| Title: | BeadArray Specific Methods for Illumina Methylation and Expression Microarrays |
|---|---|
| Description: | The lumi package provides an integrated solution for the Illumina microarray data analysis. It includes functions of Illumina BeadStudio (GenomeStudio) data input, quality control, BeadArray-specific variance stabilization, normalization and gene annotation at the probe level. It also includes the functions of processing Illumina methylation microarrays, especially Illumina Infinium methylation microarrays. |
| Authors: | Pan Du, Richard Bourgon, Gang Feng, Simon Lin |
| Maintainer: | Lei Huang <[email protected]> |
| License: | LGPL (>= 2) |
| Version: | 2.65.0 |
| Built: | 2026-05-30 09:47:50 UTC |
| Source: | https://github.com/bioc/lumi |
lumi R package is designed to preprocess the Illumina microarray (BeadArray) data. It includes functions of Illumina data input, quality control, variance stabilization, normalization and gene annotation.
| Package: | lumi |
| Type: | Package |
| Version: | 1.1.0 |
| Date: | 2007-03-23 |
| License: | LGPL version 2 or newer |
Pan Du, Simon Lin Maintainer: Pan Du <[email protected]>
1. Du, P., Kibbe, W.A. and Lin, S.M., (2008) 'lumi: a pipeline for processing Illumina microarray', Bioinformatics 24(13):1547-1548
2. Lin, S.M., Du, P., Kibbe, W.A., (2008) 'Model-based Variance-stabilizing Transformation for Illumina Microarray Data', Nucleic Acids Res. 36, e11
3. Du, P., Kibbe, W.A. and Lin, S.M., (2007) 'nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays', Biology Direct, 2, 16
Add probe color channel and basic annotation information based on the annotation library of Illumina methylation microarray
addAnnotationInfo(methyLumiM, lib = 'FDb.InfiniumMethylation.hg19', annotationColumn=c('COLOR_CHANNEL', 'CHROMOSOME', 'POSITION'))addAnnotationInfo(methyLumiM, lib = 'FDb.InfiniumMethylation.hg19', annotationColumn=c('COLOR_CHANNEL', 'CHROMOSOME', 'POSITION'))
methyLumiM |
a MethyLumiM object includes Illumina Infinium methylation data |
lib |
Annotation library of Illumina methylation microarray. |
annotationColumn |
only include 'COLOR_CHANNEL', 'CHROMOSOME' and 'POSITION' information |
The "lib" parameter supports both FeatureDb based annotation libraries and old array-based annotation libraries. 'FDb.InfiniumMethylation.hg19' is the FeatureDb based annotation library, which includes both 450k and 27k data. "IlluminaHumanMethylation27k.db" (for 27k array) and "IlluminaHumanMethylation450k.db" (450k infinium array) are old types of annotation libraries.
return the MethyLumiM object with COLOR_CHANNEL, CHROMOSOME and chromome POSITION information added to the featureData.
Pan DU
data(example.lumiMethy) head(pData(featureData(example.lumiMethy))) ## removing color channel information # testData = example.lumiMethy # pData(featureData(testData))$COLOR_CHANNEL = NULL # testData = addAnnotationInfo(testData, lib="IlluminaHumanMethylation27k.db") ## check whether the color channel information is added # head(pData(featureData(testData)))data(example.lumiMethy) head(pData(featureData(example.lumiMethy))) ## removing color channel information # testData = example.lumiMethy # pData(featureData(testData))$COLOR_CHANNEL = NULL # testData = addAnnotationInfo(testData, lib="IlluminaHumanMethylation27k.db") ## check whether the color channel information is added # head(pData(featureData(testData)))
Add the control probe profile data, outputted by BeadStudio, into the controlData slot of LumiBatch object.
addControlData2lumi(controlData, x.lumi)addControlData2lumi(controlData, x.lumi)
controlData |
the control data can be a data.frame or the control probe filename outputted by BeadStudio |
x.lumi |
a LumiBatch object, to which controlData will be added. |
The controlData slot in LumiBatch object is a data.frame with first two columns as "controlType" and "ProbeID". The rest columns are the expression amplitudes for individual samples.
Return the LumiBatch object with controlData slot filled.
Pan Du
getControlData, plotControlData
## Not runnable # controlFile <- 'Control_Probe_Profile.txt' # x.lumi <- addControlData2lumi(controlFile, x.lumi)## Not runnable # controlFile <- 'Control_Probe_Profile.txt' # x.lumi <- addControlData2lumi(controlFile, x.lumi)
Add methylation control data to a MethyLumiM object
addControlData2methyLumiM(controlData, methyLumiM, checkConsistency = TRUE, ...)addControlData2methyLumiM(controlData, methyLumiM, checkConsistency = TRUE, ...)
controlData |
a methylation control data file (output by GenomeStudio), or a MethyLumiQC object |
methyLumiM |
a MethyLumiM object to add control data |
checkConsistency |
whether to check the sample names consistency between methyLumiM and controlData |
... |
other parameters for reading controlData |
This function aims to add the controlData (MethyLumiQC object) to the controlData slot of a methyLumiM object For control data, methylated data matrix in assayData slot corresponds to green channel, and unmethylated data matrix in assayData slot corresponds to red channel.
Return the methyLumiM object with the controlData added
Pan DU
Replace the Illumina Id (Target ID or Probe Id) as nuID (nucleotide universal identifier) for indexing genes in the LumiBatch object
addNuID2lumi(x.lumi, annotationFile=NULL, sep = NULL, lib.mapping = NULL, annotationColName = c(sequence = "Probe_Sequence", target = "ILMN_Gene", probe='Probe_Id'), verbose = TRUE)addNuID2lumi(x.lumi, annotationFile=NULL, sep = NULL, lib.mapping = NULL, annotationColName = c(sequence = "Probe_Sequence", target = "ILMN_Gene", probe='Probe_Id'), verbose = TRUE)
x.lumi |
a LumiBatch object |
annotationFile |
a annotation file, which includes the Illumina ID (target or probe ids) and probe sequence information |
sep |
the separation used in the annotation file. Automatically detect the separator if it is "," or "\t". |
lib.mapping |
a Illumina ID mapping package, e.g, lumiHumanIDMapping |
annotationColName |
the annotation column name in the annotation file used for the probe sequence and TargetID and ProbeID |
verbose |
a boolean to decide whether to print out some messages |
Since the default Illumina IDs (TargetID (ILMN\_Gene ID) and ProbeId (Probe\_Id)) are not consistent between different arrays and batches, we invented a nuID, which is one-to-one matching with the probe sequence. This function is to replace the Illumina ID with the nuID. If the annotation library (the unzipped manifest file (.bgx)) is provided, the function will automatically check whether the Illumina ID is provided for the microarray data. We recommend output the data using ProbeID when using Illumina BeadStudio software, because the TargetID (ILMN\_Gene ID) are not unique.
a LumiBatch object with Illumina ID replaced by nuID.
Pan Du
Du, P., Kibbe, W.A., Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", submitted.
## load example data # data(example.lumi) ## specify the annotation file for the Illumina chip # annotationFile <- 'Human_RefSeq-8.csv' ## Replace the Target ID with nuID # lumi.nuID <- addNuID2lumi(example.lumi, annotationFile) ## An alternative way is to load the Annotation library and match the targetID (or Probe Id) with nuID # lumi.nuId <- addNuID2lumi(example.lumi, lib.mapping='lumiHumanIDMapping')## load example data # data(example.lumi) ## specify the annotation file for the Illumina chip # annotationFile <- 'Human_RefSeq-8.csv' ## Replace the Target ID with nuID # lumi.nuID <- addNuID2lumi(example.lumi, annotationFile) ## An alternative way is to load the Annotation library and match the targetID (or Probe Id) with nuID # lumi.nuId <- addNuID2lumi(example.lumi, lib.mapping='lumiHumanIDMapping')
Color bias adjustment of Illumina Infinium methylaton microarrays using smooth quantile normalization smoothQuantileNormalization
adjColorBias.quantile(methyLumiM, refChannel = c("green", "red"), logMode = TRUE, verbose = TRUE,...)adjColorBias.quantile(methyLumiM, refChannel = c("green", "red"), logMode = TRUE, verbose = TRUE,...)
methyLumiM |
a MethyLumiM object or any eSet object with "methylated" and "unmethylated" data matrix element in the assayData slot |
refChannel |
the reference color channel for color bias adjustment |
logMode |
whether perform the adjustment in log scale or not |
verbose |
whether print extra information during processing |
... |
other parameters used by |
Perform color bias adjustment of Illumina Infinium methylaton microarrays. It requires the input methyLumiM object includes the color channel information in the featureData. Basically, there should be a "COLOR_CHANNEL" column in the data.frame returned by pData(featureData(methyLumiM)).
The basic idea of color bias adjustment is to treat it as the normalization between two color channels. It uses smooth quantile normalization smoothQuantileNormalization to normalize two color channels.
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after color bias adjustment.
Pan DU
See Also lumiMethyC, smoothQuantileNormalization and adjColorBias.ssn
data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy) lumiMethy.adj = adjColorBias.quantile(example.lumiMethy) # after adjustment plotColorBias1D(lumiMethy.adj)data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy) lumiMethy.adj = adjColorBias.quantile(example.lumiMethy) # after adjustment plotColorBias1D(lumiMethy.adj)
Color bias adjustment of Illumina Infinium methylaton microarrays using simple shift and scaling normalization
adjColorBias.ssn(methyLumiM, refChannel = c("green", "red", "mean"))adjColorBias.ssn(methyLumiM, refChannel = c("green", "red", "mean"))
methyLumiM |
a MethyLumiM object or any eSet object with "methylated" and "unmethylated" data matrix element in the assayData slot |
refChannel |
the reference color channel for color bias adjustment |
Perform color bias adjustment of Illumina Infinium methylaton microarrays. It requires the input methyLumiM object includes the color channel information in the featureData. Basically, there should be a "COLOR_CHANNEL" column in the data.frame returned by pData(featureData(methyLumiM)).
The basic idea of color bias adjustment is to treat it as the normalization between two color channels. It uses simple scaling normalization to normalize two color channels. The background levels are estimated using function estimateMethylationBG.
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after color bias adjustment.
Pan DU
See Also lumiMethyC, estimateMethylationBG and adjColorBias.quantile
data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy) lumiMethy.adj = adjColorBias.ssn(example.lumiMethy) # after adjustment plotColorBias1D(lumiMethy.adj)data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy) lumiMethy.adj = adjColorBias.ssn(example.lumiMethy) # after adjustment plotColorBias1D(lumiMethy.adj)
convert the data matrix in the assayData of a ExpressionSet as BigMatrix
## S4 method for signature 'ExpressionSet' asBigMatrix(object, rowInd=NULL, colInd=NULL, nCol=NULL, dimNames=NULL, saveDir='.', savePrefix=NULL, ...)## S4 method for signature 'ExpressionSet' asBigMatrix(object, rowInd=NULL, colInd=NULL, nCol=NULL, dimNames=NULL, saveDir='.', savePrefix=NULL, ...)
object |
an object of |
rowInd |
the subset of row index |
colInd |
the subset of column index |
nCol |
the number of columns of the data, which can be larger than the real data dimension. It is designed for adding future data. |
dimNames |
the dimension names, which is a list of two character vectors (rownames and colnames) |
saveDir |
the parent directory to save the BigMatrix data files |
savePrefix |
the folder name prefix of the directory to save the BigMatrix data files. The fold name will be like this: paste(savePrefix, '_bigmat', sep=”) |
... |
optional arguments to |
This function does not work in Windows because the dependent package bigmemoryExtras does not support it. In order to make lumi package still compilation under Windows, I deliberately remove the dependency of bigmemoryExtras package. As a result, users need to manually load the bigmemoryExtras function before using this function.
The BigMatrix data files will be save in the directory file.path(saveDir, paste(savePrefix, '_bigmat', sep=”))
Convert methylation Beta-value to M-value through a logistic transformation
beta2m(beta)beta2m(beta)
beta |
a matrix or vector of methylation Beta-value |
Convert methylation Beta-value to M-value through a logistic transformation
return methylation M-value with the same size of input Beta-value
Pan Du
Du, P., Zhang, X, Huang, C.C., Jafari, N., Kibbe, W.A., Hou, L., and Lin, S.M., (2010) 'Comparison of Beta-value and M-value methods for quantifying methylation levels by microarray analysis', (under review)
See Also as m2beta
The method adjusts the data by subtracting an offset, which is estimated based on the quantile of the control probes
bgAdjust(lumiBatch, probs = 0.5, ...)bgAdjust(lumiBatch, probs = 0.5, ...)
lumiBatch |
A LumiBatch object with controlData slot include control probe information |
probs |
The quantile used to estimate the background |
... |
other parameters used by |
The method adjusts the data by subtracting an offset, which is estimated based on the quantile of the control probes. The control probe information is kept in the controlData slot of the LumiBatch object. If no control data information, the method will do nothing.
It returns a LumiBatch object with background adjusted.
Pan Du
data(example.lumi) ## Here will assume the minimum of the control probe as the background, ## because there is no negative control (blank beads) information for the Barnes data. example.lumi.b <- bgAdjust(example.lumi, probs=0)data(example.lumi) ## Here will assume the minimum of the control probe as the background, ## because there is no negative control (blank beads) information for the Barnes data. example.lumi.b <- bgAdjust(example.lumi, probs=0)
Estimate and adjust the background levels of Illumina Infinium methylaton microarrays
bgAdjustMethylation(methyLumiM, separateColor = FALSE, targetBGLevel = 300, negPercTh = 0.25)bgAdjustMethylation(methyLumiM, separateColor = FALSE, targetBGLevel = 300, negPercTh = 0.25)
methyLumiM |
a MethyLumiM object or any eSet object with "methylated" and "unmethylated" data matrix element in the assayData slot |
separateColor |
determine whether separately process two color channels |
targetBGLevel |
adjust background level to a non-zero target background level |
negPercTh |
the threshold of the percentage of negative values after subtract estimated background levels. A warning will be given if too many probes having intensities lower than background levels. |
The estimation of background level of Infinium methylaton microarray is based on the assumption that the lots of CpG sites are unmethylated, which results in a density mode of the intensities measured by methylated probes. The position of this mode represents the background level.
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after background level adjustment. The estimated background level was kept in the attribute, "EstimatedBG", of the returned methyLumiM object.
Pan DU
See Also lumiMethyB and estimateMethylationBG
data(example.lumiMethy) lumiMethy.bgAdj = bgAdjustMethylation(example.lumiMethy) attr(lumiMethy.bgAdj, "EstimatedBG")data(example.lumiMethy) lumiMethy.bgAdj = bgAdjustMethylation(example.lumiMethy) attr(lumiMethy.bgAdj, "EstimatedBG")
Creating boxplot of sample intensities in a ExpressionSet object
## S4 method for signature 'ExpressionSet' boxplot(x, range = 0, main, logMode = TRUE, subset = NULL, xlab = "", ylab = "Amplitude", ...)## S4 method for signature 'ExpressionSet' boxplot(x, range = 0, main, logMode = TRUE, subset = NULL, xlab = "", ylab = "Amplitude", ...)
x |
a |
range |
parameter of |
main |
title of the boxplot |
logMode |
whether plot the data in log2 scale or not |
subset |
subset of rows used to plot. It can be an index vector, or the length of a random subset |
xlab |
xlab of the plot |
ylab |
ylab of the plot |
... |
optional arguments to |
The boxplot function has a "subset" parameter. By default, it is set as 5000, i.e., randomly selected 5000 probes to plot the boxplot. The purpose of this is to plot the picture faster, but it will also make the boxplot has slightly different each time. If the user wants to make sure the boxplot is the same each time, you can set the "subset" parameter as NULL.
