| Title: | Comprehensive design of CRISPR gRNAs for nucleases and base editors |
|---|---|
| Description: | Provides a comprehensive suite of functions to design and annotate CRISPR guide RNA (gRNAs) sequences. This includes on- and off-target search, on-target efficiency scoring, off-target scoring, full gene and TSS contextual annotations, and SNP annotation (human only). It currently support five types of CRISPR modalities (modes of perturbations): CRISPR knockout, CRISPR activation, CRISPR inhibition, CRISPR base editing, and CRISPR knockdown. All types of CRISPR nucleases are supported, including DNA- and RNA-target nucleases such as Cas9, Cas12a, and Cas13d. All types of base editors are also supported. gRNA design can be performed on reference genomes, transcriptomes, and custom DNA and RNA sequences. Both unpaired and paired gRNA designs are enabled. |
| Authors: | Jean-Philippe Fortin [aut, cre], Luke Hoberecht [aut] |
| Maintainer: | Jean-Philippe Fortin <[email protected]> |
| License: | MIT + file LICENSE |
| Version: | 1.15.7 |
| Built: | 2026-07-10 21:53:12 UTC |
| Source: | https://github.com/bioc/crisprDesign |
Add on-target composite score to a GuideSet object.
addCompositeScores(object, ...) ## S4 method for signature 'GuideSet' addCompositeScores( object, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "casrxrf", "crisprater", "crisprscan"), scoreName = "score_composite" ) ## S4 method for signature 'PairedGuideSet' addCompositeScores( object, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "crisprater", "crisprscan", "casrxrf"), scoreName = "score_composite" ) ## S4 method for signature 'NULL' addCompositeScores(object)addCompositeScores(object, ...) ## S4 method for signature 'GuideSet' addCompositeScores( object, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "casrxrf", "crisprater", "crisprscan"), scoreName = "score_composite" ) ## S4 method for signature 'PairedGuideSet' addCompositeScores( object, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "crisprater", "crisprscan", "casrxrf"), scoreName = "score_composite" ) ## S4 method for signature 'NULL' addCompositeScores(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
methods |
Character vector specifying method names for on-target
efficiency prediction algorithms to be used to create the composite
score. Note that the specified scores must be added first to the
object using |
scoreName |
String specifying the name of the composite score to be used as a columm name. Users can choose whatever they like. Default is "score_composite". |
The function creates a composite score across a specified list of on-target scores by first transforming each individual score into a rank, and then taking the average rank across all specified methods. This can improve on-target activity prediction robustness. A higher score indicates higher on-target activity.
guideSet with column specified by scoreName
appended in mcols(guideSet).
Jean-Philippe Fortin
addOnTargetScores to add on-target scores.
gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA") gs <- addOnTargetScores(gs, methods=c("ruleset1", "crisprater")) gs <- addCompositeScores(gs, methods=c("ruleset1", "crisprater"))gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA") gs <- addOnTargetScores(gs, methods=c("ruleset1", "crisprater")) gs <- addCompositeScores(gs, methods=c("ruleset1", "crisprater"))
Add on-target composite score to a GuideSet object.
addConservationScores(object, ...) ## S4 method for signature 'GuideSet' addConservationScores( object, conservationFile, nucExtension = 9, fun = c("mean", "max"), scoreName = "score_conservation" ) ## S4 method for signature 'PairedGuideSet' addConservationScores( object, conservationFile, nucExtension = 9, fun = c("mean", "max"), scoreName = "score_conservation" ) ## S4 method for signature 'NULL' addConservationScores(object)addConservationScores(object, ...) ## S4 method for signature 'GuideSet' addConservationScores( object, conservationFile, nucExtension = 9, fun = c("mean", "max"), scoreName = "score_conservation" ) ## S4 method for signature 'PairedGuideSet' addConservationScores( object, conservationFile, nucExtension = 9, fun = c("mean", "max"), scoreName = "score_conservation" ) ## S4 method for signature 'NULL' addConservationScores(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
conservationFile |
String specifing the BigWig file containing conservation scores. |
nucExtension |
Number of nucleotides to include on each side of the cut site to calculate the conservation score. 9 by default. The region will have (2*nucExtension + 1) nucleotides in total. |
fun |
String specifying the function to use to calculate the final conservation score in the targeted region. Must be either "mean" (default) or "max". |
scoreName |
String specifying the name of the conservation score to be used as a columm name. Users can choose whatever they like. Default is "score_conservation". |
The function creates a conservation score for each gRNA by using the max, or average, conservation score in the genomic region where the cut occurs. A BigWig file storing conservation stores must be provided. Such files can be downloaded from the UCSC genome browser. See vignette for more information.
guideSet with column specified by scoreName
appended in mcols(guideSet).
Jean-Philippe Fortin
Add distance to TSS for a specificed TSS id.
addDistanceToTss(object, ...) ## S4 method for signature 'GuideSet' addDistanceToTss(object, tss_id) ## S4 method for signature 'PairedGuideSet' addDistanceToTss(object, tss_id)addDistanceToTss(object, ...) ## S4 method for signature 'GuideSet' addDistanceToTss(object, tss_id) ## S4 method for signature 'PairedGuideSet' addDistanceToTss(object, tss_id)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
tss_id |
String specifiying TSS id to calculate the distance.
The column |
A A GuideSet object or a
PairedGuideSet object with an additional
metadata column called distance_to_tss reporting
the distance (in nucleotides) between the TSS position
of the TSS specified by tss_id and the protospacer
position. The pam_site coordinate is used as the representative
position of protospacer sequences.
Note that a TSS annotation must be available in the object.
A TSS annotation can be added using addTssAnnotation.
Jean-Philippe Fortin
addTssAnnotation to add TSS annotation.
data(guideSetExampleFullAnnotation) tss_id <- "ENSG00000120645_P1" gs <- guideSetExampleFullAnnotation gs <- addDistanceToTss(gs, tss_id)data(guideSetExampleFullAnnotation) tss_id <- "ENSG00000120645_P1" gs <- guideSetExampleFullAnnotation gs <- addDistanceToTss(gs, tss_id)
To add edited alleles for a CRISPR base editing GuideSet.
addEditedAlleles( guideSet, baseEditor, editingWindow = NULL, substitutions = NULL, nMaxAlleles = 100, minEditingWeight = 0, minMutationScore = 0.3, addFunctionalConsequence = TRUE, addSummary = TRUE, txTable = NULL, verbose = TRUE, BPPARAM = MulticoreParam() )addEditedAlleles( guideSet, baseEditor, editingWindow = NULL, substitutions = NULL, nMaxAlleles = 100, minEditingWeight = 0, minMutationScore = 0.3, addFunctionalConsequence = TRUE, addSummary = TRUE, txTable = NULL, verbose = TRUE, BPPARAM = MulticoreParam() )
guideSet |
A GuideSet object. |
baseEditor |
A BaseEditor object. |
editingWindow |
A numeric vector of length 2 specifying
start and end positions of the editing window with
respect to the PAM site. If |
substitutions |
A character vector indicating the substitutions to be considered in predicting the edited alleles. If NULL (default), all substitutions are considered. |
nMaxAlleles |
Maximum number of edited alleles to report for each gRNA. Alleles from high to low scores. 100 by default. |
minEditingWeight |
Numeric value indicating the minimum editing weight required for an edited allele to be listed. Default of 0. |
minMutationScore |
Numeric value indicating the minimum editing score that an allele must have to call a mutation. Default of "0.3". |
addFunctionalConsequence |
Should variant classification
of the edited alleles be added? TRUE by default.
If |
addSummary |
Should a summary of the variant classification
be added to the metadata columns of the |
txTable |
Table of transcript-level nucleotide and amino
acid information needed for variant classification.
Usually returned by |
verbose |
Should messages be printed to console? TRUE by default. |
BPPARAM |
A BiocParallelParam object specifying the parallel back-end to use for computation. See the BiocParallel package for available back-ends (e.g., SerialParam(), MulticoreParam(), SnowParam()). The default is MulticoreParam. |
The original guideSet object with an additional
metadata column (editedAlleles) storing the annotated
edited alelles. The edited alleles are always reported
from 5' to 3' direction on the strand corresponding to the
gRNA strand.
Jean-Philippe Fortin
data(BE4max, package="crisprBase") data(grListExample, package="crisprDesign") library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 gr <- queryTxObject(grListExample, featureType="cds", queryColumn="gene_symbol", queryValue="IQSEC3") gs <- findSpacers(gr[1], crisprNuclease=BE4max, bsgenome=bsgenome) gs <- unique(gs) gs <- gs[1:2] # For the sake of time # Getting transcript info: txid="ENST00000538872" txTable <- getTxInfoDataFrame(tx_id=txid, txObject=grListExample, bsgenome=bsgenome) #Adding alelles: editingWindow <- c(-20,-8) gs <- addEditedAlleles(gs, baseEditor=BE4max, txTable=txTable, editingWindow=editingWindow, substitutions="C2T")data(BE4max, package="crisprBase") data(grListExample, package="crisprDesign") library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 gr <- queryTxObject(grListExample, featureType="cds", queryColumn="gene_symbol", queryValue="IQSEC3") gs <- findSpacers(gr[1], crisprNuclease=BE4max, bsgenome=bsgenome) gs <- unique(gs) gs <- gs[1:2] # For the sake of time # Getting transcript info: txid="ENST00000538872" txTable <- getTxInfoDataFrame(tx_id=txid, txObject=grListExample, bsgenome=bsgenome) #Adding alelles: editingWindow <- c(-20,-8) gs <- addEditedAlleles(gs, baseEditor=BE4max, txTable=txTable, editingWindow=editingWindow, substitutions="C2T")
Add optimal editing site for base editing gRNAs.
addEditingSites(object, ...) ## S4 method for signature 'GuideSet' addEditingSites(object, substitution) ## S4 method for signature 'PairedGuideSet' addEditingSites(object, substitution) ## S4 method for signature 'NULL' addEditingSites(object)addEditingSites(object, ...) ## S4 method for signature 'GuideSet' addEditingSites(object, substitution) ## S4 method for signature 'PairedGuideSet' addEditingSites(object, substitution) ## S4 method for signature 'NULL' addEditingSites(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
substitution |
String indicating which substitution should be used to estimate the optimal editing position. E.g. "C2T" will return the optimal editing position for C to T editing. |
An updated object with a colum editing_site added to
mcols(object).
Jean-Philippe Fortin
Add a gene-specific exon table to a GuideSet object.
Add a gene-specific exon table to a GuideSet object.
addExonTable( guideSet, gene_id, txObject, valueColumn = "percentCDS", useConsensusIsoform = FALSE )addExonTable( guideSet, gene_id, txObject, valueColumn = "percentCDS", useConsensusIsoform = FALSE )
guideSet |
A GuideSet object or a PairedGuideSet object. |
gene_id |
String specifying gene ID. |
txObject |
A TxDb object or a
GRangesList object obtained using
|
valueColumn |
String specifying column in
|
useConsensusIsoform |
Should a consensus isoform be used to
annotate exons? FALSE by default. If TRUE, the isoform constructed
by |
A GuideSet object with a "exonTable" DataFrame
stored in mcols(guideSet). The entries in the DataFrame
correspond to the values specified by valueColumn.
Rows correspond to gRNAs in the GuideSet, columns correspond to
all exons found in txObject for gene specified by
gene_id.
Jean-Philippe Fortin
addGeneAnnotation to add gene annotation and
addTxTable to add a transcript table.
if (interactive()){ data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addGeneAnnotation(guideSetExample, txObject=grListExample) guideSet <- addExonTable(guideSet, gene_id="ENSG00000120645", txObject=grListExample) guideSet$exonTable }if (interactive()){ data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addGeneAnnotation(guideSetExample, txObject=grListExample) guideSet <- addExonTable(guideSet, gene_id="ENSG00000120645", txObject=grListExample) guideSet$exonTable }
Add gene context annotation to spacer sequence stored in a GuideSet object
addGeneAnnotation(object, ...) ## S4 method for signature 'GuideSet' addGeneAnnotation( object, txObject, anchor = c("cut_site", "pam_site", "editing_site"), ignore_introns = TRUE, ignore.strand = TRUE, addPfam = FALSE, mart_dataset = NULL ) ## S4 method for signature 'PairedGuideSet' addGeneAnnotation( object, txObject, anchor = c("cut_site", "pam_site", "editing_site"), ignore_introns = TRUE, ignore.strand = TRUE, addPfam = FALSE, mart_dataset = NULL )addGeneAnnotation(object, ...) ## S4 method for signature 'GuideSet' addGeneAnnotation( object, txObject, anchor = c("cut_site", "pam_site", "editing_site"), ignore_introns = TRUE, ignore.strand = TRUE, addPfam = FALSE, mart_dataset = NULL ) ## S4 method for signature 'PairedGuideSet' addGeneAnnotation( object, txObject, anchor = c("cut_site", "pam_site", "editing_site"), ignore_introns = TRUE, ignore.strand = TRUE, addPfam = FALSE, mart_dataset = NULL )
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
txObject |
A TxDb object or a
GRangesList object obtained using
|
anchor |
String specifying which relative coordinate of gRNAs should be used to locate gRNAs within gene. Must be either "cut_site", "pam_site" or "editing_site". |
ignore_introns |
Should gene introns be ignored when annotating? TRUE by default. |
ignore.strand |
Should gene strand be ignored when annotating? TRUE by default. |
addPfam |
Should Pfam domains annotation be added? FALSE by default. If set to TRUE, biomaRt must be installed. |
mart_dataset |
String specifying dataset to be used by biomaRt for Pfam domains annotation . E.g. "hsapiens_gene_ensembl". |
For DNA-targeting nucleases, the different columns stored in
mcols(guideSet)[["geneAnnotation"]] are:
tx_id Transcript ID.
gene_symbol Gene symbol.
gene_id Gene ID.
protein_id Protein ID.
