is specified, the edited sequence is also saved
in the filepath stated.
Hassan Sadiq
egdata <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "TGG-AGCGACCCCTTGTCTCAATAAAAATA") dnaseqs <- Biostrings::DNAStringSet(egdata) names(dnaseqs) <- paste("seq", seq(1,3), sep="") egpath <- file.path(tempdir(), "egdata.fas") Biostrings::writeXStringSet(dnaseqs, egpath) cleanseqs <- seqfilter(egpath, c(4,6,8), "dna") print(cleanseqs)egdata <- c("CCTCAGATCACTCTTTGGCAACGACCCCTT", "CCTCAGATCACTCTTGTCTCAATAAAAGTA", "TGG-AGCGACCCCTTGTCTCAATAAAAATA") dnaseqs <- Biostrings::DNAStringSet(egdata) names(dnaseqs) <- paste("seq", seq(1,3), sep="") egpath <- file.path(tempdir(), "egdata.fas") Biostrings::writeXStringSet(dnaseqs, egpath) cleanseqs <- seqfilter(egpath, c(4,6,8), "dna") print(cleanseqs)
Assess the degree of evolutionary saturation in molecular sequences.
seqSaturation(fastafile, approach="A", wsize=6, wless1=0.40, weightmax=7, bfcutoff=3, sspi=0.01)seqSaturation(fastafile, approach="A", wsize=6, wless1=0.40, weightmax=7, bfcutoff=3, sspi=0.01)
fastafile |
a character input of the full path to a |
approach |
one of ' |
wsize |
number of |
wless1 |
fraction of |
weightmax |
maximum |
bfcutoff |
Bayes factor cutoff (default = 3). |
sspi |
tolerated proportion of saturated sites, overall. |
At least, three molecular saturation verification techniques are planned
to be incorporated into the package. However, only one is currently
accessible through the seqSaturation function. The logic behind
the technique is presented below.
Technique 1 (approach = "A"):
Codons are combinations of nucleotide bases. Codons are therefore more appealing for rigorous evolutionary analyses, including the popular investigation of natural selection as a ratio of non-synonymous to synonymous codon substitution rates. In addition, due to the smaller set of nucleotide bases (= 4) compared to codon bases (= 64), the former are expected to lose evolutionary information faster. The substitution saturation test built upon this reasoning reduces to the following hypotheses statements.
Null hypothesis (H0): Evolutionary information
contained in codon data is significantly more than the
information retrievable from associated nucleotide data. That
is, sequence is not saturated. (Bayes
Factor ).
Alternative hypothesis (H1): Evolutionary
information retrievable in the codon data is significantly
eroded or insufficient for evolutionary analyses, such that
nucleotide models reveal more about the data. That is,
sequence is saturated. (Bayes Factor
).
is the input bfcutoff. To
verify these hypotheses, it is assumed that the number of codon
and nucleotide bases observed at each of the corresponding
positions of genetic data follows a multinomial distribution.
Bayes factors are then estimated independently for each codon
site, i = (1, 2, ..., n), as the ratio of maximum
posterior log-likelihoods as follows.
where,
= data at codon position i,
=
theoretical proportions of sense codons at site i,
= nucleotide data in position
k = (1, 2, 3) at codon site i,
= theoretical
proportions of nucleotide bases at position k of
codon site i,
= number of sense codon m observed
at codon i,
= number of nucleotide base j
recorded at position k of codon site i.
Values of that the likelihoods are maximised
over for each site are pre-determined based on a technique adopted
from FUBAR. Weights of size w = nweights within
the (0, weightmax) interval are first generated such that
wless1 fraction of the weights are less than one. For more
details about the weight generation process, see
fubarweights. All possible, ,
four-weight combinations without repetitions are then sampled and
converted to z vectors of nucleotide frequencies
using the
softmax transformation. The codon frequencies
considered at
each site are obtained as the product of the frequencies of the
associated nucleotide triplets as it is conventionally implemented
in the F3x4 substitution models.