LumiBatch-class, boxplot and boxplot,MethyLumiM-method
## load example data data(example.lumi) boxplot(example.lumi)## load example data data(example.lumi) boxplot(example.lumi)
Creating a hdr.boxplot of the M-value in a MethyLumiM object
## S4 method for signature 'MethyLumiM' boxplot(x, main, logMode = TRUE, ...)## S4 method for signature 'MethyLumiM' boxplot(x, main, logMode = TRUE, ...)
x |
a |
main |
title of the boxplot |
logMode |
only works when the dataType of x is "Intensity" |
... |
optional arguments to |
Because the density plot of M-values usually includes two modes, using the traditional boxplot cannot accurately represent the distribution of the data. Here we use violin plot to show the density of M-values by samples
MethyLumiM-class, panel.violin and boxplot,ExpressionSet-method
## load example data data(example.lumiMethy) boxplot(example.lumiMethy)## load example data data(example.lumiMethy) boxplot(example.lumiMethy)
Plot the Illumina Infinium methylation color bias in terms of boxplot. boxplot of red and green color channel will be plotted side by side
boxplotColorBias(methyLumiM, logMode = TRUE, channel = c("both", "unmethy", "methy", "sum"), grid = TRUE, main = NULL, mar = NULL, verbose = F, subset = NULL, ...)boxplotColorBias(methyLumiM, logMode = TRUE, channel = c("both", "unmethy", "methy", "sum"), grid = TRUE, main = NULL, mar = NULL, verbose = F, subset = NULL, ...)
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
logMode |
whether plot the intensities in log-scale |
channel |
estimate the intensity in different methods |
grid |
whether to add grid on the plot |
main |
title of the plot |
mar |
margin of the plot |
verbose |
whether print verbose information during plot |
subset |
plot subset of randomly selected rows. All data will be plotted if it is NULL. |
... |
other parameters of |
Plot the Illumina Infinium methylation color bias in terms of boxplot. boxplot of red and green color channel will be plotted side by side
Invisibly return TRUE if plot successfully.
Pan DU
See Also as boxplot and plotColorBias1D
data(example.lumiMethy) boxplotColorBias(example.lumiMethy)data(example.lumiMethy) boxplotColorBias(example.lumiMethy)
A summary of colorBias information, which is a data.frame summarizing the intensities of individual samples
colorBiasSummary(methyLumiM, logMode = TRUE, channel = c("both", "unmethy", "methy", "sum"))colorBiasSummary(methyLumiM, logMode = TRUE, channel = c("both", "unmethy", "methy", "sum"))
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
logMode |
Whether plot the intensities in log-scale |
channel |
estimate the intensity in different methods |
A summary of colorBias information. There are four options using "channel" parameter to plot the density plot. "both": estimate the density by pooling together methylated and unmethylated probe intensities. "unmethy" and "methy": plot either unmethylated or methylated probe density. "sum" plot the density of the sum of methylatled and unmethylated probe intensitys.
A data.frame summarizing the intensities of individual samples
Pan DU
Creating density plot of sample intensities in a ExpressionSet object. It is equivalent to hist-methods.
## S4 method for signature 'ExpressionSet' density(x, logMode=TRUE, xlab = NULL, ylab = "density", type = "l", col=1:dim(x)[2], lty=1:dim(x)[2], lwd=1, xlim = NULL, index.highlight = NULL, color.highlight = 2, symmetry = NULL, addLegend = TRUE, legendPos="topright", subset = NULL, main="", ...)## S4 method for signature 'ExpressionSet' density(x, logMode=TRUE, xlab = NULL, ylab = "density", type = "l", col=1:dim(x)[2], lty=1:dim(x)[2], lwd=1, xlim = NULL, index.highlight = NULL, color.highlight = 2, symmetry = NULL, addLegend = TRUE, legendPos="topright", subset = NULL, main="", ...)
x |
a |
logMode |
determine whether the density plot is based on a log2 scale |
xlab |
xlab of the density plot |
ylab |
ylab of the density plot |
type |
parameter of plot function |
col |
line colors of the density plot |
lty |
line types of the density plot |
lwd |
line width of plot function |
xlim |
parameter of the plot function |
index.highlight |
the column index of the highlighted density curve |
color.highlight |
color of highlighted density curve |
symmetry |
the boundary position suppose to be symmetric distributed |
addLegend |
whether add legend to the plot or not |
legendPos |
the legend position. It can be a string specifying the position, or a length two vector specifying the x and y position. Please check |
subset |
subset of rows used to plot. It can be an index vector, or the length of a random subset |
main |
title for the plot |
... |
additional parameters for |
LumiBatch-class, hist-methods, density
## load example data data(example.lumi) density(example.lumi)## load example data data(example.lumi) density(example.lumi)
Estimate the detectable probe ratio of each probe, sample or just return an AP matrix
detectionCall(x.lumi, Th = 0.01, type = c('probe', 'sample', 'matrix'))detectionCall(x.lumi, Th = 0.01, type = c('probe', 'sample', 'matrix'))
x.lumi |
a LumiBatch or MethyLumiM object |
Th |
the threshold. By default, when the detection p-value is less than 0.01, we suppose it is detectable. For the old version of BeadStudio output (version 2 or earlier), the threshold will automatically transferred as 1 - Th, because in the old format, value close to 1 is suppose to be detectable. |
type |
determine to calculate the detection count by probe or by sample |
If the type is 'probe', then returns the presentCount of each probe. If the type is 'sample', then return the detectable probe ratio of each sample. If the type is 'matrix', then return the AP matrix, in which 'A' represents absent (the detect p-value less than threshold) and 'P' represents present.
Pan Du
## load example data data(example.lumi) ## load example data data(example.lumi) ## estimate the detect call (percentage of expressed genes) of each sample temp <- detectionCall(example.lumi, type='sample') print(temp) ## estimate the present count of each gene (probe) temp <- detectionCall(example.lumi, type='probe') hist(temp)## load example data data(example.lumi) ## load example data data(example.lumi) ## estimate the detect call (percentage of expressed genes) of each sample temp <- detectionCall(example.lumi, type='sample') print(temp) ## estimate the present count of each gene (probe) temp <- detectionCall(example.lumi, type='probe') hist(temp)
Detect the outlier sample (or gene) based on distance to the cluster center
detectOutlier(x, metric = "euclidean", standardize = TRUE, Th = 2, ifPlot = FALSE)detectOutlier(x, metric = "euclidean", standardize = TRUE, Th = 2, ifPlot = FALSE)
x |
a LumiBatch object, ExpressionSet object or a matrix with each column corresponding to a sample or other profile |
metric |
the distance matric |
standardize |
standardize the profile or not |
Th |
the threshold of outlier, |
ifPlot |
to plot the result (as a hierarchical tree) or not |
The current outlier detection is based on the distance from the sample to the center (average of all samples after removing 10 percent samples farthest away from the center). The assumption of the outlier detection is that there is only one single cluster and the distance from the sample to the center is Gaussian distributed.
The outlier is detected when its distance to the center is larger than a certain threshold. The threshold is calculated as Th * median distances to the center.
The profile relations can be visualized as a hierarchical tree.
Plot the results or return the outlier (a logic vector) with the distance matrix and threshold as attributes.
Pan Du
## load example data data(example.lumi) ## detect the outlier (Further improvement needed.) temp <- detectOutlier(example.lumi, ifPlot=TRUE)## load example data data(example.lumi) ## detect the outlier (Further improvement needed.) temp <- detectOutlier(example.lumi, ifPlot=TRUE)
Estimate methylation Beta-value matrix from MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities
estimateBeta(methyLumiM, returnType=c("ExpressionSet", "matrix"), offset = 100)estimateBeta(methyLumiM, returnType=c("ExpressionSet", "matrix"), offset = 100)
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
returnType |
determine whether return an ExpressionSet or matrix object |
offset |
An offset value added to the denominator to avoid close to zero intensities |
Beta-value is ratio between Illumina methylated probe intensity and total probe intensities (sum of methylated and unmethylated probe intensities, see estimateIntensity). An offset value added to the denominator to avoid close to zero intensities in the denominator. Beta-value is in the range of 0 and 1. If we assume the probe intensity follows Gamma distribution, then the Beta-value follows a Beta distribution.
An ExpressionSet or matrix object of methylation Beta-value
Pan DU
See Also as estimateIntensity and estimateM
data(example.lumiMethy) methyLumiBeta = estimateBeta(example.lumiMethy) density(methyLumiBeta)data(example.lumiMethy) methyLumiBeta = estimateBeta(example.lumiMethy) density(methyLumiBeta)
Estimate intensity of Illumina methylation data, which is the sum of Illumina methylated and unmethylated probe intensities
estimateIntensity(methyLumiM, returnType=c("ExpressionSet", "matrix"))estimateIntensity(methyLumiM, returnType=c("ExpressionSet", "matrix"))
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
returnType |
determine whether return an ExpressionSet or matrix object |
The Intensity basically is the sum of Illumina methylated and unmethylated probe intensities.
An ExpressionSet or matrix object of methylation Intensity-value
Pan DU
See Also as estimateBeta and estimateM
data(example.lumiMethy) methyLumiIntensity = estimateIntensity(example.lumiMethy) boxplot(methyLumiIntensity)data(example.lumiMethy) methyLumiIntensity = estimateIntensity(example.lumiMethy) boxplot(methyLumiIntensity)
Estimate the coefficient of variance matrix of LumiBatch object for each measurement or probe.
estimateLumiCV(x.lumi, type = c("measurement", "probe"), ifPlot = FALSE, ...)estimateLumiCV(x.lumi, type = c("measurement", "probe"), ifPlot = FALSE, ...)
x.lumi |
a LumiBatch object |
type |
estimate the coefficient of variance of each measurement or each probe |
ifPlot |
determince whether to plot the density plot or not |
... |
optional arguments to |
By default, the coefficient of variance is the ratio of the mean and variance of the bead expression values.
Basically, it is the ration of exprs and se.exprs element of LumiBatch object.
If the type is "probe", it is the ratio of the mean and variance of probe expression profile.
A matrix of coefficient of variance
Pan Du
## load example data data(example.lumi) ## estimate the coefficient of variance and plot the density plot of it cv <- estimateLumiCV(example.lumi, ifPlot = TRUE)## load example data data(example.lumi) ## estimate the coefficient of variance and plot the density plot of it cv <- estimateLumiCV(example.lumi, ifPlot = TRUE)
Estimate methylation M-value matrix from MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities
estimateM(methyLumiM, returnType=c("ExpressionSet", "matrix"), offset=100)estimateM(methyLumiM, returnType=c("ExpressionSet", "matrix"), offset=100)
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
returnType |
determine whether return an ExpressionSet (MethyLumiM in this case) or matrix object |
offset |
offset added to the methylated and unmethylated probe intensities when estimating the M-value |
M-value is the log2 ratio between Illumina methylated and unmethylated probe intensities. As variations of small intensities can cause big changes in the ratio estimation, so an offset is added to methylated and unmethylated probe intensities when estimating the M-value.
A MethyLumiM or matrix object of methylation M-value
Pan DU
Du, P., Zhang, X, Huang, C.C., Jafari, N., Kibbe, W.A., Hou, L., and Lin, S.M., (2010) 'Comparison of Beta-value and M-value methods for quantifying methylation levels by microarray analysis', (under review)
See Also as estimateBeta, estimateIntensity
data(example.lumiMethy) methyLumiM = estimateM(example.lumiMethy) boxplot(methyLumiM)data(example.lumiMethy) methyLumiM = estimateM(example.lumiMethy) boxplot(methyLumiM)
Estimate the background levels of Illumina Infinium methylaton microarrays. It is called by function bgAdjustMethylation
estimateMethylationBG(methyLumiM, separateColor = FALSE, nbin = 1000)estimateMethylationBG(methyLumiM, separateColor = FALSE, nbin = 1000)
methyLumiM |
a MethyLumiM object or any eSet object with "methylated" and "unmethylated" data matrix element in the assayData slot |
separateColor |
determine whether to separately process two color channels |
nbin |
the number of bins in the histogram used to estimate the mode position of the density |
When the controlData includes the negative control probe information, the background estimation will be the median of the negative control probes. Red and Green color channels will be estimated separately.
In the case the negative control data is not available, the background will be estimated based on the mode positions of unmethylated or methylated distribution (the smaller one). The assumption is that the lots of CpG sites are unmethylated, which results in a density mode of the intensities measured by methylated probes. The position of this mode represents the background level.
a vector of estimated background levels for individual samples.
Pan DU
See Also lumiMethyB and bgAdjustMethylation
data(example.lumiMethy) estimatedBG = estimateMethylationBG(example.lumiMethy) estimatedBGdata(example.lumiMethy) estimatedBG = estimateMethylationBG(example.lumiMethy) estimatedBG
Example data as a LumiBatch object which is a subset of Barnes data (Barnes, 2005)
data(example.lumi)data(example.lumi)
A 'LumiBatch' object
The data is from (Barnes, 2005). It used Sentrix HumanRef-8 Expression BeadChip. Two samples "100US" and "95US:5P" (each has two technique replicates) were selected. In order to save space, 8000 genes were randomly selected. As a result, the example data includes 8000 genes, each has 4 measurements. The full data set was included in the Bioconductor Experiment data package lumiBarnes.
The entire data set has been built as a lumiBarnes data object and can be downloaded from Bioconductor Experiment Data.
Barnes, M., Freudenberg, J., Thompson, S., Aronow, B. and Pavlidis, P. (2005) Ex-perimental comparison and cross-validation of the Affymetrix and Illumina gene expression analysis platforms, Nucleic Acids Res, 33, 5914-5923.
The detailed data information can be found at: http://www.bioinformatics.ubc.ca/pavlidis/lab/platformCompare/
## load the data data(example.lumi) ## summary of the data example.lumi## load the data data(example.lumi) ## summary of the data example.lumi
An example Illumina Infinium Methylation27k dataset, which includes a control and treatment dataset with both technique and biological replicates
data(example.lumiMethy)data(example.lumiMethy)
The example dataset includes four control and four treatment samples together with their technique replicates. The original samples and technique replicates were measured in two batches. Here are the names of sixteen samples: Treat1, Treat2, Treat3, Treat4, Ctrl1, Ctrl2, Ctrl3, Ctrl4, Treat1.rep, Treat2.rep, Treat3.rep, Treat4.rep, Ctrl1.rep, Ctrl2.rep, Ctrl3.rep, Ctrl4.rep.
To save storage space, we randomly subset 5000 CpG sites among about 27000 measured CpG sites.
data(example.lumiMethy) sampleNames(example.lumiMethy)data(example.lumiMethy) sampleNames(example.lumiMethy)
An example Illumina Infinium Methylation27k dataset, which includes a titration dataset
data(example.methyTitration)data(example.methyTitration)
The example dataset is a titration dataset. It includes 8 samples: "A1", "A2", "B1", "B2", "C1", "C2", "D" and "E". They are mixtures of Sample A (a B-lymphocyte sample) and Sample B (is (a colon cancer sample from a female donor) at five different titration ratios: 100:0 (A), 90:10 (C), 75:25 (D), 50:50 (E) and 0:100 (B).