ID gRNA ID.
pam_site gRNA PAM site coordinate.
cut_site gRNA cut site coordinate.
chr gRNA chromosome name.
strand gRNA strand.
cut_cds Is the gRNA cut site located within the coding sequence
(CDS) of the targeted isoform?
cut_fiveUTRs Is the gRNA cut site located within the 5'UTR
of the targeted isoform?
cut_threeUTRs Is the gRNA cut site located within the 3'UTR
of the targeted isoform?
cut_introns Is the gRNA cut site located within an intron
of the targeted isoform?
percentCDS Numeric value to indicate the relative position of
the cut site with respect to the start of the CDS sequence when
cut_cds is TRUE. The relative position is expressed as
a percentage from the total length of the CDS.
percentTx Numeric value to indicate the relative position of
the cut site with respect to the start of the mRNA sequence
(therefore including 5' UTR). The relative position is expressed as a
percentage from the total length of the mRNA sequence.
aminoAcidIndex If cut_cds is TRUE, integer value
indicating the amino acid index with respect to the start of the protein.
downstreamATG Number of potential reinitiation sites
(ATG codons) downstream of the gRNA cut site, within 85 amino acids.
nIsoforms Numeric value indicating the number of isoforms
targeted by the gRNA.
totalIsoforms Numeric value indicating the total number of
isoforms existing for the gene targeted by the gRNA and specified
in gene_id.
percentIsoforms Numeric value indicating the percentage of
isoforms for the gene specified in gene_id targeted by the gRNA.
Equivalent to nIsoforms/totalIsoforms*100.
isCommonExon Logical value to indicate whether or not the gRNA
is targeing an exon common to all isoforms.
nCodingIsoforms Numeric value indicating the number of
coding isoforms targeted by the gRNA. 5' UTRs and 3' UTRs are excluded.
totalCodingIsoforms Numeric value indicating the total number of
coding isoforms existing for the gene targeted by the gRNA and specified
in gene_id.
percentCodingIsoforms Numeric value indicating the percentage
of coding isoforms for the gene specified in gene_id targeted
by the gRNA. Equivalent to
nCodingIsoforms/totalCodingIsoforms*100.
5' UTRs and 3' UTRs are excluded.
isCommonCodingExon Logical value to indicate whether or
not the gRNA is targeing an exon common to all coding isoforms.
A GuideSet object with a "geneAnnotation" list column
stored in mcols(guideSet). See details section for a
description of the different gene annotation columns.
Jean-Philippe Fortin, Luke Hoberecht
addTssAnnotation to add TSS annotation, and
geneAnnotation to retrieve an existing gene annotation.
data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addGeneAnnotation(guideSetExample[1:6], txObject=grListExample) # To access a gene annotation already added: ann <- geneAnnotation(guideSet)data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addGeneAnnotation(guideSetExample[1:6], txObject=grListExample) # To access a gene annotation already added: ann <- geneAnnotation(guideSet)
Add isoform-specific annotation to a GuideSet object.
addIsoformAnnotation(object, ...) ## S4 method for signature 'NULL' addDistanceToTss(object) ## S4 method for signature 'GuideSet' addIsoformAnnotation(object, tx_id) ## S4 method for signature 'PairedGuideSet' addIsoformAnnotation(object, tx_id) ## S4 method for signature 'NULL' addIsoformAnnotation(object)addIsoformAnnotation(object, ...) ## S4 method for signature 'NULL' addDistanceToTss(object) ## S4 method for signature 'GuideSet' addIsoformAnnotation(object, tx_id) ## S4 method for signature 'PairedGuideSet' addIsoformAnnotation(object, tx_id) ## S4 method for signature 'NULL' addIsoformAnnotation(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
tx_id |
String specifiying Ensembl ID for the isoform transcript of interested. E.g. "ENST00000311936". |
A A GuideSet object or a
PairedGuideSet object.with the
following added columns: percentCDS,
percentCodingIsoforms, and
isCommonCodingExon. The column values are
specific to the transcript specified by tx_id.
The percentCDS column indicates at what percentage
of the coding sequence the gRNA is cutting. The
column percentCodingIsoforms indicates the
percentage of coding isoforms that are targeted
by the gRNA. The column isCommonCodingExon
indicates whether or not the exon targetd by the
gRNA is common to all isoforms for the gene.
Jean-Philippe Fortin
data(guideSetExampleFullAnnotation) tx_id <- "ENST00000538872" gs <- guideSetExampleFullAnnotation gs <- addIsoformAnnotation(gs, tx_id)data(guideSetExampleFullAnnotation) tx_id <- "ENST00000538872" gs <- guideSetExampleFullAnnotation gs <- addIsoformAnnotation(gs, tx_id)
Add non-targeting control (NTC) sequences to a GuideSet object.
addNtcs(object, ...) ## S4 method for signature 'GuideSet' addNtcs(object, ntcs) ## S4 method for signature 'PairedGuideSet' addNtcs(object, ntcs) ## S4 method for signature 'NULL' addNtcs(object, ...)addNtcs(object, ...) ## S4 method for signature 'GuideSet' addNtcs(object, ntcs) ## S4 method for signature 'PairedGuideSet' addNtcs(object, ntcs) ## S4 method for signature 'NULL' addNtcs(object, ...)
object |
A GuideSet or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
ntcs |
A named character vector of NTC sequences. Sequences must
consist of appropriate DNA or RNA bases, and have the same spacer length
as spacers in |
NTC sequences are appended as spacers to the GuideSet
object. Each NTC sequence is assigned to its own "chromosome" in the
ntc genome, as reflected in the Seqinfo of the
resulting GuideSet object. As placeholder values, NTC
ranges are set to 0 and strands set to *.
All annotation for NTC spacers appended to object are set to
NA or empty list elements. To annotate NTC spacers, you must call
the appropriate function after adding NTCs to the GuideSet
object.
The original object with appended ntcs spacers.
Pre-existing annotation in object will be set to NA or
empty list elements for appended NTC spacers.
set.seed(1000) data(guideSetExample, package="crisprDesign") ntcs <- vapply(1:4, function(x){ seq <- sample(c("A", "C", "G", "T"), 20, replace=TRUE) paste0(seq, collapse="") }, FUN.VALUE=character(1)) names(ntcs) <- paste0("ntc_", 1:4) gs <- addNtcs(guideSetExample, ntcs) gsset.seed(1000) data(guideSetExample, package="crisprDesign") ntcs <- vapply(1:4, function(x){ seq <- sample(c("A", "C", "G", "T"), 20, replace=TRUE) paste0(seq, collapse="") }, FUN.VALUE=character(1)) names(ntcs) <- paste0("ntc_", 1:4) gs <- addNtcs(guideSetExample, ntcs) gs
Add CFD and MIT off-target scores to a GuideSet object. Both the CFD and MIT methods are available for the SpCas9 nuclease. The CFD method is also available for the CasRx nuclease. Other nucleases are currently not supported.
addOffTargetScores(object, ...) ## S4 method for signature 'GuideSet' addOffTargetScores(object, max_mm = 2, includeDistance = TRUE, offset = 0) ## S4 method for signature 'PairedGuideSet' addOffTargetScores(object, max_mm = 2, includeDistance = TRUE, offset = 0) ## S4 method for signature 'NULL' addOffTargetScores(object)addOffTargetScores(object, ...) ## S4 method for signature 'GuideSet' addOffTargetScores(object, max_mm = 2, includeDistance = TRUE, offset = 0) ## S4 method for signature 'PairedGuideSet' addOffTargetScores(object, max_mm = 2, includeDistance = TRUE, offset = 0) ## S4 method for signature 'NULL' addOffTargetScores(object)
object |
A GuideSet object or a
PairedGuideSet object.
|
... |
Additional arguments, currently ignored. |
max_mm |
The maximimum number of mismatches between the spacer sequence
and the protospacer off-target sequence to be considered in the
off-target score calculations. Off-targets with a number of
mismatches greater than |
includeDistance |
Should a distance penalty for the MIT score be included? TRUE by default. |
offset |
Numeric value specifying an offset to add to the denominator when calcuting the aggregated score (inverse summation formula). 0 by default. |
See the crisprScore package for a description of the different off-target scoring methods.
A GuideSet or a PairedGuideSet object with added
scores. The alignments annotation returned by alignments(object)
will have additional column storing off-target scores. Those scores
representing the off-target score for each gRNA and off-target pair.
For SpCas9, a column containing an aggregated specificity off-target
score for each scoring method is added to the metadata columns
obtained by mcols(object).
Jean-Philippe Fortin, Luke Hoberecht
link{addOnTargetScores} to add on-target scores.
data(guideSetExampleWithAlignments, package="crisprDesign") gs <- guideSetExampleWithAlignments gs <- addOffTargetScores(gs)data(guideSetExampleWithAlignments, package="crisprDesign") gs <- guideSetExampleWithAlignments gs <- addOffTargetScores(gs)
Add on-target scores to a GuideSet object for all methods available in the crisprScore package for a given CRISPR nuclease. Requires crisprScore package to be installed.
addOnTargetScores(object, ...) ## S4 method for signature 'GuideSet' addOnTargetScores( object, enzyme = c("WT", "ESP", "HF"), promoter = c("U6", "T7"), tracrRNA = c("Hsu2013", "Chen2013"), directRepeat = "aacccctaccaactggtcggggtttgaaac", binaries = NULL, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "casrxrf", "crisprater", "crisprscan"), condaEnv = NULL ) ## S4 method for signature 'PairedGuideSet' addOnTargetScores( object, enzyme = c("WT", "ESP", "HF"), promoter = c("U6", "T7"), tracrRNA = c("Hsu2013", "Chen2013"), directRepeat = "aacccctaccaactggtcggggtttgaaac", binaries = NULL, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "crisprater", "crisprscan", "casrxrf"), condaEnv = NULL ) ## S4 method for signature 'NULL' addOnTargetScores(object)addOnTargetScores(object, ...) ## S4 method for signature 'GuideSet' addOnTargetScores( object, enzyme = c("WT", "ESP", "HF"), promoter = c("U6", "T7"), tracrRNA = c("Hsu2013", "Chen2013"), directRepeat = "aacccctaccaactggtcggggtttgaaac", binaries = NULL, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "casrxrf", "crisprater", "crisprscan"), condaEnv = NULL ) ## S4 method for signature 'PairedGuideSet' addOnTargetScores( object, enzyme = c("WT", "ESP", "HF"), promoter = c("U6", "T7"), tracrRNA = c("Hsu2013", "Chen2013"), directRepeat = "aacccctaccaactggtcggggtttgaaac", binaries = NULL, methods = c("ruleset1", "ruleset3", "lindel", "deephf", "enpamgb", "crisprater", "crisprscan", "casrxrf"), condaEnv = NULL ) ## S4 method for signature 'NULL' addOnTargetScores(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
enzyme |
Character string specifying the Cas9 variant to be used for DeepHF scoring. Wildtype Cas9 (WT) by default. See details below. |
promoter |
Character string speciyfing promoter used for expressing sgRNAs for wildtype Cas9 (must be either "U6" or "T7") for DeepHF scoring. "U6" by default. |
tracrRNA |
String specifying which tracrRNA is used for SpCas9 Must be either "Hsu2013" (default) or "Chen2013". Only used for the RuleSet3 method. |
directRepeat |
String specifying the direct repeat used in the CasRx construct. |
binaries |
Named list of paths for binaries needed for CasRx-RF. Names of the list must be "RNAfold", "RNAhybrid", and "RNAplfold". Each list element is a string specifying the path of the binary. If NULL (default), binaries must be available on the PATH. |
methods |
Character vector specifying method names for on-target efficiency prediction algorithms. |
condaEnv |
String specifying the path of the conda environment needed to run the scoring calculations. See the crisprScore vignette for instructions on how to build the environment. |
See crisprScore package for a description of each score.
guideSet with columns of on-target scores appended in
mcols(guideSet).