The log-likelihood expressions are similar to the popular Shannon
information entropy expression. The similarity justifies why it
is not inappropriate to have constructed the hypotheses statements
in terms of the information that can be retrieved. Note that the
log-lilihood estimates will always be negative for both the
numerator and denominator of the Bayes factor formula, because
the x, y counts are strictly non-negative and the
theoretical proportions () are always fractions.
Consequently, to avoid spurious outcomes, the log-likelihood
estimates were transformed into approximate posterior
probabilities using the softmax identity before
maximising.
A single Bayes factor is also estimated to assess the overall
extent of saturation of the genetic sequence data (Y). Separate
hypotheses statements about the true proportion of saturated
sites (), were necessary for this purpose. These
hypotheses may be expressed as follows.
where is the parameter of the Binomial(n,
) distribution, n = the number of codon sites and
is the input sspi (default 0.10).
Similar to the approach taken for the site-wise inferences,
potential values are obtained using the
FUBAR discretisation method. A Bayes factor is then estimated
as the ratio of the maximum posterior probabilities as follows.
Technique 2 (approach = "B") (in progress):
A significant number of existing codon models of evolution tolerate only one nucleotide mismatch between codon pairs. The assumption is that not enough time has passed for more than a single substitution event to have occurred. The following hypotheses statements are plausible consequence of this widely adopted assumption.
Null hypothesis (H0): The frequencies
of the codon bases that make up the genetic data are better
described by a model that supports only a single nucleotide
mismatch between codon pairs. That is, sequence is not
saturated. (Bayes
Factor ).
Alternative hypothesis (H1): Observed base
frequencies distribution is better supported by a model that
permits both two and three nucleotide mismatches per codon
pair. That is, sequence is saturated
(Bayes Factor
).
Technique 3 (approach = "C") (in progress):
This should extend Technique 2 by allowing for the
hypotheses to be nested such that Chi-Square likelihood ratio test
becomes applicable with the following updated hypothesis
statements.
Null hypothesis (H0): Considering only one
nucleotide mismatch per codon pair captures majority of the
evidence of evolution that has accrued in the genetic data.
That is, sequence is not saturated.
Alternative hypothesis (H1): Including
information about one, two and three nucleotide mismatches
per codon pair captures significantly more evolutionary
evidence from the genetic data. That is, sequence is
saturated.
The output object returned is determined by the analyses technique.
Additional techniques should be incorporated soon. Bayesian outputs
from Technique 1 is returned as a saturateBF object.
The object contains details of the site-wise likelihood estimates and
other useful characteristic information. The respective object help
file may be consulted for further details.
Hassan Sadiq
Benjamini, Y. and Hochberg, Y. (1995). Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing, Journal of the Royal Statistical Society: Series B. 57(1): 289-300.
Efron, B. and Hastie, T. (2016). Computer Age Statistical Inference. Algorithms, Evidence and Data Science. Cambridge, UK: Cambridge University Press.
Goldman, N. and Yang, Z. (1994) A Codon-Based Model of Nucleotide Substitution for Protein-Coding DNA Sequences, Molecular Biology and Evolution 11(5): 725-736.
Kass, R. E. and Raftery, A. E. (1995) Bayes Factors, Journal of the American Statistical Association 90(430): 773-795.
Murrell, B., Moola, S., Mabona, A., Weighill, T., Sheward, D., Kosakovsky Pond, S. L. and Scheffler, K. (2013) FUBAR: A Fast, Unconstrained Bayesian AppRoximation for Inferring Selection, Molecular Biology and Evolution 30(5): 1196-1205.
Renyi, A. (1961). On Measures of Information and Entropy, Proceedings of the Fourth Berkeley Symposium on Mathematics, Statistics and Probability 1960 547-561.
Shannon, C. E. (1948). A Mathematical Theory of Communication, The Bell System Technical Journal 27(3): 379-423.
Xia, X., Xie, Z., Salemi, M., Chen, L. and Wang, Y. (2003). An Index of Substitution Saturation and its Application, Molecular Phylogenetics and Evolution 26(1): 1-7.