To save storage space, we randomly subset 10000 CpG sites among about 27000 measured CpG sites.
data(example.methyTitration) sampleNames(example.methyTitration)data(example.methyTitration) sampleNames(example.methyTitration)
Estimate the methylation status by fitting a two component Gamma mixture model using EM algorithm based on the all M-values of a particular sample
gammaFitEM(M, initialFit = NULL, fix.k = NULL, weighted = TRUE, maxIteration = 50, tol = 1e-04, plotMode = FALSE, truncate=FALSE, verbose = FALSE)gammaFitEM(M, initialFit = NULL, fix.k = NULL, weighted = TRUE, maxIteration = 50, tol = 1e-04, plotMode = FALSE, truncate=FALSE, verbose = FALSE)
M |
a vector of M-values covering the whole genome |
initialFit |
the initial estimation of the gamma parameters returned by .initialGammaEstimation function |
fix.k |
the k parameter of the gamma function which is fixed during estimation |
weighted |
determine whether to down-weight the long tails of two component densities beyond their modes |
maxIteration |
maximum iterations allowed before converging |
tol |
the difference threshold used to determine convergence |
plotMode |
determine whether plot the histogram and density plot estimation |
truncate |
determine whether to truncate the tails beyond the modes during parameter estimation |
verbose |
determine whether plot intermediate messages during iterations |
The assumption of this function is that the M-value distribution is composed of the mixture of two shifted gamma distributions, which are defined as: dgamma(x-s[1], shape=k[1], scale=theta[1]) and dgamma(s[2]-x, shape=k[2], scale=theta[2]). Here s represents the shift.
NOTE: the methylation status modeling algorithm was developed based on 27K methylation array. It has not been tested for 450K array. Considering 450K array covers both promoter and gene body, the two component Gamma mixture model assumption may not be valid any more.
The return is a list with "gammaFit" class attribute, which includes the following items:
logLikelihood |
the log-likelihood of the fitting model |
k |
parameter k of gamma distribution |
theta |
parameter theta of gamma distribution |
shift |
parameter shift of gamma distribution |
proportion |
the proportion of two components (gamma distributions) |
mode |
the mode positions of the gamma distributions |
probability |
the estimated methylation status posterior probability of each CpG site |
Pan Du
methylationCall and plotGammaFit
data(example.lumiMethy) M <- exprs(example.lumiMethy) fittedGamma <- gammaFitEM(M[,1], initialFit=NULL, maxIteration=50, tol=0.0001, plotMode=TRUE, verbose=FALSE)data(example.lumiMethy) M <- exprs(example.lumiMethy) fittedGamma <- gammaFitEM(M[,1], initialFit=NULL, maxIteration=50, tol=0.0001, plotMode=TRUE, verbose=FALSE)
Retrieve the matched Illumina chip information by searching the provided probe identifiers through the Illumina identifiers in all manifest files.
getChipInfo(x, lib.mapping = NULL, species = c("Human", "Mouse", "Rat", "Unknown"), chipVersion = NULL, idMapping = FALSE, returnAllMatches = FALSE, verbose = TRUE)getChipInfo(x, lib.mapping = NULL, species = c("Human", "Mouse", "Rat", "Unknown"), chipVersion = NULL, idMapping = FALSE, returnAllMatches = FALSE, verbose = TRUE)
x |
a vector of probe identifiers, ExpressionSet object or a matrix with probe identifiers as row names |
lib.mapping |
the ID mapping library. If it is provided, the parameter "species" will be ignored. |
species |
species of the chip designed for. If users do not know it, it can be set as "Unknown". |
chipVersion |
chipVersion information returned by function |
idMapping |
determine whether return the idMapping information (between Illumina ID and nuID) |
returnAllMatches |
determine whether return all matches or just the best match |
verbose |
determine whether print some warning information |
The function searches the provided probe Identifiers (Illumina IDs or nuIDs) through all the manifest file ID information kept in the IDMapping libraries (lumiHumanIDMapping, lumiMouseIDMapping, lumiRatIDMapping). The Illumina IDs kept in the library include "Search\_key" ("Search\_Key"), "Target" ("ILMN\_Gene"), "Accession", "Symbol", "ProbeId" ("Probe\_Id"). To determine the best match, the function calculate the number of matched probes. The higher "matchedProbeNumber" is claimed as better. When the "matchedProbeNumber" is the same, the manifest file with fewer probes is claimed as better. If x is NULL and chipVersion is provided, it will return the entire mapping table of the chip.
The function returns a list with following items:
chipVersion |
the file name of the manifest file for the corresponding version and release |
species |
the species of the chip designed for |
IDType |
the type of probe identifier |
chipProbeNumber |
the number of probes in the manifest file |
matchedProbeNumber |
the number of input probes matching the manifest file |
idMapping |
id mapping information between Illumina ID and nuID |
When parameter "returnAllMatches" is TRUE, the items of "chipVersion", "IDType", "chipProbeNumber", "inputProbeNumber", "matchedProbeNumber" will be a vector corresponding to the matched manifest files, whose "matchedProbeNumber" is larger than zero, and the "idMapping" will be a matrix with each column corresponding to one matched manifest file. All of the items are sorted from the best match to worst (The higher "matchedProbeNumber" is claimed as better. When the "matchedProbeNumber" is the same, the manifest file with fewer probes is claimed as better.).
Pan Du
nuID2IlluminaID, IlluminaID2nuID
## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { chipInfo <- getChipInfo(example.lumi, species='Human') chipInfo }## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { chipInfo <- getChipInfo(example.lumi, species='Human') chipInfo }
get the chromosome location information of methylation probes
getChrInfo(methyData, lib = NULL, ...)getChrInfo(methyData, lib = NULL, ...)
methyData |
a MethyLumiM object |
lib |
Methylation annotation library |
... |
optional arguments to |
a data.frame
Pan Du
Get control probe information from Bead Studio output or a LumiBatch object.
getControlData(x, type = c('data.frame', 'LumiBatch'), ...)getControlData(x, type = c('data.frame', 'LumiBatch'), ...)
x |
the control data can be a LumiBatch object or the Control Probe Profile file outputted by BeadStudio |
type |
determine the return data type |
... |
other parameters used by |
By default, it returns a data.frame with first two columns as "controlType" and "ProbeID". The rest columns are the expression amplitudes for individual samples. When type is 'LumiBatch', it returns a LumiBatch object, which basically is the return of lumiR without combining duplicated TargetIDs. As the return is a LumiBatch object, it includes more information, like probe number, detection p-value and standard error of the measurement.
Pan Du
controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { ## return a data.frame controlData <- getControlData(controlFile) class(controlData) names(controlData) ## return a LumiBatch object controlData <- getControlData(controlFile, type='LumiBatch') summary(controlData) }controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { ## return a data.frame controlData <- getControlData(controlFile) class(controlData) names(controlData) ## return a LumiBatch object controlData <- getControlData(controlFile, type='LumiBatch') summary(controlData) }
Get the control probe Ids corresponding to the control probe type provided. The control probe ids are kept in the second column of controlData data.frame.
getControlProbe(controlData, type = NULL)getControlProbe(controlData, type = NULL)
controlData |
a LumiBatch object including control data or a control data data.frame |
type |
the type of control probe (case insensitive), which can be get by using |
returns the corresponding probe Ids for the control type.
Pan Du
controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { ## return a data.frame controlData <- getControlData(controlFile) getControlType(controlData) getControlProbe(controlData, type='housekeeping') }controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { ## return a data.frame controlData <- getControlData(controlFile) getControlType(controlData) getControlProbe(controlData, type='housekeeping') }
Get the types of the control probes, which is in the first column of the controlData data.frame for LumiBatch objects. For methylation data, it is the return of controlTypes function
getControlType(controlData)getControlType(controlData)
controlData |
a LumiBatch object including control data, a control data data.frame, or a MethyLumiQC object for methylation data |
return the unique type of control probe type.
Pan Du
addControlData2lumi, controlTypes for methylation data
controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { ## return a data.frame controlData <- getControlData(controlFile) getControlType(controlData) }controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { ## return a data.frame controlData <- getControlData(controlFile) getControlType(controlData) }
Get the mapping information (including mapping quality information) of nuIDs to the most recent RefSeq release. These information was kept in the IDMapping libraries.
getNuIDMappingInfo(nuID = NULL, lib.mapping)getNuIDMappingInfo(nuID = NULL, lib.mapping)
nuID |
a vector of nuIDs. If it is NULL, all mappings will be returned. |
lib.mapping |
the ID mapping library |
The function basically return the nuID mapping information kept in the "nuID\_MappingInfo" table of IDMapping libraries (lumiHumanIDMapping, lumiMouseIDMapping, lumiRatIDMapping). For more details of nuID mapping, please refer to the help of corresponding IDMapping library.
It returns a data.frame with each row corresponding to an input nuID.
Warren Kibbe, Pan Du, Simon Lin
## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { nuIDs <- featureNames(example.lumi) mappingInfo <- getNuIDMappingInfo(nuIDs, lib.mapping='lumiHumanIDMapping') head(mappingInfo) }## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { nuIDs <- featureNames(example.lumi) mappingInfo <- getNuIDMappingInfo(nuIDs, lib.mapping='lumiHumanIDMapping') head(mappingInfo) }
Creating density plot of sample intensities in a ExpressionSet object. It is equivalent to density-methods.
## S4 method for signature 'ExpressionSet' hist(x, ...)## S4 method for signature 'ExpressionSet' hist(x, ...)
x |
a |
... |
other parameters for density-methods function |
LumiBatch-class, density-methods, hist
## load example data data(example.lumi) hist(example.lumi)## load example data data(example.lumi) hist(example.lumi)
The nuID (nucleotide universal identifier) is uniquely corresponding to probe sequence. The nuID is also self-identification and error checking
id2seq(id)id2seq(id)
id |
a nuID (nucleotide universal identifier) |
A reverse of seq2id.
Please refer to reference for more details.
a string of nucleotide sequence
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) id id2seq(id)seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) id id2seq(id)
Matching Illumina IDs to nuID based on Illumina ID mapping libraries.
IlluminaID2nuID(IlluminaID, lib.mapping=NULL, species = c("Human", "Mouse", "Rat", "Unknown"), chipVersion = NULL, ...)IlluminaID2nuID(IlluminaID, lib.mapping=NULL, species = c("Human", "Mouse", "Rat", "Unknown"), chipVersion = NULL, ...)
IlluminaID |
a vector of Illumina IDs |
lib.mapping |
the ID mapping library. If it is provided, the parameter "species" will be ignored. |
species |
the species of the chip designed for. If users do not know it, it can be set as "Unknown". |
chipVersion |
chipVersion information returned by function |
... |
other parameters of |
When the parameter "chipVersion" is not provided, this function basically returned the "idMapping" item returned by function getChipInfo.
The mapping information from Illumina ID to nuID. It will be a matrix with each column corresponding to one matched manifest file when parameter "returnAllMatches" is TRUE. In this case, the columns are sorted from the best match to worst. If IlluminaID is NULL and chipVersion is provided, it will return all mapping information of the chip.
Pan Du
Import Illumina methylation .idat files as an MethyLumiM object. An extension of lumIDAT function
importMethyIDAT(sampleInfo, dataPath = getwd(), lib = NULL, bigMatrix=FALSE, dir.bigMatrix='.', savePrefix.bigMatrix, ...)importMethyIDAT(sampleInfo, dataPath = getwd(), lib = NULL, bigMatrix=FALSE, dir.bigMatrix='.', savePrefix.bigMatrix, ...)
sampleInfo |
A data.frame of sample information or a character vector of barcodes. |
dataPath |
The path of .idat files |
lib |
Annotation library |
bigMatrix |
whether to save the data as BigMatrix (designed for very large dataset) |
dir.bigMatrix |
the parent directory to save the BigMatrix data files |
savePrefix.bigMatrix |
the folder name prefix of the directory to save the BigMatrix data files. The fold name will be like this: paste(savePrefix.bigMatrix, '_bigmat', sep=”) |
... |
other parameters used by |
This function is an extension of lumIDAT. It adds sample information and probe annotation information to the data. As Illumina organizes the output .idat files by barcodes, the function will automatically check the sub-folders in the names of barcodes for .idat files. The "sampleInfo" parameter can be either a barcode vector, e.g., "7310440039_R04C02" "7310440039_R05C02". Or a data.frame with required columns of 'Sentrix_Barcode' and 'Sentrix_Position'. If "sampleInfo" is a data.frame, it will be added as the pData of the output MethyLumiM object.
A MethyLumiM object
Pan Du, Tim Triche
lumIDAT, lumiMethyR, addAnnotationInfo
Inverse transform of VST (variance stabilizing transform), see vst.
inverseVST(x, fun = c('asinh', 'log'), parameter)inverseVST(x, fun = c('asinh', 'log'), parameter)
x |
a VST transformed LumiBatch object or a numeric matrix or vector |
fun |
function used in VST transform |
parameter |
parameter of VST function |
Recover the raw data from VST transformed data returned by vst.
This function can be directly applied to the VST transformed or VST + RSN normalized LumiBatch object to reverse transform the data to the original scale.
Return the raw data before VST transform
Pan Du
Lin, S.M., Du, P., Kibbe, W.A., "Model-based Variance-stabilizing Transformation for Illumina Mi-croarray Data", submitted
## load example data data(example.lumi) ## get the gene expression mean for one chip u <- exprs(example.lumi)[,1] ## get the gene standard deviation for one chip std <- se.exprs(example.lumi)[,1] ## do variance stabilizing transform transformedU <- vst(u, std) ## do inverse transform and recover the raw data parameter <- attr(transformedU, 'parameter') transformFun <- attr(transformedU, 'transformFun') recoveredU <- inverseVST(transformedU, fun=transformFun, parameter=parameter) ## compare with the raw data print(u[1:5]) print(recoveredU[1:5]) ## do inverse transform of the VST + RSN processed data lumi.N <- lumiExpresso(example.lumi[,1:2]) ## Inverse transform. ## Note: as the normalization is involved, the processed data will be different from the raw data. lumi.N.raw <- inverseVST(lumi.N)## load example data data(example.lumi) ## get the gene expression mean for one chip u <- exprs(example.lumi)[,1] ## get the gene standard deviation for one chip std <- se.exprs(example.lumi)[,1] ## do variance stabilizing transform transformedU <- vst(u, std) ## do inverse transform and recover the raw data parameter <- attr(transformedU, 'parameter') transformFun <- attr(transformedU, 'transformFun') recoveredU <- inverseVST(transformedU, fun=transformFun, parameter=parameter) ## compare with the raw data print(u[1:5]) print(recoveredU[1:5]) ## do inverse transform of the VST + RSN processed data lumi.N <- lumiExpresso(example.lumi[,1:2]) ## Inverse transform. ## Note: as the normalization is involved, the processed data will be different from the raw data. lumi.N.raw <- inverseVST(lumi.N)
Self-identify nuID (nucleotide universal identifier) by verify the check code value and the checksum value
is.nuID(id)is.nuID(id)
id |
nuId or other string |
Return TRUE if id is a nuID, or else return FALSE.