Jean-Philippe Fortin, Luke Hoberecht
addOffTargetScores to add off-target scores.
if (interactive()){ gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA") gs <- addOnTargetScores(gs) }if (interactive()){ gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATAAAAAATTAGCCGGGTTA") gs <- addOnTargetScores(gs) }
Add optical pooled screening (OPS) barcodes.
addOpsBarcodes(guideSet, n_cycles = 9, rt_direction = c("5prime", "3prime"))addOpsBarcodes(guideSet, n_cycles = 9, rt_direction = c("5prime", "3prime"))
guideSet |
A GuideSet object. |
n_cycles |
Integer specifying the number of sequencing cycles used in the in situ sequencing. This effectively determines the length of the barcodes to be used for sequencing. |
rt_direction |
String specifying from which direction the reverse transcription of the gRNA spacer sequence will occur. Must be either "5prime" or "3prime". "5prime" by default. |
The original guideSet object with an additional
column opsBarcode stored in mcols(guideSet).
The column is a DNAStringSet storing the OPS
barcode.
Jean-Philippe Fortin
data(guideSetExample, package="crisprDesign") guideSetExample <- addOpsBarcodes(guideSetExample)data(guideSetExample, package="crisprDesign") guideSetExample <- addOpsBarcodes(guideSetExample)
Add PAM scores to a GuideSet object based on the CrisprNuclease object stored in the GuideSet object. PAM scores indicate nuclease affinity (recognition) to different PAM sequences. A score of 1 indicates a PAM sequence that is fully recognized by the nuclease.
addPamScores(object, ...) ## S4 method for signature 'GuideSet' addPamScores(object) ## S4 method for signature 'PairedGuideSet' addPamScores(object) ## S4 method for signature 'NULL' addPamScores(object)addPamScores(object, ...) ## S4 method for signature 'GuideSet' addPamScores(object) ## S4 method for signature 'PairedGuideSet' addPamScores(object) ## S4 method for signature 'NULL' addPamScores(object)
object |
A GuideSet or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
guideSet with an appended score_pam column in
mcols(guideSet).
Jean-Philippe Fortin
# Using character vector as input: data(enAsCas12a, package="crisprBase") gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATACAAAAAATTAGCCGGGTGTTA", canonical=FALSE, crisprNuclease=enAsCas12a) gs <- addPamScores(gs)# Using character vector as input: data(enAsCas12a, package="crisprBase") gs <- findSpacers("CCAACATAGTGAAACCACGTCTCTATAAAGAATACAAAAAATTAGCCGGGTGTTA", canonical=FALSE, crisprNuclease=enAsCas12a) gs <- addPamScores(gs)
Add Pfam domains annotation to GuideSet object.
addPfamDomains(object, ...) ## S4 method for signature 'GuideSet' addPfamDomains(object, pfamTable) ## S4 method for signature 'PairedGuideSet' addPfamDomains(object, pfamTable) ## S4 method for signature 'NULL' addPfamDomains(object)addPfamDomains(object, ...) ## S4 method for signature 'GuideSet' addPfamDomains(object, pfamTable) ## S4 method for signature 'PairedGuideSet' addPfamDomains(object, pfamTable) ## S4 method for signature 'NULL' addPfamDomains(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
pfamTable |
A DataFrame obtained using
|
In order to call this function,
the object must contain a gene annotation
by calling first addGeneAnnotation.
An updated object with a colum pfam added to
geneAnnotation(object).
Jean-Philippe Fortin
See preparePfamTable to prepare the Pfam
domain DataFrame object, and see addGeneAnnotation
to add a gene annotation to the object.
Add a logical flag for gRNAs leading to potential reinitiation.
addReinitiationFlag( guideSet, tx_id, grnaLocationUpperLimit = 150, cdsCutoff = 0.2 )addReinitiationFlag( guideSet, tx_id, grnaLocationUpperLimit = 150, cdsCutoff = 0.2 )
guideSet |
A GuideSet object. |
tx_id |
String specifiying Ensembl ID for the isoform transcript of interested. E.g. "ENST00000311936". |
grnaLocationUpperLimit |
Integer value specifying the number of nucleotides upstream of the start of the CDS in which to search for problematic gRNAs. Default value is 150. gRNAS beyond this value will not be flagged. |
cdsCutoff |
Numeric value between 0 and 1 to specify the percentage of the CDS in which to search for problematic gRNAs. Default is 0.20. gRNAS beyond this value will not be flagged. |
The original object with an appended column
reinitiationFlag with logical values. A TRUE value
indicates a gRNA in proximity of a potential reinitiation site,
and therefore should be avoided.
Jean-Philippe Fortin
Convert amino acid position annotations into representative coordinates for downstream one-dimensional smoothing or clustering analyses.
addRepCoordinates( guideSet, positionMethod = c("average", "max", "all"), minEditingWeight = 0.3 )addRepCoordinates( guideSet, positionMethod = c("average", "max", "all"), minEditingWeight = 0.3 )
guideSet |
A |
positionMethod |
Character string specifying how plotting coordinates
should be assigned. Must be one of |
minEditingWeight |
Numeric scalar giving the minimum editing weight
required for an edited amino acid position to be retained when
|
The column annotation of the input GuideSet must contain a
column named aaPos. This column
typically stores one or more amino acid positions per row, encoded as
semi-colon-separated integers (for example, "120;121").
When positionMethod = "average", each row is assigned a single
coordinate equal to the floor of the mean of the positions listed in
aaPos.
When positionMethod = "max", the function uses the aaChanges
column, if available, to identify the amino acid position associated with
the largest editing score. The returned integer vector is named by the
corresponding amino acid substitution (for example, "R314K"). If
aaChanges is missing, the function falls back to aaPos and
returns an unnamed vector.
When positionMethod = "all", the function returns all amino acid
positions with editing weights greater than or equal to
minEditingWeight, based on aaChanges. If no position passes
the threshold, the first listed substitution is returned. Each element of
the returned list is a named integer vector, where names are amino acid
substitutions (for example, "R314K"). If aaChanges is
missing, the function falls back to aaPos.
The aaChanges column is expected to contain strings such as
"R314K(0.41);V315I(0.29);A311T(0.10)", where the amino acid position
is extracted from each substitution and the value in parentheses is treated
as its editing weight.
If positionMethod = "average", an integer vector of length
nrow(df) is added to the mcols of the GuideSet object.
If positionMethod = "max", a named integer vector of length
nrow(df) when aaChanges is available; otherwise an unnamed
integer vector.
If positionMethod = "all", a list of length nrow(df), where
each element is an integer vector containing one or more plotting
coordinates for that row. When aaChanges is available, each integer
vector is named by the corresponding amino acid substitution.
Add an annotation column to a GuideSet object that identifies spacer sequences overlapping repeat elements.
addRepeats(object, ...) ## S4 method for signature 'GuideSet' addRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'PairedGuideSet' addRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'NULL' addRepeats(object)addRepeats(object, ...) ## S4 method for signature 'GuideSet' addRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'PairedGuideSet' addRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'NULL' addRepeats(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
gr.repeats |
A GRanges object containing repeat elements regions. |
ignore.strand |
Should gene strand be ignored when annotating? TRUE by default. |
guideSet with an inRepeats column appended in
mcols(guideSet) that signifies whether the spacer sequence
overlaps a repeat element.
Jean-Philippe Fortin, Luke Hoberecht
link{removeRepeats}.
data(guideSetExample, package="crisprDesign") data(grRepeatsExample, package="crisprDesign") guideSet <- addRepeats(guideSetExample, gr.repeats=grRepeatsExample)data(guideSetExample, package="crisprDesign") data(grRepeatsExample, package="crisprDesign") guideSet <- addRepeats(guideSetExample, gr.repeats=grRepeatsExample)
Add restriction site enzymes annotation.
addRestrictionEnzymes(object, ...) ## S4 method for signature 'GuideSet' addRestrictionEnzymes( object, enzymeNames = NULL, patterns = NULL, includeDefault = TRUE, flanking5 = "ACCG", flanking3 = "GTTT" ) ## S4 method for signature 'PairedGuideSet' addRestrictionEnzymes( object, enzymeNames = NULL, patterns = NULL, includeDefault = TRUE, flanking5 = "ACCG", flanking3 = "GTTT" ) ## S4 method for signature 'NULL' addRestrictionEnzymes(object)addRestrictionEnzymes(object, ...) ## S4 method for signature 'GuideSet' addRestrictionEnzymes( object, enzymeNames = NULL, patterns = NULL, includeDefault = TRUE, flanking5 = "ACCG", flanking3 = "GTTT" ) ## S4 method for signature 'PairedGuideSet' addRestrictionEnzymes( object, enzymeNames = NULL, patterns = NULL, includeDefault = TRUE, flanking5 = "ACCG", flanking3 = "GTTT" ) ## S4 method for signature 'NULL' addRestrictionEnzymes(object)
object |
A GuideSet or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
enzymeNames |
Character vector of enzyme names. |
patterns |
Optional named character vector for custom restriction site patterns. Vector names are treated as enzymes names. See example. |
includeDefault |
Should commonly-used enzymes be included? TRUE by default. |
flanking5, flanking3
|
Character string indicating the 5' or 3' flanking sequence, respectively, of the spacer sequence in the lentivial vector. |
Restriction enzymes are often used for cloning purpose during the
oligonucleotide synthesis of gRNA lentiviral constructs. Consequently,
it is often necessary to avoid restriction sites of the used restriction
enzymes in and around the spacer sequences.
addRestrictionEnzymes allows for
flagging problematic spacer sequences by searching for restriction sites
in the [flanking5][spacer][flanking3] sequence.
The following enzymes are included when includeDefault=TRUE:
EcoRI, KpnI, BsmBI, BsaI, BbsI, PacI, and MluI.
Custom recognition sequences in patterns may use the IUPAC
nucleotide code, excluding symbols indicating gaps. Avoid providing
enzyme names in patterns that are already included by default (if
includeDefault=TRUE) or given by enzymeNames. Patterns
with duplicated enzyme names will be silently ignored, even if the
recognition sequence differs. See example.
Adds a DataFrame indicating whether cutting sites for the specified enzymes are found in the gRNA cassette (flanking sequences + spacer sequences).
Jean-Philippe Fortin, Luke Hoberecht
enzymeAnnotation to retrieve existing enzyme
annotation from a GuideSet object.
data(SpCas9, package="crisprBase") seq <- c("ATTTCCGGAGGCGAATTCGGCGGGAGGAGGAAGACCGG") guideSet <- findSpacers(seq, crisprNuclease=SpCas9) # Using default enzymes: guideSet <- addRestrictionEnzymes(guideSet) # Using custom enzymes: guideSet <- addRestrictionEnzymes(guideSet, patterns=c(enz1="GGTCCAA", enz2="GGTCG")) # Avoid duplicate enzyme names guideSet <- addRestrictionEnzymes(guideSet, patterns=c(EcoRI="GANNTC")) # ignoreddata(SpCas9, package="crisprBase") seq <- c("ATTTCCGGAGGCGAATTCGGCGGGAGGAGGAAGACCGG") guideSet <- findSpacers(seq, crisprNuclease=SpCas9) # Using default enzymes: guideSet <- addRestrictionEnzymes(guideSet) # Using custom enzymes: guideSet <- addRestrictionEnzymes(guideSet, patterns=c(enz1="GGTCCAA", enz2="GGTCG")) # Avoid duplicate enzyme names guideSet <- addRestrictionEnzymes(guideSet, patterns=c(EcoRI="GANNTC")) # ignored
Add spacer sequence feature annotation columns, such as GC content, homopolymers, and hairpin predictions, to a GuideSet object.
addSequenceFeatures(object, ...) ## S4 method for signature 'GuideSet' addSequenceFeatures( object, addHairpin = FALSE, backbone = "AGGCTAGTCCGT", tp53 = TRUE, ... ) ## S4 method for signature 'PairedGuideSet' addSequenceFeatures( object, addHairpin = FALSE, backbone = "AGGCTAGTCCGT", tp53 = TRUE, ... ) ## S4 method for signature 'NULL' addSequenceFeatures(object, ...)addSequenceFeatures(object, ...) ## S4 method for signature 'GuideSet' addSequenceFeatures( object, addHairpin = FALSE, backbone = "AGGCTAGTCCGT", tp53 = TRUE, ... ) ## S4 method for signature 'PairedGuideSet' addSequenceFeatures( object, addHairpin = FALSE, backbone = "AGGCTAGTCCGT", tp53 = TRUE, ... ) ## S4 method for signature 'NULL' addSequenceFeatures(object, ...)
object |
A GuideSet or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
addHairpin |
Whether to include predicted hairpin formation via sequence complementarity. FALSE by default. See details. |
backbone |
Backbone sequence in the guide RNA that is susceptible to hairpin formation with a complementary region in the spacer sequence. |
tp53 |
Should TP53-related toxicity features be added? TRUE by default. See details. |
The addHairpin argument set to TRUE will indicates
which spacers are predicted to form internal hairpins. Such hairpins
can happen when there is a palindromic sequence within the spacer having
arms of >=4nt and >=50% GC content, and are separated by a loop of
>=4nt. Backbone hairpin formation is predicted when the spacer and
backbone share a complementary sequence of >=5nt and >=50% GC content.