Molecular entropy estimation functions:
Multinomial likelihood generating function:
Functions useful for transforming molecular data into the
x, y counts used in the equations above:
Weight generating function.
Function that converts nucleotide to codon frequencies.
Softmax identity function.
proteinFile <- queeemsExtdata("VertCOI.fasta") testEG <- seqSaturation(proteinFile, "A", 5, 0.4, 5) summary(testEG) testEGproteinFile <- queeemsExtdata("VertCOI.fasta") testEG <- seqSaturation(proteinFile, "A", 5, 0.4, 5) summary(testEG) testEG
Allow for neat and efficient handling of information entropy indices outputs generated site-wise from molecular data.
To create a siteindices object require executing a call of the
form new("siteindices", eindices, noinfo, meth, alphaR).
eindices:vector of site-wise entropy estimates.
noinfo:numeric vector that contains positions of
the molecular data that produced eindices which were
non-informative.
meth:character entry that informs about the method
used to generate eindices from the original protein data.
alphaR:parameter for Renyi entropy calculations. Only
relevant if meth = "renyi".
signature(object="siteindices") output highlights.
signature(object="siteindices") interesting
output statistics.
signature(cNS="siteindices") positions of the
processed molecular data that are not informative.
signature(sent="siteindices") value of the
alpha parameter used for Renyi entropy calculations.
signature(sent="siteindices") should
return the name of the method used to generate the entropy
estimates from the original molecular data.
signature(sent="siteindices") values of
entropy estimates obtained for each site of a genetic sequence.
An approximate 95% confidence interval estimated using the
Bienayme-Tchebcshef inequality is returned as part of the outputs
of the siteindices class. The expression for the said confidence
interval calculation is as follows.
where and are the average and the standard
deviation of the entropy estimates supplied as the input for
the eindices slot. The parameter .
Hassan Sadiq
Feller, W. (1968). An Introduction to Probability Theory and its Applications: Vol. 1, Wiley New York.
Variant of the nonvaries method as applied within
the baseSummary and the geneindex
classes.
The entropyindex function is a good reference
for discussions about the different entropy calculation
techniques accessible from the queeems package.
Functions that return outputs of the described
siteindices-class include codondifferindex
and molentropy.
proteinFile <- queeemsExtdata("VertCOI.fasta") testEG <- codondifferindex(proteinFile, 1, "shannon") sitentropies(testEG)[seq(1,10)] nonvaries(testEG)[seq(1,10)] summary(testEG) testEGproteinFile <- queeemsExtdata("VertCOI.fasta") testEG <- codondifferindex(proteinFile, 1, "shannon") sitentropies(testEG)[seq(1,10)] nonvaries(testEG)[seq(1,10)] summary(testEG) testEG
Transform weights to frequencies using the softmax identity
softmax(weights, maxadj)softmax(weights, maxadj)
weights |
vector of weights. |
maxadj |
logical indicator of whether weights need adjustment. |
The softmax identity is popular in machine learning applications. It is
useful for transforming a vector of weights into frequencies. A modified
version that minimises the chances of overflow is applied here. For a
given vector ( = weights) that contains real number
weights, the ith frequency (where, i = 1, 2, ..., k) is
obtained as follows.
where is set equal to zero if maxadj = FALSE. If
maxadj = TRUE then, .
A numeric vector of frequencies that sum to one.
Hassan Sadiq
Efron, B. and Hastie, T. (2016). Computer Age Statistical Inference. Algorithms, Evidence and Data Science. Cambridge, UK: Cambridge University Press.
wData <- sample(seq(1,6), 20, replace=TRUE) test1 <- softmax(wData, FALSE) test2 <- softmax(wData, TRUE) print(test1) print(test2)wData <- sample(seq(1,6), 20, replace=TRUE) test1 <- softmax(wData, FALSE) test2 <- softmax(wData, TRUE) print(test1) print(test2)