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
## check the function using a random sequence id <- 'adfasdfafd' is.nuID(id) # FALSE ## check the function using a read nuID seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) is.nuID(id) # TRUE## check the function using a random sequence id <- 'adfasdfafd' is.nuID(id) # FALSE ## check the function using a read nuID seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) is.nuID(id) # TRUE
Background correction of Illumina Expression data
lumiB(x.lumi, method = c('none', 'bgAdjust', 'forcePositive', 'bgAdjust.affy'), verbose = TRUE, ...)lumiB(x.lumi, method = c('none', 'bgAdjust', 'forcePositive', 'bgAdjust.affy'), verbose = TRUE, ...)
x.lumi |
an ExpressionSet inherited object or a data matrix with columns as samples and rows as genes. For 'bgAdjust' method, it should be a LumiBatch Object |
method |
the background correction method, it can be any function with a ExpressionSet Object or matrix as the first argument and return an processed object with the same class |
verbose |
a boolean to decide whether to print out some messages |
... |
other parameters used by the user provided background correction method |
We assume the BeadStudio output data is background corrected. So by default, it will do nothing. The 'bgAdjust' method will estimate the background based on the control probe information, which is kept in the controlData slot of LumiBatch object. The 'forcePositive' method will force all expression values to be positive by adding an offset (minus minimum value plus one), it does nothing if all expression values are positive. The purpose of this is to avoid NA when do logarithm transformation. 'none' does not but return the LumiBatch object. 'bgAdjust.affy' will call the bg.adjust function in affy package. User can also provide their own function with a LumiBatch Object as the first argument and return a LumiBatch Object with background corrected.
Thanks Kevin Coombes (M.D. Anderson Cancer Center) suggested adding this function.
Return an object with background corrected. The class of the return object is the same as the input object x.lumi.
Pan Du, Kevin Coombes
## load example data data(example.lumi) ## Do the default background correction method lumi.B <- lumiB(example.lumi, method='bgAdjust', probs=0)## load example data data(example.lumi) ## Do the default background correction method lumi.B <- lumiB(example.lumi, method='bgAdjust', probs=0)
This is a class representation for Illumina microarray data. It extends ExpressionSet.
Directly extends class ExpressionSet.
new("LumiBatch",
exprs = [matrix],
se.exprs = [matrix],
beadNum = [matrix],
detection = [matrix],
phenoData = [AnnotatedDataFrame],
history = [data.frame],
...)
LumiBatch instances are usually created through
new("LumiBatch", ...). The arguments to new
should include exprs and se.exprs, others can be
missing, in which case they are assigned default values.
Objects can be created using the function lumiR.
Slot specific to LumiBatch:
history:a data.frame recording the operation history of the LumiBatch object.
controlData:a data.frame with first two columns as "controlType" and "ProbeID". The rest columns are the control probe expression amplitudes for individual samples.
QC:a the quality control information of the LumiBatch object, returned by lumiQ function.
Slots inherited from ExpressionSet:
assayData contains equal dimensional matrices:
exprs (contains gene expression level, which is the mean of its bead replicates.),
se.exprs (contains gene expression standard error, which is the standard error of its bead replicates.),
beadNum (records the number of beads for the probe.),
detection (records the detection p-value of the probe. The number is from [0,1]. By default, < 0.01 indicates good detection.).
For more details of assayData, please see ExpressionSet
phenoData:See eSet
experimentData:See eSet
annotation:See eSet
Class-specific methods:
se.exprs(LumiBatch), se.exprs(LumiBatch,matrix)<-:Access and
set elements named se.exprs in the AssayData-class slot.
beadNum(LumiBatch), beadNum(LumiBatch)<-:Access and
set elements named beadNum in the AssayData-class slot. Use "beadNum(LumiBatch) <- NULL" to remove the beadNum element.
detection(LumiBatch), detection(LumiBatch)<-:Access and
set elements named detection in the AssayData-class slot. Use "detection(LumiBatch) <- NULL" to remove the detection element.
getHistory(LumiBatch):Access the operation history of LumiBatch object.
Derived from ExpressionSet (For the directly inherited methods,
please see ExpressionSet and eSet):
combine(LumiBatch,missing):Combine two LumiBatch objects, including history slot. See eSet
exprs(LumiBatch), exprs(LumiBatch,matrix)<-:Access and
set elements named exprs in the AssayData-class slot.
object[(i,j):Conduct subsetting of the data in a LumiBatch object
Standard generic methods (For the directly inherited methods,
please see ExpressionSet and eSet):
initialize(LumiBatch):Object instantiation, used
by new; not to be called directly by the user.
validObject(LumiBatch):Validity-checking method, ensuring that exprs and se.exprs
is a member of assayData. Other validity check is the same as checkValidity(ExpressionSet).
show(LumiBatch)A summary of the LumiBatch object.
Pan Du, Simon Lin
lumiR, lumiT, lumiN,
boxplot-methods, pairs-methods, MAplot-methods
## load example data data(example.lumi) ## show the summary of the data # summary(example.lumi) example.lumi ## get expression matrix temp <- exprs(example.lumi) ## get a subset temp <- example.lumi[,1] ## retrieve the first sample ## get the probe id featureNames(example.lumi)[1:3] ## combine LumiBatch objects temp <- combine(example.lumi[,1], example.lumi[,3]) temp## load example data data(example.lumi) ## show the summary of the data # summary(example.lumi) example.lumi ## get expression matrix temp <- exprs(example.lumi) ## get a subset temp <- example.lumi[,1] ## retrieve the first sample ## get the probe id featureNames(example.lumi)[1:3] ## combine LumiBatch objects temp <- combine(example.lumi[,1], example.lumi[,3]) temp
Goes from raw Illumina probe intensities to expression values
lumiExpresso(lumiBatch, bg.correct = TRUE, bgcorrect.param = list(method='bgAdjust'), variance.stabilize = TRUE, varianceStabilize.param = list(), normalize = TRUE, normalize.param = list(), QC.evaluation = TRUE, QC.param = list(), verbose = TRUE)lumiExpresso(lumiBatch, bg.correct = TRUE, bgcorrect.param = list(method='bgAdjust'), variance.stabilize = TRUE, varianceStabilize.param = list(), normalize = TRUE, normalize.param = list(), QC.evaluation = TRUE, QC.param = list(), verbose = TRUE)
lumiBatch |
a LumiBatch object, which can be the return of |
bg.correct |
a boolean to decide whether to do background correction or not |
bgcorrect.param |
a list of parameters of |
variance.stabilize |
a boolean to decide whether to do variance stabilization or not |
varianceStabilize.param |
a list of parameters of |
normalize |
a boolean to decide whether to do normalization or not |
normalize.param |
a list of parameters of |
QC.evaluation |
a boolean to decide whether to do quality control estimation before and after preprocessing |
QC.param |
a list of parameters of |
verbose |
a boolean to decide whether to print out some messages |
The function is to encapsulate the major functions of Illumina preprocessing. It is organized in a similar way as the expresso function in affy package.
return a processed LumiBatch object. The operation history can be track in the history slot of the object.
Pan Du
## load example data data(example.lumi) ## Do all the default preprocessing in one step lumi.N <- lumiExpresso(example.lumi) ## Do customized preprocessing. No variance stabilizing or log transform, use Quantile normalization. lumi.N <- lumiExpresso(example.lumi, variance.stabilize=FALSE, normalize.param = list(method='quantile'))## load example data data(example.lumi) ## Do all the default preprocessing in one step lumi.N <- lumiExpresso(example.lumi) ## Do customized preprocessing. No variance stabilizing or log transform, use Quantile normalization. lumi.N <- lumiExpresso(example.lumi, variance.stabilize=FALSE, normalize.param = list(method='quantile'))
Adjust background level of Illumina Infinium methylation data, which is an object in MethyLumiM class.
lumiMethyB(methyLumiM, method = c("bgAdjust2C", "forcePositive", "none"), separateColor = FALSE, verbose = TRUE, overwriteBigMatrix=FALSE, ...)lumiMethyB(methyLumiM, method = c("bgAdjust2C", "forcePositive", "none"), separateColor = FALSE, verbose = TRUE, overwriteBigMatrix=FALSE, ...)
methyLumiM |
a MethyLumiM object includes Illumina Infinium methylation data |
method |
background adjustment methods or user provided function, whose input and output should be a intensity matrix (pool of methylated and unmethylated probe intensities) |
separateColor |
determine whether to separately process two color channels |
verbose |
a boolean to decide whether to print out some messages |
overwriteBigMatrix |
whether to overwrite the result to the BigMatrix data, only valid when the input data is BigMatrix-based |
... |
other parameters used by corresponding method |
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after background level adjustment.
Pan DU
See Also bgAdjustMethylation and estimateMethylationBG
data(example.lumiMethy) lumiMethy.bgAdj = lumiB(example.lumiMethy) attr(lumiMethy.bgAdj, "EstimatedBG")data(example.lumiMethy) lumiMethy.bgAdj = lumiB(example.lumiMethy) attr(lumiMethy.bgAdj, "EstimatedBG")
Color bias adjust of Illumina Infinium methylation data, which is an object in MethyLumiM class.
lumiMethyC(methyLumiM, method = c("quantile", "ssn", "none"), verbose = TRUE, overwriteBigMatrix=FALSE, ...)lumiMethyC(methyLumiM, method = c("quantile", "ssn", "none"), verbose = TRUE, overwriteBigMatrix=FALSE, ...)
methyLumiM |
a MethyLumiM object includes Illumina Infinium methylation data |
method |
color bias adjustment methods or user provided function, see "details" for more information of user defined function. |
verbose |
a boolean to decide whether to print out some messages |
overwriteBigMatrix |
whether to overwrite the result to the BigMatrix data, only valid when the input data is BigMatrix-based |
... |
other parameters used by corresponding method |
The first two arguments of the user defined function should be two intensity matrix (pool of methylated and unmethylated probe intensities) of red and green channel respectively. The return of the user defined function should be a list including color adjusted matrix of red and green channel. For example: return(list(red=redData, green=grnData)). "redData" and "grnData" are two color adjusted matrix.
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after background level adjustment.
Pan DU
See Also adjColorBias.quantile and adjColorBias.ssn
data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy) # plot in 2D plot of one selected sample plotColorBias2D(example.lumiMethy, selSample = 1) lumiMethy.adj = lumiMethyC(example.lumiMethy) # after adjustment plotColorBias1D(lumiMethy.adj) # plot in 2D plot of one selected sample plotColorBias2D(lumiMethy.adj, selSample = 1)data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy) # plot in 2D plot of one selected sample plotColorBias2D(example.lumiMethy, selSample = 1) lumiMethy.adj = lumiMethyC(example.lumiMethy) # after adjustment plotColorBias1D(lumiMethy.adj) # plot in 2D plot of one selected sample plotColorBias2D(lumiMethy.adj, selSample = 1)
Normalize the Illumina Infinium methylation data, which is an object in MethyLumiM class.
lumiMethyN(methyLumiM, method = c("quantile", "ssn", "none"), separateColor = FALSE, verbose = TRUE, overwriteBigMatrix = FALSE, ...)lumiMethyN(methyLumiM, method = c("quantile", "ssn", "none"), separateColor = FALSE, verbose = TRUE, overwriteBigMatrix = FALSE, ...)
methyLumiM |
a MethyLumiM object includes Illumina Infinium methylation data |
method |
supported normalization methods or user provided function, whose input and output should be a intensity matrix (pool of methylated and unmethylated probe intensities) |
separateColor |
determine whether to separately process two color channels |
verbose |
a boolean to decide whether to print out some messages |
overwriteBigMatrix |
whether to overwrite the result to the BigMatrix data, only valid when the input data is BigMatrix-based |
... |
other parameters used by corresponding method |
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after background level adjustment.
Pan DU
See Also normalizeMethylation.ssn and normalizeMethylation.quantile
data(example.lumiMethy) lumiMethy.norm = lumiN(example.lumiMethy)data(example.lumiMethy) lumiMethy.norm = lumiN(example.lumiMethy)
This function is a wrap of methylumiR function in methylumi package.
lumiMethyR(filename, lib=NULL, controlData=NULL, qcfile=NULL, sampleDescriptions=NULL, sep = NULL)lumiMethyR(filename, lib=NULL, controlData=NULL, qcfile=NULL, sampleDescriptions=NULL, sep = NULL)
filename |
file name output by GenomeStudio |
lib |
Annotation library of Illumina methylation microarray |
controlData |
the controlData file name or a MethyLumiQC object to be added to the "controlData" slot of the MethyLumiM object |
qcfile |
parameter of |
sampleDescriptions |
parameter of |
sep |
parameter of |
This function is a wrap of methylumiR function in methylumi package. It will coerce the returned object as MethyLumiM class. The methylated and unmethylated probe intensity information is required for color-bias adjustment and normalization. If users have the Illumina IDAT files, we suggest use importMethyIDAT function to import the data. The importMethyIDAT function will automatically retrieve the required information and return a MethyLumiM object.
return a MethyLumiM object
Pan Du
See Also importMethyIDAT, methylumiR and addControlData2methyLumiM
Estimate the methylation status of individual methylation sites by fitting a two component Gamma mixture model for each sample
lumiMethyStatus(methyLumiM, ...)lumiMethyStatus(methyLumiM, ...)
methyLumiM |
a MethyLumiM class object |
... |
Other parameters used by |
This function calls methylationCall and returns the methylation status of individual methylation sites. The methylation status includes: "Unmethy" (unmethylation probability > unmethylation threshold), "Methy" (methylation probability > methylation threshold), or "Margin". The methylation probability is returned as an attribute of "probability".
return a methylation status matrix with "probability" attribute
Pan Du
See Also methylationCall and gammaFitEM
data(example.lumiMethy) methyCall <- lumiMethyStatus(example.lumiMethy) head(methyCall)data(example.lumiMethy) methyCall <- lumiMethyStatus(example.lumiMethy) head(methyCall)
A main function of between chip normalization of a LumiBatch object. Currently, four methods ("rsn", "ssn", "quantile", "loess", "vsn") are supported.
lumiN(x.lumi, method = c("quantile", "rsn", "ssn", "loess", "vsn", "rankinvariant"), verbose = TRUE, ...)lumiN(x.lumi, method = c("quantile", "rsn", "ssn", "loess", "vsn", "rankinvariant"), verbose = TRUE, ...)
x.lumi |
an ExpressionSet inherited object or a data matrix with columns as samples and rows as genes |
method |
five different between chips normalization methods ("quantile", "rsn", "ssn", "loess", "vsn", "rankinvariant") are supported |
verbose |
a boolean to decide whether to print out some messages |
... |
other parameters used by corresponding method |
lumiN is an interface for different normalization methods. Currently it supports "RSN" (See rsn), "SSN" (See ssn), "loess" (See normalize.loess), "quantile" (See normalize.quantiles), "VSN" (See vsn) and "rankinvariant" (See rankinvariant) . See details in individual functions. Note: the "VSN" normalization should be directly applied to the raw data instead of the lumiT processed data.
Return an object with expression values normalized. The class of the return object is the same as the input object x.lumi.
If it is a LumiBatch object, it also includes the VST transform function and its parameters as attributes: "transformFun", "parameter". See inverseVST for details.