The argument backbone allows users to specify the vector
backbone sequence directly downstream of the spacer sequence.
The tp53 argument set to TRUE will add sequence-based
features that have been reported to make SpCas9 gRNAs toxic for
cells with wildtype TP53
(see https://doi.org/10.1038/s41467-022-32285-1). Currently, only
one feature is reported and consists of the extended NNGG PAM sequence
(1 nucleotide + PAM sequence) for SpCas9. gRNAs with extended CNGG
PAM sequences, and in particular CCGG, should be avoided.
The original object with the following columns appended to
mcols(object):
percentGC — percent GC content
polyA, polyC, polyG, polyT —
presence of homopolymers of 4nt or longer
selfHairpin — prediction of hairpin formation within the
spacer sequence via self-complementarity if addHairpin is
TRUE.
backboneHairpin — prediction of hairpin formation with
the backbone sequence via complementarity if addHairpin is
TRUE.
NNGG – extended PAM sequence for SpCas9 if tp53
is TRUE corresponding to one nucleotide upstream of the PAM
sequence followed by the PAM sequence itself.
custom_seq <- c("ATTTCCGGAGGCGGAGAGGCGGGAGGAGCG") data(SpCas9, package="crisprBase") guideSet <- findSpacers(custom_seq, crisprNuclease=SpCas9) guideSet <- addSequenceFeatures(guideSet)custom_seq <- c("ATTTCCGGAGGCGGAGAGGCGGGAGGAGCG") data(SpCas9, package="crisprBase") guideSet <- findSpacers(custom_seq, crisprNuclease=SpCas9) guideSet <- addSequenceFeatures(guideSet)
Add SNP annotation to a GuideSet object. Only available for sgRNAs designed for human genome.
addSNPAnnotation(object, ...) ## S4 method for signature 'NULL' addGeneAnnotation(object) ## S4 method for signature 'GuideSet' addSNPAnnotation(object, snpObject, maf = 0.01) ## S4 method for signature 'PairedGuideSet' addSNPAnnotation(object, snpObject, maf = 0.01) ## S4 method for signature 'NULL' addSNPAnnotation(object)addSNPAnnotation(object, ...) ## S4 method for signature 'NULL' addGeneAnnotation(object) ## S4 method for signature 'GuideSet' addSNPAnnotation(object, snpObject, maf = 0.01) ## S4 method for signature 'PairedGuideSet' addSNPAnnotation(object, snpObject, maf = 0.01) ## S4 method for signature 'NULL' addSNPAnnotation(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
snpObject |
Either a character string specfying a path to a VCF file or a GRanges object. |
maf |
Minimum minor allele frequency to report (for a least one source among 1000Genomes and TOPMED). Must be between 0 and 1 (exclusive). |
The different columns stored in
mcols(guideSet)[["snps"]] are:
ID sgRNA ID.
rs Reference SNP cluster ID (e.g. rs17852242)
rs_site Genomic coordinate of the SNP.
rs_site_rel Position of SNP relative to the PAM site.
allele_ref DNAString specifying the SNP reference allele.
allele_minor DNAString specifying the SNP minor allele.
MAF_1000G Minor allele frequency in the 1000 Genomes project.
MAF_TOPMED Minor allele frequency in the TOPMed project.
type Type of SNP ("ins": insertion, "del":
deletion).
length Length of SNP in nucleotides.
guideSet appended with hasSNP column and snps
list-column, both stored in mcols{guideSet}.
link{snps} to retrieve an existing SNP annotation
stored in a GuideSet object. See details section for a
description of the different columns.
vcf <- system.file("extdata", file="common_snps_dbsnp151_example.vcf.gz", package="crisprDesign") data(guideSetExample, package="crisprDesign") guideSet <- addSNPAnnotation(guideSetExample, snpObject=vcf)vcf <- system.file("extdata", file="common_snps_dbsnp151_example.vcf.gz", package="crisprDesign") data(guideSetExample, package="crisprDesign") guideSet <- addSNPAnnotation(guideSetExample, snpObject=vcf)
Functions for finding and characterizing on- and off-targets of spacer sequences.
addSpacerAlignments(object, ...) addSpacerAlignmentsIterative(object, ...) ## S4 method for signature 'GuideSet' addSpacerAlignmentsIterative( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, all_alignments = FALSE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL, alignmentThresholds = c(n0 = 5, n1 = 100, n2 = 100, n3 = 1000, n4 = 1000) ) ## S4 method for signature 'PairedGuideSet' addSpacerAlignmentsIterative( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, all_alignments = FALSE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL, alignmentThresholds = c(n0 = 5, n1 = 100, n2 = 100, n3 = 1000, n4 = 1000) ) ## S4 method for signature 'NULL' addSpacerAlignmentsIterative(object) ## S4 method for signature 'GuideSet' addSpacerAlignments( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, n_max_alignments = 1000, all_alignments = TRUE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL ) ## S4 method for signature 'PairedGuideSet' addSpacerAlignments( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, n_max_alignments = 1000, all_alignments = FALSE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL ) ## S4 method for signature 'NULL' addSpacerAlignments(object) getSpacerAlignments( spacers, aligner = c("bowtie", "bwa", "biostrings"), custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, n_max_alignments = 1000, all_alignments = TRUE, crisprNuclease = NULL, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE )addSpacerAlignments(object, ...) addSpacerAlignmentsIterative(object, ...) ## S4 method for signature 'GuideSet' addSpacerAlignmentsIterative( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, all_alignments = FALSE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL, alignmentThresholds = c(n0 = 5, n1 = 100, n2 = 100, n3 = 1000, n4 = 1000) ) ## S4 method for signature 'PairedGuideSet' addSpacerAlignmentsIterative( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, all_alignments = FALSE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL, alignmentThresholds = c(n0 = 5, n1 = 100, n2 = 100, n3 = 1000, n4 = 1000) ) ## S4 method for signature 'NULL' addSpacerAlignmentsIterative(object) ## S4 method for signature 'GuideSet' addSpacerAlignments( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, n_max_alignments = 1000, all_alignments = TRUE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL ) ## S4 method for signature 'PairedGuideSet' addSpacerAlignments( object, aligner = c("bowtie", "bwa", "biostrings"), colname = "alignments", addSummary = TRUE, txObject = NULL, tssObject = NULL, custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, n_max_alignments = 1000, all_alignments = FALSE, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE, anchor = c("cut_site", "pam_site"), annotationType = c("gene_symbol", "gene_id"), tss_window = NULL ) ## S4 method for signature 'NULL' addSpacerAlignments(object) getSpacerAlignments( spacers, aligner = c("bowtie", "bwa", "biostrings"), custom_seq = NULL, aligner_index = NULL, bsgenome = NULL, n_mismatches = 0, n_max_alignments = 1000, all_alignments = TRUE, crisprNuclease = NULL, canonical = TRUE, standard_chr_only = FALSE, both_strands = TRUE )
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
aligner |
Which genomic alignment method should be used? Must be one of "bowtie", "bwa", and "biostrings". "bowtie" by default. Note that "bwa" is not availble for Windows machines. |
colname |
String specifying the columm name storing the alignments
in |
addSummary |
Should summary columns be added to |
txObject |
A TxDb object or a GRangesList
object obtained using |
tssObject |
A GRanges object specifying TSS coordinates. |
custom_seq |
Optional string specifying the target DNA sequence for the search space. This will limit the off-target search to the specified custom sequence. |
aligner_index |
String specifying bowtie or BWA index.
Must be provided when |
bsgenome |
A BSgenome object from which to extract sequences if a GRanges object is provided as input. |
n_mismatches |
Maximum number of mismatches permitted between guide RNA and genomic DNA. |
all_alignments |
Should all all possible alignments be returned? FALSE by default. |
canonical |
|
standard_chr_only |
Should only standard chromosomes be considered?
If |
both_strands |
When |
anchor |
The position within the protospacer as determined by CrisprNuclease to use when annotating with overlapping gene regions. |
annotationType |
Gene identifier to return when annotating alignments
with gene and/or promoter overlaps. Corresponding |
tss_window |
Window size of promoters upstream of gene TSS to search
for overlap with spacer sequence. Must be a numeric vector of length 2:
upstream limit and downstream limit. Default is |
alignmentThresholds |
Named numeric vector of the maximum on-target
alignments tolerated for |
n_max_alignments |
Maximum number of alignments to report by bowtie
for each spacer. Effectively set to |
spacers |
Character vector of gRNA spacer sequences. All sequences must be equal in length. |
crisprNuclease |
A CrisprNuclease object. |
The columns stored in mcols(guideSet)[["alignments"]] are:
spacer Spacer sequence of the query gRNA.
protospacer Protospacer sequence in the target DNA.
pam PAM sequence.
pam_site PAM site of the found protospacer.
n_mismatches Integer value specifying the number
of nucleotide mismatches between the gRNA spacer sequence
and the protospacer sequence found in the genome or custom sequence.
canonical Whether the PAM sequence of the found protospacer
sequence is canonical.
cute_site Cut site of the found protospacer.
The following columns are also stored when a txObject is provided:
cds Character vector specifying gene names of CDS overlapping
the found protospacer sequence.
fiveUTRs Character vector specifying gene names of 5'UTRs
overlapping the found protospacer sequence.
threeUTRs Character vector specifying gene names of 3'UTRs
overlapping the found protospacer sequence.
exons Character vector specifying gene names of exons
overlapping the found protospacer sequence.
introns Character vector specifying gene names of introns
overlapping the found protospacer sequence.
intergenic Character vector specifying the nearest gene when
the found protospacer sequence is not located in a gene.
intergenic_distance Distance in base pairs from the nearest
gene when the found protospacer sequence is not located in a gene.
The following columns are also stored when a tssObject is provided:
promoters Character vector specifying gene names of promoters,
as defined by tss_window relative to the gene TSS, overlapping
the found protospacer sequence.
getSpacerAlignments returns a GRanges
object storing spacer alignment data, including genomic coordinates,
spacer and PAM sequences, and position of mismatches relative to
pam_site.
addSpacerAlignments is similar to
getSpacerAlignments, with the addition of adding the
alignment data to a list-column in mcols(guideSet) specified
by colname.
addSpacerAlignmentsIterative is similar to
addSpacerAlignments, except that it avoids finding
alignments for spacer sequences that have a large number of on-targets
and/or off-targets to speed up the off-target search. The parameters
n0_max, n1_max and n2_max specify the maximum
number of on-targets (n0) and off-targets
(n1 for 1-mismatch off-targets, and n2 for 2-mismatch off-targets)
tolerated before the algorithm stops finding additional off-targets
for spacer sequences that exceed those quotas.
Jean-Philippe Fortin, Luke Hoberecht
if (interactive()){ # Creating a bowtie index: library(Rbowtie) library(BSgenome.Hsapiens.UCSC.hg38) fasta <- system.file(package="crisprDesign", "fasta/chr12.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta, outdir=outdir, force=TRUE, prefix="chr12") bowtieIndex <- file.path(outdir, "chr12") # Adding spacer alignments with bowtie: data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addSpacerAlignments(guideSetExample, aligner="bowtie", aligner_index=bowtieIndex, bsgenome=BSgenome.Hsapiens.UCSC.hg38, n_mismatches=2, txObject=grListExample) }if (interactive()){ # Creating a bowtie index: library(Rbowtie) library(BSgenome.Hsapiens.UCSC.hg38) fasta <- system.file(package="crisprDesign", "fasta/chr12.fa") outdir <- tempdir() Rbowtie::bowtie_build(fasta, outdir=outdir, force=TRUE, prefix="chr12") bowtieIndex <- file.path(outdir, "chr12") # Adding spacer alignments with bowtie: data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addSpacerAlignments(guideSetExample, aligner="bowtie", aligner_index=bowtieIndex, bsgenome=BSgenome.Hsapiens.UCSC.hg38, n_mismatches=2, txObject=grListExample) }
Computes a specificity proxy score for each gRNA based on the number of genomic alignments with 0, 1, 2, or 3 mismatches. The score is intended as a simple measure of off-target burden when empirical mismatch-tolerance models are unavailable for the nuclease of interest.
addSpecificityProxyScore(guideSet, w1 = 0.5, w2 = 0.05, w3 = 0.005)addSpecificityProxyScore(guideSet, w1 = 0.5, w2 = 0.05, w3 = 0.005)
guideSet |
A GuideSet object containing alignment information produced
by |
w1 |
Numeric weight assigned to alignments with one mismatch. |
w2 |
Numeric weight assigned to alignments with two mismatches. |
w3 |
Numeric weight assigned to alignments with three mismatches. |
For each spacer, the score is calculated as:
where , , , and denote the number of
genomic alignments with 0, 1, 2, and 3 mismatches, respectively. If no
perfect match is identified (), an additional penalty of 1 is
added to the denominator.
Larger values indicate higher predicted specificity (lower off-target burden), whereas smaller values indicate the presence of more closely matching genomic sites. The score should be interpreted as a relative ranking metric and not as a calibrated probability of off-target cleavage.
This method provides a simple count-based approximation of guide specificity. Unlike CFD or MIT specificity scores, it does not account for mismatch position, mismatch identity, chromatin accessibility, or empirical cleavage measurements. Consequently, it should be viewed as a heuristic specificity proxy suitable for relative guide ranking.
The input GuideSet with an additional column,
score_specificity_proxy, added to
S4Vectors::mcols(guideSet).
Add transcription start site (TSS) context annotation to spacer sequences stored in a GuideSet object.
addTssAnnotation(object, ...) ## S4 method for signature 'GuideSet' addTssAnnotation( object, tssObject, anchor = c("cut_site", "pam_site"), tss_window = NULL, ignore.strand = TRUE ) ## S4 method for signature 'PairedGuideSet' addTssAnnotation( object, tssObject, anchor = c("cut_site", "pam_site"), tss_window = NULL, ignore.strand = TRUE ) ## S4 method for signature 'NULL' addTssAnnotation(object)addTssAnnotation(object, ...) ## S4 method for signature 'GuideSet' addTssAnnotation( object, tssObject, anchor = c("cut_site", "pam_site"), tss_window = NULL, ignore.strand = TRUE ) ## S4 method for signature 'PairedGuideSet' addTssAnnotation( object, tssObject, anchor = c("cut_site", "pam_site"), tss_window = NULL, ignore.strand = TRUE ) ## S4 method for signature 'NULL' addTssAnnotation(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
tssObject |
A GRanges object containing TSS coordinates and annotation. |
anchor |
A character string specifying which gRNA-specific coordinate
to use ( |
tss_window |
A numeric vector of length 2 establishing the window size
of the genomic region around the TSS to include as the "TSS region".
The values set the upstream and downstream limits, respecitvely. The
default is |
ignore.strand |
If |
mcols(guideSet)[["tssAnnotation"]] includes all columns from
mcols(tssObject) in addition to the columns described below.
chr — gRNA chromosome name.
anchor_site — Genomic coordinate used to search for overlapping
TSS regions.
strand — Strand the gRNA is located on.
tss_id — The ID for the TSS in tssObject, if present.
tss_strand — Strand the TSS is located on, as provided in
tssObject
tss_pos — Genomic coordinate of the TSS, as provided in
tssObject.
dist_to_tss — Distance (in nucleotides) between the gRNA
anchor_site and tss_pos. Negative values indicate
gRNA targets upstream of the TSS.
A GuideSet object with a tssAnnotation list
column stored in mcols(guideSet). See details section for
descriptions of TSS annotation columns.
Jean-Philippe Fortin, Luke Hoberecht
addGeneAnnotation to add gene annotation, and
tssAnnotation to retrieve an existing TSS annotation.
data(guideSetExample, package="crisprDesign") data(tssObjectExample, package="crisprDesign") guideSet <- addTssAnnotation(guideSetExample, tssObject=tssObjectExample) # To access TSS annotation: ann <- tssAnnotation(guideSet)data(guideSetExample, package="crisprDesign") data(tssObjectExample, package="crisprDesign") guideSet <- addTssAnnotation(guideSetExample, tssObject=tssObjectExample) # To access TSS annotation: ann <- tssAnnotation(guideSet)
Add a gene-specific transcript table to a GuideSet object.
Add a gene-specific transcript table to a GuideSet object.
addTxTable(guideSet, gene_id, txObject, valueColumn = "percentCDS")addTxTable(guideSet, gene_id, txObject, valueColumn = "percentCDS")
guideSet |
A GuideSet object or a PairedGuideSet object. |
gene_id |
String specifying gene ID. |
txObject |
A TxDb object or a
GRangesList object obtained using
|
valueColumn |
String specifying column in
|
A GuideSet object with a "txTable" DataFrame
stored in mcols(guideSet). The entries in the DataFrame
correspond to the values specified by valueColumn.
Rows correspond to gRNAs in the GuideSet, columns correspond to
all transcripts found in txObject for gene specified by
gene_id.
Jean-Philippe Fortin
addGeneAnnotation to add gene annotation.
if (interactive()){ data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addGeneAnnotation(guideSetExample, txObject=grListExample) guideSet <- addTxTable(guideSet, gene_id="ENSG00000120645", txObject=grListExample) guideSet$txTable }if (interactive()){ data(guideSetExample, package="crisprDesign") data(grListExample, package="crisprDesign") guideSet <- addGeneAnnotation(guideSetExample, txObject=grListExample) guideSet <- addTxTable(guideSet, gene_id="ENSG00000120645", txObject=grListExample) guideSet$txTable }
These functions serve to "fill-in-the-blank" for spacers lacking information.
getPAMSequence(chr, pam_site, strand, crisprNuclease = NULL, bsgenome = NULL) getSpacerSequence( chr, pam_site, strand, crisprNuclease = NULL, bsgenome = NULL, spacerLen = NULL ) getPAMSiteFromStartAndEnd( start = NULL, end = NULL, strand, crisprNuclease = NULL, spacerLen = NULL )getPAMSequence(chr, pam_site, strand, crisprNuclease = NULL, bsgenome = NULL) getSpacerSequence( chr, pam_site, strand, crisprNuclease = NULL, bsgenome = NULL, spacerLen = NULL ) getPAMSiteFromStartAndEnd( start = NULL, end = NULL, strand, crisprNuclease = NULL, spacerLen = NULL )
chr |
The chromosome in which the protospacer sequence is located. |
pam_site |
Coordinate of the first nucleotide of the PAM sequence. |
strand |
Either "+" or "-". |
crisprNuclease |
A CrisprNuclease object. |
bsgenome |
A BSgenome object. |
spacerLen |
Spacer sequence length.
If NULL, the information is obtained from |
start |
Coordinate of the first nucleotide of the spacer sequences.
Must be always less than |
end |
Coordinate of the last nucleotide of the spacer sequence.
Must be always greater than |
Functions that return coordinates (getPAMSite,
getCutSite, getSpacerRanges) do not check whether
coordinates exceed chromosomal lengths.
The start and end coordinates of a genomic range is
strand-independent, and always obeys start <= end.
A numeric or character vector, depending on the function.
getPAMSequence returns a character vector of PAM sequences.
getSpacerSequence returns a character vector of
spacer sequences.
if (requireNamespace("BSgenome.Hsapiens.UCSC.hg38")){ library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 dat <- data.frame(chr='chr4', start=1642343, strand='+') dat$pam_site <- getPAMSiteFromStartAndEnd(start=dat$start, strand=dat$strand) dat$pam <- getPAMSequence(chr=dat$chr, pam_site=dat$pam_site, strand=dat$strand, bsgenome=bsgenome) dat$spacer <- getSpacerSequence(chr=dat$chr, pam_site=dat$pam_site, strand=dat$strand, bsgenome=bsgenome) }if (requireNamespace("BSgenome.Hsapiens.UCSC.hg38")){ library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 dat <- data.frame(chr='chr4', start=1642343, strand='+') dat$pam_site <- getPAMSiteFromStartAndEnd(start=dat$start, strand=dat$strand) dat$pam <- getPAMSequence(chr=dat$chr, pam_site=dat$pam_site, strand=dat$strand, bsgenome=bsgenome) dat$spacer <- getSpacerSequence(chr=dat$chr, pam_site=dat$pam_site, strand=dat$strand, bsgenome=bsgenome) }
Convert a GuideSet object into a GRanges object containing the minimum and maximum coordinates for all targeting gRNAs.
convertToMinMaxGRanges(guideSet, anchor = c("cut_site", "pam_site"))convertToMinMaxGRanges(guideSet, anchor = c("cut_site", "pam_site"))
guideSet |
A GuideSet object. |
anchor |
A character string specifying which gRNA-specific coordinate
to use ( |
A GRanges object with start and end coordinates
corresponding to the minimum and maximum coordinates of the GuideSet
object sites defined by anchor.
Jean-Philippe Fortin, Luke Hoberecht
data(guideSetExample, package="crisprDesign") gr <- convertToMinMaxGRanges(guideSetExample)data(guideSetExample, package="crisprDesign") gr <- convertToMinMaxGRanges(guideSetExample)
Convert PAM site coordinates to protospacer start and end coordinates.
convertToProtospacerGRanges(guideSet)convertToProtospacerGRanges(guideSet)
guideSet |
A GuideSet object. |
A GuideSet object with start and end coordinates corresponding to the start and end coordinates of the protospacer sequences.
Jean-Philippe Fortin
data(guideSetExample, package="crisprDesign") gr <- convertToProtospacerGRanges(guideSetExample)data(guideSetExample, package="crisprDesign") gr <- convertToProtospacerGRanges(guideSetExample)
An S4 class to store CRISPR gRNA sequences with modular annotations.