Pan Du, Simon Lin
## load example data data(example.lumi) ## Do lumi transform lumi.T <- lumiT(example.lumi) ## Do lumi between chip normaliazation lumi.N <- lumiN(lumi.T, method='rsn', ifPlot=TRUE)## load example data data(example.lumi) ## Do lumi transform lumi.T <- lumiT(example.lumi) ## Do lumi between chip normaliazation lumi.N <- lumiN(lumi.T, method='rsn', ifPlot=TRUE)
Quality control evaluation of the LumiBatch object and returns a summary of the data
lumiQ(x.lumi, logMode = TRUE, detectionTh = 0.01, verbose = TRUE)lumiQ(x.lumi, logMode = TRUE, detectionTh = 0.01, verbose = TRUE)
x.lumi |
a LumiBatch object |
logMode |
transform as log2 or not (the function can check whether it is already log transformed.) |
detectionTh |
the detection threshold used by |
verbose |
a boolean to decide whether to print out some messages |
Quality control of a LumiBatch object includes estimating the mean and standard deviation of the chips, detectable probe ratio of each chip, sample (chip) relations, detecting outliers of samples (chips). The produced QC information is kept in the QC slot of LumiBatch class. The summary function will provide a summary of the QC information (See example).
a LumiBatch object with QC slot keeping the QC information
Pan Du
LumiBatch, plot,ExpressionSet-method
## load example data data(example.lumi) ## Do quality control estimation lumi.Q <- lumiQ(example.lumi) ## A summary of the QC summary(lumi.Q, 'QC') ## Plot the results ## plot the pairwise sample correlation plot(lumi.Q, what='pair') ## see more examples in "plot,ExpressionSet-method" help documents## load example data data(example.lumi) ## Do quality control estimation lumi.Q <- lumiQ(example.lumi) ## A summary of the QC summary(lumi.Q, 'QC') ## Plot the results ## plot the pairwise sample correlation plot(lumi.Q, what='pair') ## see more examples in "plot,ExpressionSet-method" help documents
Read in Illumina expression data. We assume the data was saved in a comma or tab separated text file.
lumiR(fileName, sep = NULL, detectionTh = 0.01, na.rm = TRUE, convertNuID = TRUE, lib.mapping = NULL, dec = '.', parseColumnName = FALSE, checkDupId = TRUE, QC = TRUE, columnNameGrepPattern = list(exprs='AVG_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'), inputAnnotation=TRUE, annotationColumn=c('ACCESSION', 'SYMBOL', 'PROBE_SEQUENCE', 'PROBE_START', 'CHROMOSOME', 'PROBE_CHR_ORIENTATION', 'PROBE_COORDINATES', 'DEFINITION'), verbose = TRUE, ...)lumiR(fileName, sep = NULL, detectionTh = 0.01, na.rm = TRUE, convertNuID = TRUE, lib.mapping = NULL, dec = '.', parseColumnName = FALSE, checkDupId = TRUE, QC = TRUE, columnNameGrepPattern = list(exprs='AVG_SIGNAL', se.exprs='BEAD_STD', detection='DETECTION', beadNum='Avg_NBEADS'), inputAnnotation=TRUE, annotationColumn=c('ACCESSION', 'SYMBOL', 'PROBE_SEQUENCE', 'PROBE_START', 'CHROMOSOME', 'PROBE_CHR_ORIENTATION', 'PROBE_COORDINATES', 'DEFINITION'), verbose = TRUE, ...)
fileName |
fileName of the data file |
sep |
the separation character used in the text file. |
detectionTh |
the p-value threshold of determining detectability of the expression. See more details in |
na.rm |
determine whether to remove NA |
convertNuID |
determine whether convert the probe identifier as nuID |
lib.mapping |
a Illumina ID mapping package, e.g, lumiHumanIDMapping, used by |
dec |
the character used in the file for decimal points. |
parseColumnName |
determine whether to parse the column names and retrieve the sample information (Assume the sample information is separated by "\_".) |
checkDupId |
determine whether to check duplicated TargetIDs or ProbeIds. The duplicated ones will be averaged. |
QC |
determine whether to do quality control assessment after read in the data. |
columnNameGrepPattern |
the string grep patterns used to determine the slot corresponding columns. |
inputAnnotation |
determine whether input the annotation information outputted by BeadStudio if exists. |
annotationColumn |
the column names of the annotation information outputted by BeadStudio |
verbose |
a boolean to decide whether to print out some messages |
... |
other parameters used by |
The function can automatically determine the separation character if it is Tab or comma. Otherwise, the user should specify the separator manually. If the annotation library is provided, the Illumina Id will be replaced with nuID, which is used as the index Id for the lumi annotation packages. If the annotation library is not provided, it will try to directly convert the probe sequence (if provided in the BeadStudio output file) as nuIDs.
The parameter "columnNameGrepPattern" is designed for some advanced users. It defines the string grep patterns used to determine the slot corresponding columns. For example, for the "exprs" slot in LumiBatch object, it is composed of the columns whose name includes "AVG\_SIGNAL". In some cases, the user may not want to read the "detection" and "beadNum" related columns to save memory. The user can set the "detection" and "beadNum" as NA in "columnNameGrepPattern". If the 'se.exprs' is set as NA or the corresponding columns are not available, then lumiR will create a ExpressionSet object instead of LumiBatch object.
The parameter "parseColumnName" is designed to parse the column names and retrieve the sample information. We assume the sample information is separated by "\_" and the last element after "\_" is the sample label (sample names of the LumiBatch object). If the parsed sample labels are not unique, then the entire string will be used as the sample label. For example: "1881436055\_A\_STA 27aR" is included in one of the column names of BeadStudio output file. Here, the program will first treat "STA 27aR" as the sample label. If it is not unique across the samples, "1881436055\_A\_STA 27aR" will be the sample label. If it is still not unique, the program will report warning messages. All the parsed information is kept in the phenoData slot. By default, "parseColumnName" is FALSE. We suggest the users use it only when they know what they are doing.
Current version of lumiR can adaptively read the output of BeadStudio Verson 1 and 3. The format Version 3 made quite a few changes comparing with previous versions. One change is the detection value. It was called detectable when the detection value is close to one for Version 1 format. However, the detection value became a p-value in the Version 3. As a result, the detectionTh is automatically changed based on the version. The detectionTh 0.01 for the Version 3 will be changed as the detectionTh 0.99 for Version 1. Another big change is that Version 3 separately output the control probe (gene) information and a "Samples Table". As a result, the controlData slot in LumiBatch class was added to keep the control probe (gene) information, and a QC slot to keep the quality control information, including the "Sample Table" output by BeadStudio version 3.
The recent version of BeadStudio can also output the annotation information together with the expression data. In the users also want to input the annotation information, they can set the parameter "inputAnnotation" as TRUE. At the same time, they can also specify which columns to be inputted by setting parameter "annotationColumn". The BeadStudio annotation columns include: SPECIES, TRANSCRIPT, ILMN\_GENE, UNIGENE\_ID, GI, ACCESSION, SYMBOL, PROBE\_ID, ARRAY\_ADDRESS\_ID, PROBE\_TYPE, PROBE\_START, PROBE\_SEQUENCE, CHROMOSOME, PROBE\_CHR\_ORIENTATION, PROBE\_COORDINATES, DEFINITION, ONTOLOGY\_COMPONENT, ONTOLOGY\_PROCESS, ONTOLOGY\_FUNCTION, SYNONYMS, OBSOLETE\_PROBE\_ID. As the annotation data is huge, by default, we only input: ACCESSION, SYMBOL, PROBE\_START, CHROMOSOME, PROBE\_CHR\_ORIENTATION, PROBE\_COORDINATES, DEFINITION. This annotation information is kept in the featureData slot of ExpressionSet, which can be retrieved using pData(featureData(x.lumi)), suppose x.lumi is the LumiBatch object. As some annotation information may be outdated. We recommend using Bioconductor annotation packages to retrieve the annotation information.
The BeadStudio may output either STDEV or STDERR (standard error of the mean) columns. As the variance stabilization (see vst function) requires the information of the standard deviation instead of the standard error of the mean, the value correction is required. The lumiR function will automatically check whether the BeadStudio output file includes STDEV or STDERR columns. If it is STDERR columns, it will correct STDERR as STDEV. The corrected value will be x * sqrt(N), where x is the STDERR value (standard error of the mean), N is the number of beads corresponding to the probe. (Thanks Sebastian Balbach and Gordon Smyth kindly provided this information.). This correction was previous implemented in the lumiT function.
return a LumiBatch object
Simon Lin, Pan Du
## specify the file name # fileName <- 'Barnes_gene_profile.txt' # Not Run ## load the data # x.lumi <- lumiR(fileName) ## load the data with empty detection and beadNum slots # x.lumi <- lumiR(fileName, columnNameGrepPattern=list(detection=NA, beadNum=NA))## specify the file name # fileName <- 'Barnes_gene_profile.txt' # Not Run ## load the data # x.lumi <- lumiR(fileName) ## load the data with empty detection and beadNum slots # x.lumi <- lumiR(fileName, columnNameGrepPattern=list(detection=NA, beadNum=NA))
Read BeadStudio output files in batch and combine them as a single LumiBatch object
lumiR.batch(fileList, convertNuID = TRUE, lib.mapping = NULL, detectionTh = 0.01, QC = TRUE, transform = c('none', 'vst', 'log2', 'cubicRoot'), sampleInfoFile = NULL, verbose = TRUE, ...)lumiR.batch(fileList, convertNuID = TRUE, lib.mapping = NULL, detectionTh = 0.01, QC = TRUE, transform = c('none', 'vst', 'log2', 'cubicRoot'), sampleInfoFile = NULL, verbose = TRUE, ...)
fileList |
a vector of file names or a directory keeping the data files in the format of .csv |
convertNuID |
determine whether convert the probe identifier as nuID |
lib.mapping |
same as |
detectionTh |
the p-value threshold of determining detectability of the expression. See more details in |
QC |
determine whether to do quality control assessment after read in the data. |
transform |
determine whether to do transform after input each file |
sampleInfoFile |
a Tab-separated text file or a data.frame keeping the sample information (optional) |
verbose |
a boolean to decide whether to print out some messages |
... |
other parameters used by |
The function basically call lumiR for individual files and then combine the returns. The sampleInfoFile parameter is optional. It provides the sample information (for phenoData slot in LumiBatch object), it is a Tab-separated text file. ID column is required. It represents sample ID, which is defined based on the column names of BeadStudio output file. For example, sample ID of column "1881436070\_A\_STA.AVG\_Signal" is "1881436070\_A\_STA". The sample ID column can also be found in the "Samples Table.txt" file output by BeadStudio. Another "Label" column (if provided) will be used as the sampleNames of LumiBatch object. All information of sampleInfoFile will be directly added in the phenoData slot in LumiBatch object.
To save memory space in the case of reading large data set, we can do transformation using lumiT function right after input the data, and the information like se.exprs, beadNum will be removed from the LumiBatch object after transformation.
A LumiBatch object which combines the individual LumiBatch object corresponding to each file
Pan Du
## fileList <- c('file1.csv', 'file2.cvs') ## x.lumi <- lumiR.batch(fileList, sampleInfoFile='sampleInfo.txt')## fileList <- c('file1.csv', 'file2.cvs') ## x.lumi <- lumiR.batch(fileList, sampleInfoFile='sampleInfo.txt')
Transfer the Illumina data to stabilize the variance.
lumiT(x.lumi, method = c("vst", 'log2', 'cubicRoot'), ifPlot = FALSE, simpleOutput = TRUE, verbose = TRUE, ...)lumiT(x.lumi, method = c("vst", 'log2', 'cubicRoot'), ifPlot = FALSE, simpleOutput = TRUE, verbose = TRUE, ...)
x.lumi |
LumiBatch object |
method |
four methods are supported: "vst", "log2", "cubicRoot" |
ifPlot |
determine whether to plot the intermediate results |
simpleOutput |
determine whether to simplify the output LumiBatch object, which will set the se.exprs, detection and beadNum slots as NULL. |
verbose |
a boolean to decide whether to print out some messages |
... |
other parameters used by |
lumiT is an interface of difference variance stabilizing transformation. See vst for details of VST (Variance Stabilizing Transform) of Illumina data.
NOTE: This correction of STDERR as STDEV was moved to the lumiR function.
Return a LumiBatch object with transformed expression values. It also includes the VST transform function and its parameters as attributes: "transformFun", "parameter". See inverseVST for details.
Pan Du, Simon Lin
Lin, S.M., Du, P., Kibbe, W.A., (2008) 'Model-based Variance-stabilizing Transformation for Illumina Microarray Data', Nucleic Acids Res. 36, e11
## load example data data(example.lumi) ## Do default VST variance stabilizing transform lumi.T <- lumiT(example.lumi, ifPlot=TRUE)## load example data data(example.lumi) ## Do default VST variance stabilizing transform lumi.T <- lumiT(example.lumi, ifPlot=TRUE)
Convert methylation M-value to Beta-value
m2beta(m)m2beta(m)
m |
a matrix or vector of methylation M-value |
Convert methylation M-value to Beta-value
return methylation Beta-value with the same size of input M-value
Pan Du
Du, P., Zhang, X, Huang, C.C., Jafari, N., Kibbe, W.A., Hou, L., and Lin, S.M., (2010) 'Comparison of Beta-value and M-value methods for quantifying methylation levels by microarray analysis', (under review)
See Also as beta2m
Creating pairwise MAplot of sample intensities in a ExpressionSet object
## S4 method for signature 'ExpressionSet' MAplot(object, ..., smoothScatter = FALSE, logMode = TRUE, subset = 5000, main = NULL)## S4 method for signature 'ExpressionSet' MAplot(object, ..., smoothScatter = FALSE, logMode = TRUE, subset = 5000, main = NULL)
object |
an |
... |
optional arguments to |
smoothScatter |
whether use |
logMode |
whether plot the data in log2 scale or not |
subset |
subset of rows used to plot. It can be an index vector, or the length of a random subset |
main |
title of the plot |
To increase the plot efficiency, by default, we only plot RANDOMLY selected subset of points (based on parameter "subset"). If users want to plot all the points, they can set the parameter "subset = NULL". When smoothScatter is set as TRUE, the subsetting will be suppressed because smoothScatter function has good plot efficiency for large number of points.
## load example data data(example.lumi) MAplot(example.lumi) MAplot(example.lumi, smoothScatter=TRUE)## load example data data(example.lumi) MAplot(example.lumi) MAplot(example.lumi, smoothScatter=TRUE)
Estimated methylation call based on the fitting results of gammaFitEM
methylationCall(x, threshold = 0.95, ...)methylationCall(x, threshold = 0.95, ...)
x |
a vector of M-values covering the whole genome or a "gammaFit" class object returned by |
threshold |
the probability threshold to make a methylation call. The threshold can be a vector of two: unmethylation threshold and methylation threshold |
... |
other parameters used by |
Retrieve the probability element returned by gammaFitEM, and convert it as three status calls based on probability threshold
NOTE: the methylation status modeling algorithm was developed based on 27K methylation array. It has not been tested for 450K array. Considering 450K array covers both promoter and gene body, the two component Gamma mixture model assumption may not be valid any more.
A vector of three methylation status: "Unmethy" (unmethylation posterior probability > unmethylation threshold), "Methy" (methylation posterior probability > methylation threshold), or "Margin". The sum of unmethylation posterior probability and methylation posterior probability equals one. The methylation probability is returned as an attribute of "probability".