crisprNuclease(object, ...) targetOrigin(object, ...) customSequences(object, ...) bsgenome(object, ...) spacers(object, ...) protospacers(object, ...) pamSites(object, ...) snps(object, ...) alignments(object, ...) onTargets(object, ...) offTargets(object, ...) geneAnnotation(object, ...) tssAnnotation(object, ...) enzymeAnnotation(object, ...) editedAlleles(object, ...) txTable(object, ...) exonTable(object, ...) tssAnnotation(object) <- value geneAnnotation(object) <- value enzymeAnnotation(object) <- value snps(object) <- value alignments(object) <- value addCutSites(object, ...) GuideSet( ids = NA_character_, protospacers = NA_character_, pams = NULL, seqnames = NA_character_, pam_site = 0L, strand = "*", CrisprNuclease = NULL, targetOrigin = c("bsgenome", "customSequences"), bsgenome = NULL, customSequences = NULL, ..., seqinfo = NULL, seqlengths = NULL ) ## S4 method for signature 'GuideSet' targetOrigin(object) ## S4 method for signature 'GuideSet' customSequences(object) ## S4 method for signature 'GuideSet' bsgenome(object) ## S4 method for signature 'GuideSet' crisprNuclease(object) ## S4 method for signature 'GuideSet' spacers(object, as.character = FALSE, returnAsRna = FALSE) ## S4 method for signature 'GuideSet' pams(object, as.character = FALSE, returnAsRna = FALSE) ## S4 method for signature 'GuideSet' pamSites(object) ## S4 method for signature 'GuideSet' cutSites(object) ## S4 method for signature 'GuideSet' addCutSites(object) ## S4 method for signature 'GuideSet' protospacers( object, as.character = FALSE, include.pam = FALSE, returnAsRna = FALSE ) ## S4 method for signature 'GuideSet' spacerLength(object) ## S4 method for signature 'GuideSet' prototypeSequence(object) ## S4 method for signature 'GuideSet' pamLength(object) ## S4 method for signature 'GuideSet' pamSide(object) ## S4 method for signature 'GuideSet' snps(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' alignments(object, columnName = "alignments", unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' onTargets(object, columnName = "alignments", unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' offTargets( object, columnName = "alignments", max_mismatches = Inf, unlist = TRUE, use.names = TRUE ) ## S4 replacement method for signature 'GuideSet' alignments(object) <- value ## S4 replacement method for signature 'GuideSet' geneAnnotation(object) <- value ## S4 replacement method for signature 'GuideSet' tssAnnotation(object) <- value ## S4 replacement method for signature 'GuideSet' enzymeAnnotation(object) <- value ## S4 replacement method for signature 'GuideSet' snps(object) <- value ## S4 method for signature 'GuideSet' geneAnnotation( object, unlist = TRUE, gene_id = NULL, tx_id = NULL, gene_symbol = NULL, use.names = TRUE ) ## S4 method for signature 'GuideSet' editedAlleles(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' tssAnnotation( object, unlist = TRUE, gene_id = NULL, gene_symbol = NULL, use.names = TRUE ) ## S4 method for signature 'GuideSet' enzymeAnnotation(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' txTable(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' exonTable(object, unlist = TRUE, use.names = TRUE)crisprNuclease(object, ...) targetOrigin(object, ...) customSequences(object, ...) bsgenome(object, ...) spacers(object, ...) protospacers(object, ...) pamSites(object, ...) snps(object, ...) alignments(object, ...) onTargets(object, ...) offTargets(object, ...) geneAnnotation(object, ...) tssAnnotation(object, ...) enzymeAnnotation(object, ...) editedAlleles(object, ...) txTable(object, ...) exonTable(object, ...) tssAnnotation(object) <- value geneAnnotation(object) <- value enzymeAnnotation(object) <- value snps(object) <- value alignments(object) <- value addCutSites(object, ...) GuideSet( ids = NA_character_, protospacers = NA_character_, pams = NULL, seqnames = NA_character_, pam_site = 0L, strand = "*", CrisprNuclease = NULL, targetOrigin = c("bsgenome", "customSequences"), bsgenome = NULL, customSequences = NULL, ..., seqinfo = NULL, seqlengths = NULL ) ## S4 method for signature 'GuideSet' targetOrigin(object) ## S4 method for signature 'GuideSet' customSequences(object) ## S4 method for signature 'GuideSet' bsgenome(object) ## S4 method for signature 'GuideSet' crisprNuclease(object) ## S4 method for signature 'GuideSet' spacers(object, as.character = FALSE, returnAsRna = FALSE) ## S4 method for signature 'GuideSet' pams(object, as.character = FALSE, returnAsRna = FALSE) ## S4 method for signature 'GuideSet' pamSites(object) ## S4 method for signature 'GuideSet' cutSites(object) ## S4 method for signature 'GuideSet' addCutSites(object) ## S4 method for signature 'GuideSet' protospacers( object, as.character = FALSE, include.pam = FALSE, returnAsRna = FALSE ) ## S4 method for signature 'GuideSet' spacerLength(object) ## S4 method for signature 'GuideSet' prototypeSequence(object) ## S4 method for signature 'GuideSet' pamLength(object) ## S4 method for signature 'GuideSet' pamSide(object) ## S4 method for signature 'GuideSet' snps(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' alignments(object, columnName = "alignments", unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' onTargets(object, columnName = "alignments", unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' offTargets( object, columnName = "alignments", max_mismatches = Inf, unlist = TRUE, use.names = TRUE ) ## S4 replacement method for signature 'GuideSet' alignments(object) <- value ## S4 replacement method for signature 'GuideSet' geneAnnotation(object) <- value ## S4 replacement method for signature 'GuideSet' tssAnnotation(object) <- value ## S4 replacement method for signature 'GuideSet' enzymeAnnotation(object) <- value ## S4 replacement method for signature 'GuideSet' snps(object) <- value ## S4 method for signature 'GuideSet' geneAnnotation( object, unlist = TRUE, gene_id = NULL, tx_id = NULL, gene_symbol = NULL, use.names = TRUE ) ## S4 method for signature 'GuideSet' editedAlleles(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' tssAnnotation( object, unlist = TRUE, gene_id = NULL, gene_symbol = NULL, use.names = TRUE ) ## S4 method for signature 'GuideSet' enzymeAnnotation(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' txTable(object, unlist = TRUE, use.names = TRUE) ## S4 method for signature 'GuideSet' exonTable(object, unlist = TRUE, use.names = TRUE)
object |
GuideSet object. |
... |
Additional arguments for class-specific methods |
value |
Object to replace with |
ids |
Character vector of unique gRNA ids. The ids can be anything, as long as they are unique. |
protospacers |
Character vector of protospacers sequences. |
pams |
Character vector of PAM sequences. |
seqnames |
Character vector of chromosome names. |
pam_site |
Integer vector of PAM site coordinates. |
strand |
Character vector of gRNA strand. Only accepted values are "+" and "-". |
CrisprNuclease |
CrisprNuclease object. |
targetOrigin |
String specifying the origin of the DNA target. Must be either 'bsgenome' or 'customSequences'. |
bsgenome |
BSgenome object or string specifying
BSgenome package name. Must be specified when
|
customSequences |
DNAStringSet object. Must be specified
when |
seqinfo |
A Seqinfo object containing informatioon about the set of genomic sequences present in the target genome. |
seqlengths |
|
as.character |
Should sequences be returned as a character vector? FALSE by default, in which case sequences are returned as a DNAStringSet. |
returnAsRna |
Should the sequences be returned as RNA instead of DNA? FALSE by default. |
include.pam |
Should PAM sequences be included? FALSE by default. |
unlist |
Should the annotation be returned as one table instead of a list? TRUE by default. |
use.names |
Whether to include spacer IDs as (row)names ( |
columnName |
Name of the column storing the alignments annotation to be retrieved. |
max_mismatches |
What should be the maximum number of mismatches considered for off-targets? Inf by default. |
gene_id |
Character vector of Ensembl gene IDs to subset gene annotation data by. If NULL (default), all genes are considered. |
tx_id |
Character vector of Ensembl transcript IDs to subset gene annotation data by. If NULL (deafult), all transcript are considered. |
gene_symbol |
Character vector of gene symbols to subset gene annotation data by. If NULL (default), all genes are considered. |
A GuideSet object.
GuideSet(): Create a GuideSet object
Use the constructor link{GuideSet} to create a GuideSet object.
crisprNuclease:To get CrisprNuclease object used to design gRNAs.
spacers:To get spacer sequences.
protospacers:To get protospacer sequences.
spacerLength:To get spacer length.
pams:To get PAM sequences.
pamSites:To get PAM site coordinates.
pamLength:To get PAM length.
pamSide:To return the side of the PAM sequence with respect to the protospacer sequence.
prototypeSequence:To get a prototype protospacer sequence.
cutSites:To get cut sites.
alignments:To get genomic alignments annotation.
onTargets:To get on-target alignments annotation
offTargets:To get off-target alignments annotation
snps:Tp get SNP annotation.
geneAnnotation:To get gene annotation.
tssAnnotation:To get TSS annotation.
enzymeAnnotation:To get restriction enzymes annotation.
editedAlleles:To get edited alleles annotation.
protospacers <- c("AGGTCGTGTGTGGGGGGGGG", "AGGTCGTGTGTGGGGGGGGG") pams <- c("AGG", "CGG") pam_site=c(10,11) seqnames="chr7" data(SpCas9, package="crisprBase") CrisprNuclease <- SpCas9 strand=c("+", "-") ids <- paste0("grna_", seq_along(protospacers)) gr <- GuideSet(ids=ids, protospacers=protospacers, pams=pams, seqnames=seqnames, CrisprNuclease=CrisprNuclease, pam_site=pam_site, strand=strand, targetOrigin="customSequences", customSequences=protospacers)protospacers <- c("AGGTCGTGTGTGGGGGGGGG", "AGGTCGTGTGTGGGGGGGGG") pams <- c("AGG", "CGG") pam_site=c(10,11) seqnames="chr7" data(SpCas9, package="crisprBase") CrisprNuclease <- SpCas9 strand=c("+", "-") ids <- paste0("grna_", seq_along(protospacers)) gr <- GuideSet(ids=ids, protospacers=protospacers, pams=pams, seqnames=seqnames, CrisprNuclease=CrisprNuclease, pam_site=pam_site, strand=strand, targetOrigin="customSequences", customSequences=protospacers)
One-step gRNA design and annotation function to faciliate the design and generation of genome-wide gRNA databases for a combination of parameters such as nuclease, organism, and CRISPR modality.
designCompleteAnnotation( queryValue = NULL, queryColumn = "gene_id", featureType = "cds", modality = c("CRISPRko", "CRISPRa", "CRISPRi", "CRISPRkd"), bsgenome = NULL, bowtie_index = NULL, vcf = NULL, crisprNuclease = NULL, tssObject = NULL, txObject = NULL, grRepeats = NULL, scoring_methods = NULL, tss_window = NULL, n_mismatches = 3, max_mm = 2, canonical_ontarget = TRUE, canonical_offtarget = FALSE, all_alignments = TRUE, conservationFile = NULL, nucExtension = 9, binaries = NULL, canonicalIsoforms = NULL, pfamTable = NULL, verbose = TRUE )designCompleteAnnotation( queryValue = NULL, queryColumn = "gene_id", featureType = "cds", modality = c("CRISPRko", "CRISPRa", "CRISPRi", "CRISPRkd"), bsgenome = NULL, bowtie_index = NULL, vcf = NULL, crisprNuclease = NULL, tssObject = NULL, txObject = NULL, grRepeats = NULL, scoring_methods = NULL, tss_window = NULL, n_mismatches = 3, max_mm = 2, canonical_ontarget = TRUE, canonical_offtarget = FALSE, all_alignments = TRUE, conservationFile = NULL, nucExtension = 9, binaries = NULL, canonicalIsoforms = NULL, pfamTable = NULL, verbose = TRUE )
queryValue |
Vector specifying the value(s) to search for in
|
queryColumn |
Character string specifying the column in
|
featureType |
For CRISPRko, string specifying the type of genomic feature to use to design gRNAs. Must be of the following: "transcripts", "exons", "cds", "fiveUTRs", "threeUTRs" or "introns". The default is "cds". |
modality |
String specifying the CRISPR modality. Must be one of the following: "CRISPRko", "CRISPRa", "CRISPRi" or "CRISPRkd". CRISPRkd is reserved for DNA-targeting nucleases only such as CasRx. |
bsgenome |
A BSgenome object from which to extract sequences if a GRanges object is provided as input. |
bowtie_index |
String specifying path to a bowtie index. |
vcf |
Either a character string specfying a path to a VCF file or connection, or a VCF object. |
crisprNuclease |
A CrisprNuclease object. |
tssObject |
A GRanges object specifying TSS coordinates. |
txObject |
A TxDb object or a GRangesList
object obtained using |
grRepeats |
A GRanges object containing repeat elements regions. |
scoring_methods |
Character vector to specify which on-target scoring methods should be calculated. See crisprScore package to obtain available methods. |
tss_window |
Vector of length 2 specifying the start and coordinates of the CRISPRa/CRISPRi target region with respect to the TSS position. |
n_mismatches |
Maximum number of mismatches permitted between guide RNA and genomic DNA. |
max_mm |
The maximimum number of mismatches between a spacer and an off-target to be accepted when calculating aggregate off-target scores. 2 by default. |
canonical_ontarget |
Should only canonical PAM sequences be searched for designing gRNAs? TRUE by default. |
canonical_offtarget |
Should only canonical PAM sequences by searched during the off-target search? TRUE by default. |
all_alignments |
Should all all possible alignments be returned? TRUE by default. |
conservationFile |
String specifing the BigWig file containing conservation scores. |
nucExtension |
Number of nucleotides to include on each side of the cut site to calculate the conservation score. 9 by default. The region will have (2*nucExtension + 1) nucleotides in total. |
binaries |
Named list of paths for binaries needed for CasRx-RF. Names of the list must be "RNAfold", "RNAhybrid", and "RNAplfold". Each list element is a string specifying the path of the binary. If NULL (default), binaries must be available on the PATH. |
canonicalIsoforms |
Optional data.frame with 2 columns detailing Ensembl canonical isoforms. First column must be named "tx_id", and second column must be named "gene_id", corresponding to Ensembl transcript and gene ids, respectively. |
pfamTable |
A DataFrame obtained using
|
verbose |
Should messages be printed? |
A GuideSet object.
Jean-Philippe Fortin
Design gRNA library for optical pooled screening
designOpsLibrary( df, n_guides = 4, gene_field = "gene", min_dist_edit = 2, dist_method = c("hamming", "levenshtein"), splitByChunks = FALSE )designOpsLibrary( df, n_guides = 4, gene_field = "gene", min_dist_edit = 2, dist_method = c("hamming", "levenshtein"), splitByChunks = FALSE )
df |
data.frame containing information about candidate gRNAs from which to build the OPS library. See details. |
n_guides |
Integer specifying how many gRNAs per gene should be selected. 4 by default. |
gene_field |
String specifying the column in |
min_dist_edit |
Integer specifying the minimum distance edit required for barcodes to be considered dissimilar. Barcodes that have edit distances less than the min_dist_edit will not be included in the library. 2 by default. |
dist_method |
String specifying distance method. Must be either "hamming" (default) or "levenshtein". |
splitByChunks |
Should distances be calculated in a chunk-wise manner? FALSE by default. Highly recommended when the set of query barcodes is large to reduce memory footprint. |
A subset of the df containing the gRNAs
selected for the OPS library.
Jean-Philippe Fortin
data(guideSetExample, package="crisprDesign") guideSet <- unique(guideSetExample) guideSet <- addOpsBarcodes(guideSet) guideSet <- guideSet[1:200] df <- data.frame(ID=names(guideSet), spacer=spacers(guideSet, as.character=TRUE), opsBarcode=as.character(guideSet$opsBarcode)) # Creating mock gene: df$gene <- rep(paste0("gene",1:10),each=20) df$rank <- rep(1:20,10) opsLib <- designOpsLibrary(df)data(guideSetExample, package="crisprDesign") guideSet <- unique(guideSetExample) guideSet <- addOpsBarcodes(guideSet) guideSet <- guideSet[1:200] df <- data.frame(ID=names(guideSet), spacer=spacers(guideSet, as.character=TRUE), opsBarcode=as.character(guideSet$opsBarcode)) # Creating mock gene: df$gene <- rep(paste0("gene",1:10),each=20) df$rank <- rep(1:20,10) opsLib <- designOpsLibrary(df)
Returns all possible, valid gRNA sequences for a given CRISPR nuclease from either a GRanges object or a set of sequence(s) contained in either a DNAStringSet, DNAString or character vector of genomic sequences.
findSpacerPairs( x1, x2, sortWithinPair = TRUE, pamOrientation = c("all", "out", "in"), minCutLength = NULL, maxCutLength = NULL, crisprNuclease = NULL, bsgenome = NULL, canonical = TRUE, both_strands = TRUE, spacer_len = NULL, strict_overlap = TRUE, remove_ambiguities = TRUE )findSpacerPairs( x1, x2, sortWithinPair = TRUE, pamOrientation = c("all", "out", "in"), minCutLength = NULL, maxCutLength = NULL, crisprNuclease = NULL, bsgenome = NULL, canonical = TRUE, both_strands = TRUE, spacer_len = NULL, strict_overlap = TRUE, remove_ambiguities = TRUE )
x1 |
Either a GRanges, a DNAStringSet, or a DNAString object, or a character vector of genomic sequences. This specifies the sequence space from which gRNAs in position 1 of the pairs will be designed. Alternatively, a GuideSet object can be provided. |
x2 |
Either a GRanges, a DNAStringSet, or a DNAString object, or a character vector of genomic sequences. This specifies the sequence space from which gRNAs in position 2 of the pairs will be designed. Alternatively, a GuideSet object can be provided. |
sortWithinPair |
Should gRNAs be sorted by chr and position within a pair? TRUE by default. |
pamOrientation |
String specifying a constraint on the PAM orientation of the pairs. Should be either "all" (default), "out" (for the so-called PAM-out orientation) or "in" (for PAM-in orientation). |
minCutLength |
Integer specifying the minimum cut length allowed (distance between the two cuts) induced by the gRNA pair. If NULL (default), the argument is ignored. Note that this parameter is only applicable for pairs of gRNAs targeting the same chromosome. |
maxCutLength |
Integer specifying the maximum cut length allowed (distance between the two cuts) induced by the gRNA pair. If NULL (default), the argument is ignored. Note that this parameter is only applicable for pairs of gRNAs targeting the same chromosome. |
crisprNuclease |
A CrisprNuclease object. |
bsgenome |
A BSgenome object from which to extract
sequences if |
canonical |
Whether to return only guide sequences having canonical
PAM sequences. If TRUE (default), only PAM sequences with the highest
weights stored in the |
both_strands |
Whether to consider both strands in search for
protospacer sequences. |
spacer_len |
Length of spacers to return, if different from the
default length specified by |
strict_overlap |
Whether to only include gRNAs that cut in the input
range, as given by |
remove_ambiguities |
Whether to remove spacer sequences that contain
ambiguous nucleotides (not explicily |
This function returns a PairedGuideSet object that stores gRNA pairs targeting the two genomic regions provided as input. The gRNAs in position 1 target the first genomic region, and the gRNAs in position 2 target the second genomic region.
This function can be used for the following scenarios:
1. Designing pairs of gRNAs targeting different genes, for instance for dual-promoter Cas9 systems, or polycystronic Cas12a constructs. This can also be used to target a given gene with multiple gRNAs for improved efficacy (for instance CRISPRa and CRISPRi)
2. Designing pairs of gRNAs for double nicking systems such as Cas9 D10A.
See vignette for more examples.
A PairedGuideSet object.
Jean-Philippe Fortin
findSpacers to find unpaired spacer sequences, and the
PairedGuideSet object documentation to understand the
output of findSpacerPairs.
library(GenomicRanges) library(BSgenome.Hsapiens.UCSC.hg38) library(crisprBase) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 # Region 1: gr1 <- GRanges(c("chr12"), IRanges(start=22224014, end=22225007)) # Region 2: gr2 <- GRanges(c("chr13"), IRanges(start=23224014, end=23225007)) # Pairs targeting the same region: pairs <- findSpacerPairs(gr1, gr1, bsgenome=bsgenome) # Pairs targeting two regions: # The gRNA in position targets gr1 # and the gRNA in position 2 targets gr2 pairs <- findSpacerPairs(gr1, gr2, bsgenome=bsgenome)library(GenomicRanges) library(BSgenome.Hsapiens.UCSC.hg38) library(crisprBase) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 # Region 1: gr1 <- GRanges(c("chr12"), IRanges(start=22224014, end=22225007)) # Region 2: gr2 <- GRanges(c("chr13"), IRanges(start=23224014, end=23225007)) # Pairs targeting the same region: pairs <- findSpacerPairs(gr1, gr1, bsgenome=bsgenome) # Pairs targeting two regions: # The gRNA in position targets gr1 # and the gRNA in position 2 targets gr2 pairs <- findSpacerPairs(gr1, gr2, bsgenome=bsgenome)
Returns all possible, valid gRNA sequences for a given CRISPR nuclease from either a GRanges object or a set of sequence(s) contained in either a DNAStringSet, DNAString or character vector of genomic sequences.
findSpacers( x, crisprNuclease = NULL, bsgenome = NULL, canonical = TRUE, both_strands = TRUE, spacer_len = NULL, strict_overlap = TRUE, remove_ambiguities = TRUE, remove_duplicates = TRUE )findSpacers( x, crisprNuclease = NULL, bsgenome = NULL, canonical = TRUE, both_strands = TRUE, spacer_len = NULL, strict_overlap = TRUE, remove_ambiguities = TRUE, remove_duplicates = TRUE )
x |
Either a GRanges, a DNAStringSet, or a DNAString object, or a character vector of genomic sequences. See details. |
crisprNuclease |
A CrisprNuclease object. |
bsgenome |
A BSgenome object from which to extract
sequences if |
canonical |
Whether to return only guide sequences having canonical
PAM sequences. If TRUE (default), only PAM sequences with the highest
weights stored in the |
both_strands |
Whether to consider both strands in search for
protospacer sequences. |
spacer_len |
Length of spacers to return, if different from the
default length specified by |
strict_overlap |
Whether to only include gRNAs that cut in the input
range, as given by |
remove_ambiguities |
Whether to remove spacer sequences that contain
ambiguous nucleotides (not explicily |
remove_duplicates |
Whether to remove duplicated protospacer sequences originating from overlapping genomic ranges. TRUE by default. |
If x is a GRanges object then a
BSgenome must be supplied to bsgenome, from which
the genomic sequence is obtained, unless the bsgenome can be
inferred from genome(x), for example, "hg38". Otherwise,
all supplied sequences are treated as the "+" strands of
chromosomes in a "custom" genome.
Ranges or sequences in x may contain names where permitted. These
names are stored in region in the mcols of the output,
and as seqnames of the output if x is not a
GRanges object. If not NULL, names(x) must
be unique, otherwise ranges or sequences are enumerated with the
"region_" prefix.
When x is a GRanges, the * strand is
interpreted as both strands. Consequently, the both_strands
argument has no effect on such ranges.
A GuideSet object.
Jean-Philippe Fortin, Luke Hoberecht
# Using custom sequence as input: my_seq <- c(my_seq="CCAANAGTGAAACCACGTCTCTATAAAGAATACAAAAAATTAGCCGGGTGTTA") guides <- findSpacers(my_seq) # Exon-intro region of human KRAS specified # using a GRanges object: library(GenomicRanges) library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 gr_input <- GRanges(c("chr12"), IRanges(start=25224014, end=25227007)) guideSet <- findSpacers(gr_input, bsgenome=bsgenome) # Designing guides for enAsCas12a nuclease: data(enAsCas12a, package="crisprBase") guideSet <- findSpacers(gr_input, canonical=FALSE, bsgenome=bsgenome, crisprNuclease=enAsCas12a)# Using custom sequence as input: my_seq <- c(my_seq="CCAANAGTGAAACCACGTCTCTATAAAGAATACAAAAAATTAGCCGGGTGTTA") guides <- findSpacers(my_seq) # Exon-intro region of human KRAS specified # using a GRanges object: library(GenomicRanges) library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 gr_input <- GRanges(c("chr12"), IRanges(start=25224014, end=25227007)) guideSet <- findSpacers(gr_input, bsgenome=bsgenome) # Designing guides for enAsCas12a nuclease: data(enAsCas12a, package="crisprBase") guideSet <- findSpacers(gr_input, canonical=FALSE, bsgenome=bsgenome, crisprNuclease=enAsCas12a)
Create a list of annotation tables from a GuideSet object
flattenGuideSet(guideSet, useSpacerCoordinates = TRUE, primaryOnly = FALSE)flattenGuideSet(guideSet, useSpacerCoordinates = TRUE, primaryOnly = FALSE)
guideSet |
A GuideSet object |
useSpacerCoordinates |
Should the spacer coordinates be used as start and end coordinates? TRUE by default. If FALSE, the PAM site coordinate is used for both start and end. |
primaryOnly |
Should only the primary table (on-targets) be returned? FALSE by default. |
A simple list of tables containing annotations derived from a GuideSet object. The first table ("primary") is always available, while the other tables will be only available when the annotations were added to the GuideSet object.
primary Primary table containing genomic coordinates and
sequence information of the gRNA sequences. Also contains on-target
and off-target scores when available.
alignments Table of on- and off-target alignments.
geneAnnotation Gene context annotation table.
tssAnnotation TSS context annotation table.
enzymeAnnotation Boolean table indicating whether or not
recognition motifs of restriction enzymes are found.
snps SNP annotation table (human only).
Jean-Philippe Fortin
Get distance between query and target sets of barcodes
getBarcodeDistanceMatrix( queryBarcodes, targetBarcodes = NULL, binnarize = TRUE, min_dist_edit = NULL, dist_method = c("hamming", "levenshtein"), ignore_diagonal = TRUE, splitByChunks = FALSE, n_chunks = NULL )getBarcodeDistanceMatrix( queryBarcodes, targetBarcodes = NULL, binnarize = TRUE, min_dist_edit = NULL, dist_method = c("hamming", "levenshtein"), ignore_diagonal = TRUE, splitByChunks = FALSE, n_chunks = NULL )
queryBarcodes |
Character vector of DNA sequences or DNAStringSet. |
targetBarcodes |
Optional character vector of DNA sequences
or DNAStringSet. If NULL, distances will be calculated between
barcodes provided in |
binnarize |
Should the distance matrix be made binnary? TRUE by default. See details section. |
min_dist_edit |
Integer specifying the minimum distance edit
required for barcodes to be considered dissimilar when
|
dist_method |
String specifying distance method. Must be either "hamming" (default) or "levenshtein". |
ignore_diagonal |
When |
splitByChunks |
Should distances be calculated in a chunk-wise manner? FALSE by default. Highly recommended when the set of query barcodes is large to reduce memory footprint. |
n_chunks |
Integer specifying the number of chunks to be used
when |
A sparse matrix of class dgCMatrix or dsCMatrix
in which rows correspond to queryBarcodes and columns
correspond to targetBarcodes. If binnarize=TRUE,
a value of 0 indicates that two barcodes have a distance
greater of equal to min_dist_edit, otherwise the value
is 1. If If binnarize=FALSE, values represent
the actual calculated distances between barcodes.
Jean-Philippe Fortin
data(guideSetExample, package="crisprDesign") guideSetExample <- addOpsBarcodes(guideSetExample) barcodes <- as.character(guideSetExample$opsBarcode) dist <- getBarcodeDistanceMatrix(barcodes, min_dist_edit=2)data(guideSetExample, package="crisprDesign") guideSetExample <- addOpsBarcodes(guideSetExample) barcodes <- as.character(guideSetExample$opsBarcode) dist <- getBarcodeDistanceMatrix(barcodes, min_dist_edit=2)
Get the genomic ranges of a consensus isoform.
The consensus isoform is taken as the union of exons across
all isoforms where overlapping exons are merged to produce
a simplified set through the reduce method of the
GenomicRanges package.
getConsensusIsoform(gene_id, txObject)getConsensusIsoform(gene_id, txObject)
gene_id |
String specifiying Ensembl ID for the
gene of interest. E.g. "ENSG00000049618". ID must be present in
|
txObject |
A TxDb object or a
GRangesList object obtained using
|
A GRanges object.