Pan DU
data(example.lumiMethy) M <- exprs(example.lumiMethy) fittedGamma <- gammaFitEM(M[,1], initialFit=NULL, maxIteration=50, tol=0.0001, plotMode=TRUE, verbose=FALSE) methyCall <- methylationCall(fittedGamma) table(methyCall)data(example.lumiMethy) M <- exprs(example.lumiMethy) fittedGamma <- gammaFitEM(M[,1], initialFit=NULL, maxIteration=50, tol=0.0001, plotMode=TRUE, verbose=FALSE) methyCall <- methylationCall(fittedGamma) table(methyCall)
Fit the monotonic-constraint spline curve
monoSmu(x, y, newX = NULL, nSupport = min(200, length(x)), nKnots = 6, rotate = FALSE, ifPlot = FALSE, xlab = 'x', ylab = 'y', ...)monoSmu(x, y, newX = NULL, nSupport = min(200, length(x)), nKnots = 6, rotate = FALSE, ifPlot = FALSE, xlab = 'x', ylab = 'y', ...)
x |
a vector represents x values |
y |
a vector represents y values |
newX |
the new values to be transformed. If not provided, "x" will be used. |
nSupport |
downsampled data points |
nKnots |
parameter used by |
rotate |
determine whether to rotate the axis with 45 degrees in clockwise, i.e., fit the curve in the MA-plot. |
ifPlot |
determine whether to plot intermediate results |
xlab |
the xlab of the plot |
ylab |
the ylab of the plot |
... |
function called by lumiN.rsn. The function first fits a monotonic spline between vector x and y, then transforms the vector newX based on the fitted spline. (After transformation the fitted spline is supposed to be a diagonal line, i.e., x=y)
Return the transformed "newX" based on the smoothed curve
Simon Lin, Pan Du
Lin, S.M., Du, P., Kibbe, W.A., (2008) 'Model-based Variance-stabilizing Transformation for Illumina Microarray Data', Nucleic Acids Res. 36, e11
Fitting a curve with monotonic spline
monoSpline(x, y, newX=NULL, nKnots = 6, ifPlot = FALSE)monoSpline(x, y, newX=NULL, nKnots = 6, ifPlot = FALSE)
x |
a vector represents x values |
y |
a vector represents y values |
newX |
the new values to be transformed. If not provided, "x" will be used. |
nKnots |
parameter used by function smoothCon in package mgcv |
ifPlot |
determine whether to plot intermediate results |
Function internally called by monoSmu
return the transformed "newX" based on the smoothed curve
Simon Lin, Pan Du
Quantile normalization of Illumina Infinium methylation data at probe level. Input data is a MethyLumiM object
normalizeMethylation.quantile(methyLumiM, separateColor = FALSE, reference = NULL, ...)normalizeMethylation.quantile(methyLumiM, separateColor = FALSE, reference = NULL, ...)
methyLumiM |
a MethyLumiM object includes Illumina Infinium methylation data |
separateColor |
determine whether separately normalize two color channels |
reference |
the reference vector (same length as the number of matrix rows) for quanitle normalization |
... |
other parameters used by normalize.quantiles.robust method |
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after background level adjustment.
Pan DU
See Also lumiMethyN, and normalizeMethylation.ssn
data(example.lumiMethy) lumiMethy.norm = normalizeMethylation.quantile(example.lumiMethy)data(example.lumiMethy) lumiMethy.norm = normalizeMethylation.quantile(example.lumiMethy)
Shift and scaling normalization of Illumina Infinium methylation data at probe level
normalizeMethylation.ssn(methyLumiM, separateColor = FALSE)normalizeMethylation.ssn(methyLumiM, separateColor = FALSE)
methyLumiM |
a MethyLumiM object includes Illumina Infinium methylation data |
separateColor |
determine whether separately normalize two color channels |
Return an object (same class as input methyLumiM) with updated "methylated" and "unmethylated" data matrix after background level adjustment.
Pan DU
See Also lumiMethyN, and normalizeMethylation.quantile
data(example.lumiMethy) lumiMethy.norm = normalizeMethylation.ssn(example.lumiMethy)data(example.lumiMethy) lumiMethy.norm = normalizeMethylation.ssn(example.lumiMethy)
Map nuID to EntrezID through RefSeq ID based on IDMapping libraries.
nuID2EntrezID(nuID = NULL, lib.mapping, filterTh = c(Strength1 = 95, Uniqueness = 95), returnAllInfo = FALSE)nuID2EntrezID(nuID = NULL, lib.mapping, filterTh = c(Strength1 = 95, Uniqueness = 95), returnAllInfo = FALSE)
nuID |
a vector of nuIDs. If it is NULL, all mappings will be returned. |
lib.mapping |
the ID mapping library |
filterTh |
the mapping quality filtering threshold used to filter the ID mapping. |
returnAllInfo |
determine to return the detailed mapping information or just the matched RefSeq IDs |
This function is based on the return of getNuIDMappingInfo function. The mapping from nuID to EntrezID was based on the mapping from nuID to RefSeqID and RefSeqID to EntrezID. It uses mapping quality information to filter out the bad mappings from nuID to RefSeqID. The parameter "filterTh" is obsolete for lumi ID mapping package > version 1.3, which only keeps the perfect mapping. For the old version of ID mapping package (< 1.3), the names of "filterTh" are basically the field names of "nuID\_MappingInfo" table, which include 'Strength1', 'Strength2', 'Uniqueness' and 'Total hits'. For the definition of these metrics, please refer to the IDMapping library or see the reference website.
returns the matched Entrez IDs or a data.frame with each row corresponding to an input nuID (when "returnAllInfo" is TRUE).
Warren Kibbe, Pan Du, Simon Lin
https://prod.bioinformatics.northwestern.edu/nuID/
See Also getNuIDMappingInfo
## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { nuIDs <- featureNames(example.lumi) mappingInfo <- nuID2EntrezID(nuIDs, lib.mapping='lumiHumanIDMapping') head(mappingInfo) }## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { nuIDs <- featureNames(example.lumi) mappingInfo <- nuID2EntrezID(nuIDs, lib.mapping='lumiHumanIDMapping') head(mappingInfo) }
Matching nuIDs to Illumina IDs based on Illumina ID mapping library
nuID2IlluminaID(nuID, lib.mapping=NULL, species = c("Human", "Mouse", "Rat", "Unknown"), idType=c('All', 'Probe', 'Gene', 'Accession', 'Search_key', 'Symbol'), chipVersion = NULL, ...)nuID2IlluminaID(nuID, lib.mapping=NULL, species = c("Human", "Mouse", "Rat", "Unknown"), idType=c('All', 'Probe', 'Gene', 'Accession', 'Search_key', 'Symbol'), chipVersion = NULL, ...)
nuID |
a vector of nuIDs |
lib.mapping |
the ID mapping library. If it is provided, the parameter "species" will be ignored. |
species |
the species of the chip designed for. If users do not know it, it can be set as "Unknown". |
idType |
the Illumina ID type |
chipVersion |
chipVersion information returned by function |
... |
other parameters of |
The parameter "idType" represents different types of Illumina IDs. It returns the entire table when idType = "All". When idType = 'Probe', it returns "ProbeId" or "Probe\_Id". When idType = 'Gene', it returns "Target" or "ILMN\_Gene" IDs.
This function basically returned the "idMapping" item returned by function getChipInfo.
If nuID is NULL and chipVersion is provided, it will return all mapping information of the chip.
The mapping information from nuID to Illumina ID. It will be a matrix with each column corresponding to one matched manifest file when parameter "returnAllMatches" is TRUE. In this case, the columns are sorted from the best match to worst.
Pan Du
## load example data data(example.lumi) nuIDs <- featureNames(example.lumi) if (require(lumiHumanIDMapping)) { illuminaID <- nuID2IlluminaID(nuIDs[1:5], lib='lumiHumanIDMapping') illuminaID }## load example data data(example.lumi) nuIDs <- featureNames(example.lumi) if (require(lumiHumanIDMapping)) { illuminaID <- nuID2IlluminaID(nuIDs[1:5], lib='lumiHumanIDMapping') illuminaID }
Mapping nuID into Illumina ProbeID.
nuID2probeID(nuID, lib.mapping = "lumiHumanIDMapping", ...)nuID2probeID(nuID, lib.mapping = "lumiHumanIDMapping", ...)
nuID |
a vector of nuID |
lib.mapping |
an Illumina ID mapping library |
... |
other parameters of |
The function will call nuID2IlluminaID when ID mapping library were provided.
see function nuID2IlluminaID
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
if (require(lumiHumanIDMapping)) { nuID2probeID("B2J6WGhV.RevOJYff4", lib.mapping = "lumiHumanIDMapping") }if (require(lumiHumanIDMapping)) { nuID2probeID("B2J6WGhV.RevOJYff4", lib.mapping = "lumiHumanIDMapping") }
Map nuID to RefSeq ID based on IDMapping libraries.
nuID2RefSeqID(nuID = NULL, lib.mapping, filterTh = c(Strength1 = 95, Uniqueness = 95), returnAllInfo = FALSE)nuID2RefSeqID(nuID = NULL, lib.mapping, filterTh = c(Strength1 = 95, Uniqueness = 95), returnAllInfo = FALSE)
nuID |
a vector of nuIDs. If it is NULL, all mappings will be returned. |
lib.mapping |
the ID mapping library |
filterTh |
the mapping quality filtering threshold used to filter the ID mapping. Obsolete for lumi ID mapping package > version 1.3! |
returnAllInfo |
determine to return the detailed mapping information or just the matched RefSeq IDs |
This function is based on the return of getNuIDMappingInfo function. It uses mapping quality information to filter out the bad mappings. The parameter "filterTh" is obsolete for lumi ID mapping package > version 1.3, which only keeps the perfect mapping. For the old version of ID mapping package (< 1.3), the names of "filterTh" are basically the field names of "nuID\_MappingInfo" table, which include 'Strength1', 'Strength2', 'Uniqueness' and 'Total hits'. For the definition of these metrics, please refer to the IDMapping library or see the reference website.
returns the matched RefSeq IDs or a data.frame with each row corresponding to an input nuID (when "returnAllInfo" is TRUE).
Warren Kibbe, Pan Du, Simon Lin
https://prod.bioinformatics.northwestern.edu/nuID/
See Also getNuIDMappingInfo
## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { nuIDs <- featureNames(example.lumi) mappingInfo <- nuID2RefSeqID(nuIDs, lib.mapping='lumiHumanIDMapping') head(mappingInfo) }## load example data data(example.lumi) if (require(lumiHumanIDMapping)) { nuIDs <- featureNames(example.lumi) mappingInfo <- nuID2RefSeqID(nuIDs, lib.mapping='lumiHumanIDMapping') head(mappingInfo) }
Mapping nuID into Illumina TargetID or GeneID.
nuID2targetID(nuID, lib.mapping = "lumiHumanIDMapping", ...)nuID2targetID(nuID, lib.mapping = "lumiHumanIDMapping", ...)
nuID |
a vector of nuID |
lib.mapping |
an Illumina ID mapping library |
... |
other parameters of |
The function will call nuID2IlluminaID when ID mapping library were provided.
see function nuID2IlluminaID
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
targetID2nuID, nuID2IlluminaID
if (require(lumiHumanIDMapping)) { nuID2targetID("B2J6WGhV.RevOJYff4", lib.mapping = "lumiHumanIDMapping") }if (require(lumiHumanIDMapping)) { nuID2targetID("B2J6WGhV.RevOJYff4", lib.mapping = "lumiHumanIDMapping") }
Creating pairs plot of sample intensities in an ExpressionSet object
## S4 method for signature 'ExpressionSet' pairs(x, ..., smoothScatter = FALSE, logMode = TRUE, subset = 5000, fold=2, dotColor=1, highlight = NULL, highlightColor = 2, main = NULL, checkTransform = TRUE)## S4 method for signature 'ExpressionSet' pairs(x, ..., smoothScatter = FALSE, logMode = TRUE, subset = 5000, fold=2, dotColor=1, highlight = NULL, highlightColor = 2, main = NULL, checkTransform = TRUE)
x |
a |
... |
optional arguments to |
smoothScatter |
whether use |
logMode |
whether plot the data in log2 scale |
subset |
subset of rows used to plot. It can be an index vector, or the length of a random subset |
fold |
The fold-change threshold used to estimate the number of probes having high fold-changes |
dotColor |
color of points in the scatter plot |
highlight |
the subset dots need to be highlighted |
highlightColor |
the color for those highlighted dots |
main |
title of the plot |
checkTransform |
whether to check the data is log2-transformed or not |
To increase the plot efficiency, by default, we only plot RANDOMLY selected subset of points (based on parameter "subset"). If users want to plot all the points, they can set the parameter "subset = NULL". When smoothScatter is set as TRUE, the subsetting will be suppressed because smoothScatter function has good plot efficiency for large number of points.
## load example data data(example.lumi) pairs(example.lumi) pairs(example.lumi, smoothScatter=TRUE)## load example data data(example.lumi) pairs(example.lumi) pairs(example.lumi, smoothScatter=TRUE)
Creating quality control plots of a ExpressionSet object
## S4 method for signature 'ExpressionSet,missing' plot(x, what = c("density", "boxplot", "pair", "MAplot", "sampleRelation", "outlier", "cv"), main, ...)## S4 method for signature 'ExpressionSet,missing' plot(x, what = c("density", "boxplot", "pair", "MAplot", "sampleRelation", "outlier", "cv"), main, ...)
x |
a ExpressionSet object returned by |
what |
one of the six kinds of QC plots |
main |
the title of the QC plot |
... |
additional parameters for the corresponding QC plots |
The parameter "what" of plot function controls the type of QC plots,
which includes:
density: the density plot of the chips, see hist-methods
boxplot: box plot of the chip intensities, see boxplot-methods
pair: the correlation among chips, plot as a hierarchical tree, see pairs-methods
MAplot: the MAplot between chips, see MAplot-methods
sampleRelation: plot the sample relations. See plotSampleRelation
outlier: detect the outliers based on the sample distance to the center. See
detectOutlier
cv: the density plot of the coefficients of variance of the chips. See estimateLumiCV
LumiBatch-class, hist-methods, boxplot-methods, MAplot-methods,
pairs-methods, plotSampleRelation, estimateLumiCV, detectOutlier
## load example data data(example.lumi) ## Quality control estimation lumi.Q <- lumiQ(example.lumi) ## summary summary(lumi.Q) ## plot the density plot(lumi.Q, what='density') ## plot the pairwise sample correlation plot(lumi.Q, what='pair') ## plot the pairwise MAplot plot(lumi.Q, what='MAplot') ## sample relations plot(lumi.Q, what='sampleRelation', method='mds', color=c('100US', '95US:5P', '100US', '95US:5P')) ## detect outlier based on the distance to the mean profile plot(lumi.Q, what='outlier') ## Density plot of coefficient of variance plot(lumi.Q, what='cv')## load example data data(example.lumi) ## Quality control estimation lumi.Q <- lumiQ(example.lumi) ## summary summary(lumi.Q) ## plot the density plot(lumi.Q, what='density') ## plot the pairwise sample correlation plot(lumi.Q, what='pair') ## plot the pairwise MAplot plot(lumi.Q, what='MAplot') ## sample relations plot(lumi.Q, what='sampleRelation', method='mds', color=c('100US', '95US:5P', '100US', '95US:5P')) ## detect outlier based on the distance to the mean profile plot(lumi.Q, what='outlier') ## Density plot of coefficient of variance plot(lumi.Q, what='cv')
plot the cumulative distribution function of a ExpressionSet object from high to low value or in reverse
plotCDF(x, reverse=TRUE, logMode=TRUE, xlab = NULL, ylab = "Cumulative density", col=1:dim(x)[2], lwd=1, xlim = NULL, index.highlight = NULL, color.highlight = 2, addLegend = TRUE, main="", ...)plotCDF(x, reverse=TRUE, logMode=TRUE, xlab = NULL, ylab = "Cumulative density", col=1:dim(x)[2], lwd=1, xlim = NULL, index.highlight = NULL, color.highlight = 2, addLegend = TRUE, main="", ...)
x |
a numeric or |
reverse |
determine whether plot the CDF from high to low value or not |
logMode |
determine whether the CDF plot is based on a log2 scale |
xlab |
xlab of the plotCDF plot |
ylab |
ylab of the plotCDF plot |
col |
line colors of the plotCDF plot |
lwd |
line width of plot function |
xlim |
parameter of the plot function |
index.highlight |
the column index of the highlighted plotCDF curve |
color.highlight |
color of highlighted plotCDF curve |
addLegend |
whether add legend to the plot or not |
main |
title for the plot |
... |
additional parameters for |
## load example data data(example.lumi) plotCDF(example.lumi)## load example data data(example.lumi) plotCDF(example.lumi)
Plot the color bias density plot of Illumina Infinium Methylation data in one dimension (comparing with 2D scatter plot)
plotColorBias1D(methyLumiM, channel = c("both", "unmethy", "methy", "sum"), colorMode=TRUE, removeGenderProbes = FALSE, logMode = TRUE, subset = NULL, ...)plotColorBias1D(methyLumiM, channel = c("both", "unmethy", "methy", "sum"), colorMode=TRUE, removeGenderProbes = FALSE, logMode = TRUE, subset = NULL, ...)
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
channel |
estimate the intensity in different methods |
colorMode |
whether separate two color channels or not |
removeGenderProbes |
determine whether exclude probes on X and Y chromosomes if the chromosome information is provided in the methyLumiM object. |
logMode |
Whether plot the intensities in log-scale |
subset |
plot subset of randomly selected rows. All data will be plotted if it is NULL. |
... |
Plot the color bias density plot of Illumina Infinium Methylation data. There are four options using "channel" parameter to plot the density plot. "both": estimate the density by pooling together methylated and unmethylated probe intensities. "unmethy" and "methy": plot either unmethylated or methylated probe density. "sum" plot the density of the sum of methylatled and unmethylated probe intensitys.
Invisibly return TRUE if plot successfully.
Pan DU
See Also as plotColorBias2D and boxplotColorBias
data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy)data(example.lumiMethy) # before adjustment plotColorBias1D(example.lumiMethy)
Plot the color bias (red and green channel) of Illumina Infinium Methylation data of one selected sample in two dimensions (methylated and unmethylated probe intensities)
plotColorBias2D(methyLumiM, selSample = 1, combineMode = F, layoutRatioWidth = c(0.75, 0.25), layoutRatioHeight = c(0.25, 0.75), margins = c(5, 5, 2, 2), cex = 1.25, logMode = TRUE, subset = NULL, ...)plotColorBias2D(methyLumiM, selSample = 1, combineMode = F, layoutRatioWidth = c(0.75, 0.25), layoutRatioHeight = c(0.25, 0.75), margins = c(5, 5, 2, 2), cex = 1.25, logMode = TRUE, subset = NULL, ...)
methyLumiM |
MethyLumiM-class object or eSet-class object, which include methylated and unmethylated probe intensities |
selSample |
The index of sample name of the selected sample to plot color bias |
combineMode |
Whether combine two color channels together and plot as one color |
layoutRatioWidth |
the plot figure ratio between scatter plot and density plot |
layoutRatioHeight |
the plot figure ratio between scatter plot and density plot |
margins |
margin of the plot |
cex |
A numerical value giving the amount by which plotting text and symbols should be magnified relative to the default. See |
logMode |
Whether plot the intensities in log-scale |
subset |
plot subset of randomly selected rows. All data will be plotted if it is NULL. |
... |
other parameters used by |
The function basically plots the probe intensities in 2-dimension (methylated vs unmethylated), and colors the dots in Red and Green based on their color channel information. The related density plot will also be plotted at the right and top of the scatter plot.
Invisibly return TRUE if plot successfully.
Pan DU
See Also as plotColorBias1D
data(example.lumiMethy) # plot in 2D plot of one selected sample plotColorBias2D(example.lumiMethy, selSample = 1)data(example.lumiMethy) # plot in 2D plot of one selected sample plotColorBias2D(example.lumiMethy, selSample = 1)
Plot the mean intensity (with standard deviation bar) of different type of control probes. Multiple control types can be plotted in a single plot. The available control types can be get by running getControlType(controlData).
plotControlData(controlData, type = NULL, slideIndex = NULL, logMode = FALSE, new = TRUE, ...)plotControlData(controlData, type = NULL, slideIndex = NULL, logMode = FALSE, new = TRUE, ...)
controlData |
a LumiBatch object including control data, a control data data.frame, a MethyLumiQC object or a MethyLumiM object including MethyLumiQC control data |
type |
the control probe type (case insensitive), which can be get by running getControlType(controlData) |
slideIndex |
the slide index or ID corresponding to each sample |
logMode |
whether show the data in log2 scale |
new |
whether refresh the new plot or add it on the old one |
... |
other parameters used by default plot function |
When multiple control types are selected, they will be plotted in a two-column plot. For methylation data, the red and green channels will be plotted respectively in red and green colors.
plot the picture and invisibly return TRUE if everything is OK
Pan Du
addControlData2lumi and addControlData2methyLumiM
controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { controlData <- getControlData(controlFile) getControlType(controlData) plotControlData(controlData, type='NEGATIVE') }controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { controlData <- getControlData(controlFile) getControlType(controlData) plotControlData(controlData, type='NEGATIVE') }
plot the density distribution of a dataMatrix or ExpressionSet object
plotDensity(dataMatrix, logMode=TRUE, addLegend=TRUE, legendPos="topright", subset = NULL, ...)plotDensity(dataMatrix, logMode=TRUE, addLegend=TRUE, legendPos="topright", subset = NULL, ...)
dataMatrix |
a data matrix or |
logMode |
determine whether the CDF plot is based on a log2 scale |
addLegend |
whether add legend to the plot or not |
legendPos |
the position of the legend. If its length is two, then it specifies the x and y location of legend. |
subset |
plot subset of randomly selected rows. All data will be plotted if it is NULL. |
... |
additional parameters for |
## load example data data(example.lumi) plotDensity(example.lumi)## load example data data(example.lumi) plotDensity(example.lumi)
gammaFitEM plot the fitting results of gammaFitEM. It basically plot the histogram of M-values plus the estimated gamma density plots and their mixture.
plotGammaFit(x, gammaFit = NULL, k = NULL, theta = NULL, shift = NULL, proportion = NULL, plotType = c("histogram", "density"), ...)plotGammaFit(x, gammaFit = NULL, k = NULL, theta = NULL, shift = NULL, proportion = NULL, plotType = c("histogram", "density"), ...)
x |
a vector of M-values covering the whole genome |
gammaFit |
a "gammaFit" class object returned by |
k |
parameter k of gamma distribution |
theta |
parameter theta of gamma distribution |
shift |
parameter shift of gamma distribution |
proportion |
the proportion of two components (gamma distributions) |
plotType |
determine the way to show the distribution of the input data, either histogram or density plot |
... |
Other parameters used by |
This function is to visualize the fitting results, which helps us understand how well the fitting is.
Invisibly return TRUE if the plot is successful.
Pan DU
data(example.lumiMethy) M <- exprs(example.lumiMethy) fittedGamma <- gammaFitEM(M[,1], initialFit=NULL, maxIteration=50, tol=0.0001, plotMode=FALSE, verbose=FALSE) plotGammaFit(M[,1], gammaFit=fittedGamma)data(example.lumiMethy) M <- exprs(example.lumiMethy) fittedGamma <- gammaFitEM(M[,1], initialFit=NULL, maxIteration=50, tol=0.0001, plotMode=FALSE, verbose=FALSE) plotGammaFit(M[,1], gammaFit=fittedGamma)
Plot the housekeeping gene expression profile
plotHousekeepingGene(controlData, lib = NULL, slideIndex = NULL, addLegend = TRUE, logMode = TRUE, ...)plotHousekeepingGene(controlData, lib = NULL, slideIndex = NULL, addLegend = TRUE, logMode = TRUE, ...)
controlData |
a LumiBatch object including control data or a control data data.frame |
lib |
the annotation library (for retrieving the gene name) |
slideIndex |
the slide index or ID corresponding to each sample |
addLegend |
whether add legend or not |
logMode |
whether show the data in log2 scale |
... |
other parameters used by default matplot function |
plot the picture and return TRUE if everything is OK
Pan Du
addControlData2lumi, plotControlData
controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { controlData <- getControlData(controlFile) plotHousekeepingGene(controlData) }controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { controlData <- getControlData(controlFile) plotHousekeepingGene(controlData) }
plot the sample relations based on MDS or hierarchical clustering
plotSampleRelation(x, subset = NULL, cv.Th = 0.1, standardize = TRUE, method = c("cluster", "mds"), dimension = c(1, 2), color = NULL, main = NULL, pch=NULL, addLegend=TRUE, ...)plotSampleRelation(x, subset = NULL, cv.Th = 0.1, standardize = TRUE, method = c("cluster", "mds"), dimension = c(1, 2), color = NULL, main = NULL, pch=NULL, addLegend=TRUE, ...)
x |
a LumiBatch object, ExpressionSet object or a matrix with each column corresponding to a sample |
subset |
the subset probes used to determine the sample relations. If it is one number, then randomly selected "number" of probes will be used. If not provide, all the probes will be used. |
cv.Th |
the threshold of the coefficient of variance of probes used to select probes to estimate sample relations |
standardize |
standardize the expression profiles or not |
method |
"MDS" or "hierarchical clustering" |
dimension |
the principle components to visualize the MDS plot |
color |
the color for each sample during plot. Only support the "mds" method |
main |
the title of the plot |
pch |
use symbols instead of text to label the samples |
addLegend |
Whether to add legend to MDS (two-dimensional PCA) plot |
... |
Other parameters used by plot function. |
Estimate the sample relations based on selected probes (based on large coefficient of variance (mean / standard variance)). Two methods can be used: MDS (Multi-Dimensional Scaling) or hierarchical clustering methods.
Invisibly return the hierarchical clustering results (if 'cluster' method used) or coordinates of the mds plot (if 'mds' method used) .
Pan Du
lumiQ, LumiBatch, , plot,ExpressionSet-method
## load example data data(example.lumi) ## plot the sample relations with MDS ## the color of sample is automatically set based on the sample type plotSampleRelation(example.lumi, col=c('100US', '95US:5P', '100US', '95US:5P')) ## plot the sample relations with hierarchical clustering plotSampleRelation(example.lumi, method='cluster')## load example data data(example.lumi) ## plot the sample relations with MDS ## the color of sample is automatically set based on the sample type plotSampleRelation(example.lumi, col=c('100US', '95US:5P', '100US', '95US:5P')) ## plot the sample relations with hierarchical clustering plotSampleRelation(example.lumi, method='cluster')
Plot the Stringency related control probe (Low-Stringency, Medium-Stringency and High-Stringency) profiles. Using getControlType function to view available stringency types.
plotStringencyGene(controlData, lib = NULL, slideIndex = NULL, addLegend = TRUE, logMode = TRUE, ...)plotStringencyGene(controlData, lib = NULL, slideIndex = NULL, addLegend = TRUE, logMode = TRUE, ...)
controlData |
a LumiBatch object including control data or a control data data.frame |
lib |
the annotation library (for retrieving the gene name) |
slideIndex |
the slide index or ID corresponding to each sample |
addLegend |
whether add legend or not |
logMode |
whether show the data in log2 scale |
... |
other parameters used by default matplot function |
plot the picture and return TRUE if everything is OK
Pan Du
addControlData2lumi, plotControlData
controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { controlData <- getControlData(controlFile) plotStringencyGene(controlData) }controlFile <- system.file('doc', 'Control_Probe_Profile.txt', package='lumi') if (file.exists(controlFile)) { controlData <- getControlData(controlFile) plotStringencyGene(controlData) }
plot the VST (Variance Stabilizing Transform) function of VST transformed LumiBatch object or parameters of VST function.
plotVST(x, transFun = NULL, plotRange = NULL, addLegend = TRUE, ...)plotVST(x, transFun = NULL, plotRange = NULL, addLegend = TRUE, ...)
x |
a LumiBatch object after lumiT transform, or a matrix or data.frame with VST parameter |
transFun |
a character vector of transformation function (asinh or log2) |
plotRange |
the plot range of untransformed data |
addLegend |
add legend or not |
... |
other parameter used by |
invisibly return the untransformed and transformed values.
Pan Du
## load example data data(example.lumi) ## Do default VST variance stabilizing transform lumi.T <- lumiT(example.lumi, ifPlot=TRUE) ## plot the transform function plotVST(lumi.T)## load example data data(example.lumi) ## Do default VST variance stabilizing transform lumi.T <- lumiT(example.lumi, ifPlot=TRUE) ## plot the transform function plotVST(lumi.T)
Mapping Illumina ProbeID as nuID.
probeID2nuID(probeID, lib.mapping = "lumiHumanIDMapping", ...)probeID2nuID(probeID, lib.mapping = "lumiHumanIDMapping", ...)
probeID |
a vector of Illumina ProbeID |
lib.mapping |
an Illumina ID mapping library |
... |
other parameters of |
The function will call IlluminaID2nuID when ID mapping library were provided.
see function IlluminaID2nuID
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
if (require(lumiHumanIDMapping)) { probeID2nuID('0001240020', lib='lumiHumanIDMapping') }if (require(lumiHumanIDMapping)) { probeID2nuID('0001240020', lib='lumiHumanIDMapping') }
Produce GEO Sample Submission File in SOFT format based on the provided LumiBatch object and Illumina ID Mapping library
produceGEOPlatformFile(x.lumi, lib.mapping = NULL, nuIDMode = TRUE, includeAllChipProbe=FALSE, fileName = "GEOPlatformFile.txt")produceGEOPlatformFile(x.lumi, lib.mapping = NULL, nuIDMode = TRUE, includeAllChipProbe=FALSE, fileName = "GEOPlatformFile.txt")
x.lumi |
The LumiBatch object keeping all probes |
lib.mapping |
The Illumina ID Mapping library, e.g., "lumiHumanIDMapping" |
nuIDMode |
Determine whether producing the platform indexed by nuID |
includeAllChipProbe |
Determine whether including all probes in the Manifest file or just the probes used in the x.lumi object |
fileName |
Filename of the GEO Platform File name |
The function produces the GEO platform submission file based on the chip information kept in the Illumina ID Mapping library (specified by lib.mapping parameter). The determination of chip type will be automatically done by selecting the best matching of the probe IDs with individual chips.
Save the result as a text file in SOFT platform submission format.
Pan Du
http://www.ncbi.nlm.nih.gov/projects/geo/info/soft2.html
# data(example.lumi) # produceGEOPlatformFile(example.lumi, lib.mapping='lumiHumanIDMapping')# data(example.lumi) # produceGEOPlatformFile(example.lumi, lib.mapping='lumiHumanIDMapping')
Produce the template of GEO sample information, which is used for function produceGEOSubmissionFile.
produceGEOSampleInfoTemplate(lumiNormalized, lib.mapping = NULL, fileName = "GEOsampleInfo.txt")produceGEOSampleInfoTemplate(lumiNormalized, lib.mapping = NULL, fileName = "GEOsampleInfo.txt")
lumiNormalized |
The normalized data (LumiBatch object) |
lib.mapping |
The Illumina ID Mapping library, e.g., "lumiHumanIDMapping" |
fileName |
The file name of Tab separated sample information file |
This function just produces a template of sample information with some default fillings. Users need to fill in the detailed sample descriptions, especially the Sample\_title, Sample\_description and some protocols. No blank fields are allowed. Function produceGEOSubmissionFile will produce the file GEO submission file based on this sample information. The users should not use "\#" in the description as it is a reserved character.
Save the result as a Tab separated text file or return a data.frame if the fileName is NULL.
Pan Du
http://www.ncbi.nlm.nih.gov/projects/geo/info/soft2.html
Produce GEO Sample Submission File in the SOFT format based on the provided LumiBatch object and sample information
produceGEOSubmissionFile(lumiNormalized, lumiRaw, lib.mapping = NULL, idType = 'Probe', sampleInfo = NULL, fileName = "GEOSubmissionFile.txt", supplementaryRdata = TRUE, ...)produceGEOSubmissionFile(lumiNormalized, lumiRaw, lib.mapping = NULL, idType = 'Probe', sampleInfo = NULL, fileName = "GEOSubmissionFile.txt", supplementaryRdata = TRUE, ...)
lumiNormalized |
The normalized data (LumiBatch object) |
lumiRaw |
The raw data (LumiBatch object), e.g., returned by |
lib.mapping |
The Illumina ID Mapping library, e.g., "lumiHumanIDMapping" |
idType |
the idType parameter of function |
sampleInfo |
The sample information filename or data.frame, which is returned by |
fileName |
The file name of GEO Submission file |
supplementaryRdata |
determine whether produce the Rdata supplement data, which include both lumiNormalized and lumiRaw R objects. |
... |
other parameters used by function |
The function produces the GEO sample submission file including both normalized and raw data information in the SOFT format. The sample information should be provided by the user as a data.frame or Tab separated text file following the format of the template, which can be produced by function produceGEOSampleInfoTemplate. Users need to fill in the detailed sample descriptions in the template, especially the Sample\_title, Sample\_description and some protocols. Users are also required to fill in the "Sample\_platform\_id" by checking information of the GEO Illumina platform.
When the parameter "supplementaryRdata" is TRUE, the R objects, lumiNormalized, lumiRaw and sampleInfo, will be saved in a file named 'supplementaryData.Rdata'.
Save the result as a text file in SOFT sample submission format. The supplementary Rdata will be saved in a file 'supplementaryData.Rdata'.
Pan Du
http://www.ncbi.nlm.nih.gov/projects/geo/info/soft2.html
produceGEOSampleInfoTemplate, produceGEOPlatformFile
## Not run ## Produce the sample information template # produceGEOSampleInfoTemplate(lumiNormalized, lib.mapping = NULL, fileName = "GEOsampleInfo.txt") ## After editing the 'GEOsampleInfo.txt' by filling in sample information # produceGEOSubmissionFile(lumiNormalized, lumiRaw, lib='lumiHumanIDMapping', sampleInfo='GEOsampleInfo.txt')## Not run ## Produce the sample information template # produceGEOSampleInfoTemplate(lumiNormalized, lib.mapping = NULL, fileName = "GEOsampleInfo.txt") ## After editing the 'GEOsampleInfo.txt' by filling in sample information # produceGEOSubmissionFile(lumiNormalized, lumiRaw, lib='lumiHumanIDMapping', sampleInfo='GEOsampleInfo.txt')
Produce GEO Sample Submission File in the SOFT format based on the provided MethyLumiM object and sample information
produceMethylationGEOSubmissionFile(methyLumiM, methyLumiM.raw = NULL, lib.mapping = NULL, idType = "Probe", sampleInfo = NULL, fileName = "GEOSubmissionFile.txt", supplementaryRdata = FALSE, ...)produceMethylationGEOSubmissionFile(methyLumiM, methyLumiM.raw = NULL, lib.mapping = NULL, idType = "Probe", sampleInfo = NULL, fileName = "GEOSubmissionFile.txt", supplementaryRdata = FALSE, ...)
methyLumiM |
The normalized data in MethyLumiM class |
methyLumiM.raw |
The raw data in MethyLumiM class |
lib.mapping |
Currently not used for Illumina methylation data |
idType |
Currently no other options for Illumina methylation data |
sampleInfo |
The sample information filename or data.frame, which is returned by |
fileName |
The file name of GEO Submission file |
supplementaryRdata |
determine whether produce the Rdata supplement data, which include both methyLumiM and methyLumiM.raw R objects. |
... |
other parameters used by function |
The function produces the GEO sample submission file including both normalized and raw data information in the SOFT format. The sample information should be provided by the user as a data.frame or Tab separated text file following the format of the template, which can be produced by function produceGEOSampleInfoTemplate. Users need to fill in the detailed sample descriptions in the template, especially the Sample\_title, Sample\_description and some protocols. Users are also required to fill in the "Sample\_platform\_id" by checking information of the GEO Illumina platform.
When the parameter "supplementaryRdata" is TRUE, the R objects, methyLumiM, methyLumiM.raw and sampleInfo, will be saved in a file named 'supplementaryData.Rdata'.
Save the result as a text file in SOFT sample submission format. The supplementary Rdata will be saved in a file 'supplementaryData.Rdata'.
Pan Du
http://www.ncbi.nlm.nih.gov/projects/geo/info/soft2.html
produceGEOSampleInfoTemplate, produceGEOPlatformFile
## Not run ## Produce the sample information template # produceGEOSampleInfoTemplate(methyLumiM, fileName = "GEOsampleInfo.txt") ## After editing the 'GEOsampleInfo.txt' by filling in sample information # produceMethylationGEOSubmissionFile(methyLumiM, methyLumiM.raw, sampleInfo='GEOsampleInfo.txt')## Not run ## Produce the sample information template # produceGEOSampleInfoTemplate(methyLumiM, fileName = "GEOsampleInfo.txt") ## After editing the 'GEOsampleInfo.txt' by filling in sample information # produceMethylationGEOSubmissionFile(methyLumiM, methyLumiM.raw, sampleInfo='GEOsampleInfo.txt')
This function basically adjusts the samples to the same background level and then optionally scales to the same foreground level.
rankinvariant(x.lumi, targetArray = NULL, rrc = .05, lowRank = seq(.5, .25, -.05), highRank = .9, minSize = .02, maxit=200)rankinvariant(x.lumi, targetArray = NULL, rrc = .05, lowRank = seq(.5, .25, -.05), highRank = .9, minSize = .02, maxit=200)
x.lumi |
an ExpressionSet inherited object or a data matrix with columns as samples and rows as genes |
targetArray |
A target chip is the model for other chips to normalize. It can be a column index, a vector or a LumiBatch object with one sample. |
rrc |
The relative rank change allowed for a gene to be selected as rank invariant |
lowRank |
A vector with, in decreasing order, the minimum ranks where candidate genes can be selected as rank invariant |
highRank |
The maximum rank where candidate genes can be selected as rank invariant |
minSize |
Fraction of genes required to be selected as rank invariant |
maxit |
Maximum number of iterations for |
Rank invariant normalization uses a set of genes that are rank invariant between a given sample and a target sample. The target sample can be predefined by setting the targetArray argument. If targetArray is NULL the average expression of all samples will be the target. Rank invariant genes are found for each sample seperately by calculation the relative rank change for each gene. Furthermore, only genes with ranks between the lowRank and highRank are considered. If the number of probes is less than minSize multiplies by the number of genes the next lowRank value tried. If no rank invariant set can be found an error is thrown.
The default settings of this function are the same as used Genomstudio (Illumina). The results produced by this method are similar, but not identical to Genomestudio.
Return an object with expression values normalized. The class of the return object is the same as the input object x.lumi.
Arno Velds (contact: a.velds (at) nki.nl)
Robust spline normalization (monotonic curves) between chips
rsn(x.lumi, targetArray = NULL, excludeFold = 2, span = 0.03, ifPlot = FALSE, ...)rsn(x.lumi, targetArray = NULL, excludeFold = 2, span = 0.03, ifPlot = FALSE, ...)
x.lumi |
an ExpressionSet inherited object or a data matrix with columns as samples and rows as genes |
targetArray |
A target chip is the model for other chips to normalize. It can be a column index, a vector or a LumiBatch object with one sample. |
excludeFold |
exclude the genes with fold change larger than "excludeFold" during fitting the curve in normalization |
span |
the span parameter used by |
ifPlot |
determine whether to plot intermediate results |
... |
other parameters used by |
The robust spline normalization (RSN) algorithm combines the features of quantile and loess normalization. It is designed to normalize the variance-stabilized data. The function will check whether the data is variance stabilized (vst or log2 transform), if not, it will automatically run lumiT before run rsn. For details of the algorithm, please see the reference.
The targetArray can be a column index, a vector or a LumiBatch object with one sample, which corresponds to an external sample to be normalized with. This is very useful for handling large data set or normalizing the data set with a common reference (targetArray).
Return an object with expression values normalized. The class of the return object is the same as the input object x.lumi.
If it is a LumiBatch object, it also includes the VST transform function and its parameters as attributes: "transformFun", "parameter". See inverseVST for details.
Pan Du, Simon Lin
The nuID (nucleotide universal identifier) is uniquely corresponding to probe sequence. The nuID is also self-identification and error checking
seq2id(seq)seq2id(seq)
seq |
a nucleotide sequence composed of A, C, G, T (U). |
The nuID is a exact mapping of nucleotide sequence based on Base64 encoding scheme. A character set A-Z, a-z, 0-9, "\_" and "." is used to represent to the base-64 numbers of 0-63. The first character of nuID is a checking code, which provide information of both the number of padded "A"s at the nucleotide sequence and error checking. Please refer to reference for more details.
A string represents nuID
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) id id2seq(id)seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG' id <- seq2id(seq) id id2seq(id)
Smooth quantile normalization with a reference sample
smoothQuantileNormalization(dataMatrix, ref = NULL, adjData=NULL, logMode = TRUE, bandwidth = NULL, degree = 1, verbose = FALSE, ...)smoothQuantileNormalization(dataMatrix, ref = NULL, adjData=NULL, logMode = TRUE, bandwidth = NULL, degree = 1, verbose = FALSE, ...)
dataMatrix |
a matrix of microarray intensity data |
ref |
a vector of reference sample intensity, which matches the dataMatrix |
adjData |
data to be adjusted based on the ref and dataMatrix distribution |
logMode |
whether perform the analysis in log2 scale |
bandwidth |
a parameter used by |
degree |
a parameter used by |
verbose |
whether print the processing sample names |
... |
other parameters used by |
a data matrix with intensity normalized.
Pan DU
See Also adjColorBias.quantile
This function basically adjusts the samples to the same background level and then optionally scales to the same foreground level.
ssn(x.lumi, targetArray = NULL, scaling = TRUE, bgMethod=c('density', 'mean', 'median', 'none'), fgMethod=c('mean', 'density', 'median'), ...)ssn(x.lumi, targetArray = NULL, scaling = TRUE, bgMethod=c('density', 'mean', 'median', 'none'), fgMethod=c('mean', 'density', 'median'), ...)
x.lumi |
an ExpressionSet inherited object or a data matrix with columns as samples and rows as genes |
targetArray |
A target chip is the model for other chips to normalize. It can be a column index, a vector or a LumiBatch object with one sample. |
scaling |
determine whether do scaling or just background shift |
bgMethod |
optional methods of determining the background level |
fgMethod |
optional methods of determining the foreground level |
... |
other parameters used by |
This function basically adjusts the samples to the same background level and then optionally scales to the same foreground level. The adjustment is based on the raw scale data (For the transformed data, it still estimates the parameters in the raw scale by inverse transformation.).
Comparing with other normalization methods, like quantile and curve-fitting methods, SSN is a more conservative method. The only assumption is that each sample has the same background levels and the same scale (if do scaling). There are three methods ('density', 'mean' and 'median') for background estimation. If bgMethod is 'none', then the background level will be set as 0, i.e., no background adjustment. For the 'density' bgMethod, it estimates the background based on the mode of probe intensities based on the assumption that the background level intensity is the most frequent value across all the probes in the chip. For the foreground level estimation, it also provides three methods ('mean', 'density', 'median'). For the 'density' fgMethod, it assumes the background probe levels are symmetrically distributed. Then we estimate the foreground levels by taking the intensity mean of all other probes except from the background probes. For the 'mean' and 'median' methods (for both bgMethod and fgMethod), it basically estimates the level based on the mean or median of all probes of the sample. If the fgMethod is the same as bgMethod (except 'density' method), no scaling will be performed.
Return an object with expression values normalized. The class of the return object is the same as the input object x.lumi.
Pan Du, Simon Lin
Mapping Illumina TargetID (GeneID) into nuID.
targetID2nuID(targetID, lib.mapping = "lumiHumanIDMapping", ...)targetID2nuID(targetID, lib.mapping = "lumiHumanIDMapping", ...)
targetID |
a vector of Illumina TargetID (GeneID) |
lib.mapping |
an Illumina ID mapping library |
... |
other parameters of |
The function will call IlluminaID2nuID when ID mapping library were provided.
see function IlluminaID2nuID
Pan Du
Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming schema of oligonucleotides for Illumina, Affymetrix, and other microarrays", Biology Direct 2007, 2:16 (31May2007).
nuID2targetID, IlluminaID2nuID
if (require(lumiHumanIDMapping)) { targetID2nuID('GI_21389350-S', lib='lumiHumanIDMapping') }if (require(lumiHumanIDMapping)) { targetID2nuID('GI_21389350-S', lib='lumiHumanIDMapping') }
Stabilizing the expression variance based on the bead level expression variance and mean relations
vst(u, std, nSupport = min(length(u), 500), backgroundStd=NULL, fitMethod = c('linear', 'quadratic'), lowCutoff = 1/3, ifPlot = FALSE)vst(u, std, nSupport = min(length(u), 500), backgroundStd=NULL, fitMethod = c('linear', 'quadratic'), lowCutoff = 1/3, ifPlot = FALSE)
u |
mean expression of the beads with same sequence |
std |
expression standard deviation of the beads with same sequence |
nSupport |
the number of down-sampling to speed processing |
backgroundStd |
pre-estimated background standard deviation level |
fitMethod |
methods of fitting the relations between expression variance and mean relations |
lowCutoff |
cutoff ratio to determine the low expression range. Do not change this until you now what you are doing. |
ifPlot |
plot intermediate results or not |
The variance-stabilizing transformation (VST) takes the advantage of larger number of technical replicates available on the Illumina microarray. It models the mean-variance relationship of the within-array technical replicates at the bead level of Illumina microarray. An arcsinh transform is then applied to stabilize the variance. See reference for more details.
For the methods of fitting the relations between expression variance and mean relations, the 'linear' method is more robust and provides detailed parameters for inverseVST.
Return the transformed (variance stabilized) expression values.
Pan Du, Simon Lin
Lin, S.M., Du, P., Kibbe, W.A., "Model-based Variance-stabilizing Transformation for Illumina Mi-croarray Data", submitted
## load example data data(example.lumi) ## get the gene expression mean for one chip u <- exprs(example.lumi)[,1] ## get the gene standard deviation for one chip std <- se.exprs(example.lumi)[,1] ## do variance stabilizing transform transformedU <- vst(u, std) ## do variance stabilizing transform with plotting intermediate result transformedU <- vst(u, std, ifPlot=TRUE)## load example data data(example.lumi) ## get the gene expression mean for one chip u <- exprs(example.lumi)[,1] ## get the gene standard deviation for one chip std <- se.exprs(example.lumi)[,1] ## do variance stabilizing transform transformedU <- vst(u, std) ## do variance stabilizing transform with plotting intermediate result transformedU <- vst(u, std, ifPlot=TRUE)