Jean-Philippe Fortin
data(grListExample) gene_id <- "ENSG00000120645" gr <- getConsensusIsoform(gene_id, grListExample)data(grListExample) gene_id <- "ENSG00000120645" gr <- getConsensusIsoform(gene_id, grListExample)
A function for retrieving mRNA sequences of select transcripts.
getMrnaSequences(txids, txObject, bsgenome)getMrnaSequences(txids, txObject, bsgenome)
txids |
A character vector of Ensembl transcript IDs. IDs not present
in |
txObject |
A TxDb object or a GRangesList
object obtained from |
bsgenome |
A BSgenome object from which to extract mRNA sequences. |
A DNAStringSet object of mRNA sequences. Note that sequences are returned as DNA rather than RNA.
Jean-Philippe Fortin
library(BSgenome.Hsapiens.UCSC.hg38) data(grListExample) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 txids <- c("ENST00000538872", "ENST00000382841") out <- getMrnaSequences(txids, grListExample, bsgenome)library(BSgenome.Hsapiens.UCSC.hg38) data(grListExample) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 txids <- c("ENST00000538872", "ENST00000382841") out <- getMrnaSequences(txids, grListExample, bsgenome)
A function for retrieving pre-mRNA sequences of select transcripts.
getPreMrnaSequences(txids, txObject, bsgenome)getPreMrnaSequences(txids, txObject, bsgenome)
txids |
A character vector of Ensembl transcript IDs. IDs not present
in |
txObject |
A TxDb object or a GRangesList
object obtained from |
bsgenome |
A BSgenome object from which to extract pre-mRNA sequences. |
A DNAStringSet object of mRNA sequences. Note that sequences are returned as DNA rather than RNA.
Jean-Philippe Fortin
library(BSgenome.Hsapiens.UCSC.hg38) data(grListExample) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 txids <- c("ENST00000538872", "ENST00000382841") out <- getPreMrnaSequences(txids, grListExample, bsgenome)library(BSgenome.Hsapiens.UCSC.hg38) data(grListExample) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 txids <- c("ENST00000538872", "ENST00000382841") out <- getPreMrnaSequences(txids, grListExample, bsgenome)
Extract TSS coordinates from a gene model object.
getTssObjectFromTxObject(txObject)getTssObjectFromTxObject(txObject)
txObject |
A TxDb object or a GRangesList
object obtained using |
A GRanges object containing TSS coordinates
Jean-Philippe Fortin
data(grListExample, package="crisprDesign") tss <- getTssObjectFromTxObject(grListExample)data(grListExample, package="crisprDesign") tss <- getTssObjectFromTxObject(grListExample)
Convenience function for constructing a TxDb object.
getTxDb(file = NA, organism, release = NA, tx_attrib = "gencode_basic", ...)getTxDb(file = NA, organism, release = NA, tx_attrib = "gencode_basic", ...)
file |
File argument for |
organism |
String specifying genus and species name
(e.g. "Homo sapiens" for human). Required if |
release |
Ensembl release version; passed to
|
tx_attrib |
Argument passed to |
... |
Additional arguments passed to either
|
A TxDb object.
Jean-Philippe Fortin, Luke Hoberecht
if (interactive()){ # To obtain a TxDb for Homo sapiens from Ensembl: txdb <- getTxDb() # To obtain a TxDb from a GFF file: file='https://www.mirbase.org/ftp/CURRENT/genomes/hsa.gff3' txdb <- getTxDb(file=file) }if (interactive()){ # To obtain a TxDb for Homo sapiens from Ensembl: txdb <- getTxDb() # To obtain a TxDb from a GFF file: file='https://www.mirbase.org/ftp/CURRENT/genomes/hsa.gff3' txdb <- getTxDb(file=file) }
To obtain a DataFrame of transcript-specific CDS and mRNA coordinates.
getTxInfoDataFrame( tx_id, txObject, bsgenome, extend = 30, checkCdsLength = TRUE )getTxInfoDataFrame( tx_id, txObject, bsgenome, extend = 30, checkCdsLength = TRUE )
tx_id |
String specifying ENSEMBL Transcript id. |
txObject |
A TxDb object or a GRangesList
object obtained using |
bsgenome |
BSgenome object from which to extract sequences if a GRanges object is provided as input. |
extend |
Integer value specifying how many nucleotides in intron regions should be included. |
checkCdsLength |
Should the CDS nucleotide length be a multiple of 3? TRUE by default. |
A DataFrame containing nucleotide and amino acid information.
The columns are:
chr Character specifying chromosome.
pos Integer value specifying coordinate in reference genome.
strand Character specifying strand of transcript.
nuc Character specifying nucleotide on the strand
specified by strand.
aa Character specifying amino acid.
aa_number Integer specifying amino acid number from 5' end.
exon Integer specifying exon number.
pos_plot Integer specifying plot coordinate. Useful for
plotting.
pos_mrna Integer specifying relative mRNA coordinate from the
start of the mRNA.
pos_cds Integer specifying relative CDS coordinate from the
start of the CDS.
region Character specifying gene region:
3UTR, 5UTR, CDS, Intron, Upstream (promoter) or downstream.
Jean-Philippe Fortin
library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 data("grListExample") tx_id <- "ENST00000538872" df <- getTxInfoDataFrame(tx_id=tx_id, txObject=grListExample, bsgenome=bsgenome)library(BSgenome.Hsapiens.UCSC.hg38) bsgenome <- BSgenome.Hsapiens.UCSC.hg38 data("grListExample") tx_id <- "ENST00000538872" df <- getTxInfoDataFrame(tx_id=tx_id, txObject=grListExample, bsgenome=bsgenome)
Example of a TxDb object converted to a GRangesList object for human gene IQSEC3 (ENSG00000120645).
data(grListExample, package="crisprDesign")data(grListExample, package="crisprDesign")
Named GRangesList with 7 elements:
transcripts, exons,
cds, fiveUTRs, threeUTRs, introns
and tss.
The full human transcriptome TxDb object was
obtained from the Ensembl 104 release using the getTxDb
function and converted to a GRangesList object using the
TxDb2GRangesList function and subsequently subsetted
to only contain the IQSEC3 gene (ENSG00000120645) located
at the start of chr12 in the human genome (hg38 build).
Example of a GRanges object containing genomic coordinates of repeat elements found in the neighborhood of human gene IQSEC3 (ENSG00000120645).
data(grRepeatsExample, package="crisprDesign")data(grRepeatsExample, package="crisprDesign")
A GRanges object.
Create a list of annotation tables from a GuideSet object
GuideSet2DataFrames(guideSet, useSpacerCoordinates = TRUE, primaryOnly = FALSE)GuideSet2DataFrames(guideSet, useSpacerCoordinates = TRUE, primaryOnly = FALSE)
guideSet |
A GuideSet object |
useSpacerCoordinates |
Should the spacer coordinates be used as start and end coordinates? TRUE by default. If FALSE, the PAM site coordinate is used for both start and end. |
primaryOnly |
Should only the primary table (on-targets) be returned? FALSE by default. |
A simple list of tables containing annotations derived from a GuideSet object. The first table ("primary") is always available, while the other tables will be only available when the annotations were added to the GuideSet object.
primary Primary table containing genomic coordinates and
sequence information of the gRNA sequences. Also contains on-target
and off-target scores when available.
alignments Table of on- and off-target alignments.
geneAnnotation Gene context annotation table.
tssAnnotation TSS context annotation table.
enzymeAnnotation Boolean table indicating whether or not
recognition motifs of restriction enzymes are found.
snps SNP annotation table (human only).
Jean-Philippe Fortin, Luke Hoberecht
data(guideSetExampleFullAnnotation) tables <- GuideSet2DataFrames(guideSetExampleFullAnnotation)data(guideSetExampleFullAnnotation) tables <- GuideSet2DataFrames(guideSetExampleFullAnnotation)
Example of a GuideSet object storing gRNA sequences targeting the coding sequence of human gene IQSEC3 (ENSG00000120645) for SpCas9 nuclease.
data(guideSetExample, package="crisprDesign")data(guideSetExample, package="crisprDesign")
A GuideSet object.
The object was obtained by calling findSpacers on the
CDS region of human gene IQSEC3. See code in
inst/scripts/generateGuideSet.R.
Example of a fully-annotated GuideSet object storing gRNA sequences targeting the coding sequence of human gene IQSEC3 (ENSG00000120645) for SpCas9 nuclease.
data(guideSetExampleFullAnnotation, package="crisprDesign")data(guideSetExampleFullAnnotation, package="crisprDesign")
A GuideSet object.
The object was obtained by applying all available add*
annotation functions in crisprDesign (e.g.
addSequenceFeatures) to a randomly selected 20-guide subset of
guideSetExample. See code in
inst/scripts/generateGuideSetFullAnnotation.R.
Example of a GuideSet object storing gRNA sequences targeting the coding sequence of human gene IQSEC3 (ENSG00000120645) for SpCas9 nuclease with off-target alignments.
data(guideSetExampleWithAlignments, package="crisprDesign")data(guideSetExampleWithAlignments, package="crisprDesign")
A GuideSet object.
The object was obtained by adding off-target alignments
to a randomly selected 20-guide subset of
guideSetExample. See code in
inst/scripts/generateGuideSetFullAnnotation.R.
An S4 class to store pairs of CRISPR gRNA sequences.
pamOrientation(object, ...) pamDistance(object, ...) spacerDistance(object, ...) cutLength(object, ...) PairedGuideSet(GuideSet1 = NULL, GuideSet2 = NULL) ## S4 method for signature 'PairedGuideSet' pamOrientation(object) ## S4 method for signature 'PairedGuideSet' pamDistance(object) ## S4 method for signature 'PairedGuideSet' spacerDistance(object) ## S4 method for signature 'PairedGuideSet' cutLength(object) ## S4 method for signature 'PairedGuideSet' crisprNuclease(object, index = NULL) ## S4 method for signature 'PairedGuideSet' spacers(object, as.character = FALSE, returnAsRna = FALSE, index = NULL) ## S4 method for signature 'PairedGuideSet' pams(object, as.character = FALSE, returnAsRna = FALSE, index = NULL) ## S4 method for signature 'PairedGuideSet' pamSites(object, index = NULL) ## S4 method for signature 'PairedGuideSet' cutSites(object, index = NULL) ## S4 method for signature 'PairedGuideSet' protospacers( object, as.character = FALSE, include.pam = FALSE, returnAsRna = FALSE, index = NULL ) ## S4 method for signature 'PairedGuideSet' spacerLength(object, index = NULL) ## S4 method for signature 'PairedGuideSet' pamLength(object, index = NULL) ## S4 method for signature 'PairedGuideSet' pamSide(object, index = NULL)pamOrientation(object, ...) pamDistance(object, ...) spacerDistance(object, ...) cutLength(object, ...) PairedGuideSet(GuideSet1 = NULL, GuideSet2 = NULL) ## S4 method for signature 'PairedGuideSet' pamOrientation(object) ## S4 method for signature 'PairedGuideSet' pamDistance(object) ## S4 method for signature 'PairedGuideSet' spacerDistance(object) ## S4 method for signature 'PairedGuideSet' cutLength(object) ## S4 method for signature 'PairedGuideSet' crisprNuclease(object, index = NULL) ## S4 method for signature 'PairedGuideSet' spacers(object, as.character = FALSE, returnAsRna = FALSE, index = NULL) ## S4 method for signature 'PairedGuideSet' pams(object, as.character = FALSE, returnAsRna = FALSE, index = NULL) ## S4 method for signature 'PairedGuideSet' pamSites(object, index = NULL) ## S4 method for signature 'PairedGuideSet' cutSites(object, index = NULL) ## S4 method for signature 'PairedGuideSet' protospacers( object, as.character = FALSE, include.pam = FALSE, returnAsRna = FALSE, index = NULL ) ## S4 method for signature 'PairedGuideSet' spacerLength(object, index = NULL) ## S4 method for signature 'PairedGuideSet' pamLength(object, index = NULL) ## S4 method for signature 'PairedGuideSet' pamSide(object, index = NULL)
object |
PairedGuideSet object. |
... |
Additional arguments for class-specific methods |
GuideSet1 |
A GuideSet object containing gRNAs at the first position of the pairs. |
GuideSet2 |
A GuideSet object containing gRNAs at the second position of the pairs. |
index |
Integer value indicating gRNA position. Must be either 1, 2, or NULL (default). If NULL, both positions are returned. |
as.character |
Should sequences be returned as a character vector? FALSE by default, in which case sequences are returned as a DNAStringSet. |
returnAsRna |
Should the sequences be returned as RNA instead of DNA? FALSE by default. |
include.pam |
Should PAM sequences be included? FALSE by default. |
A PairedGuideSet object.
PairedGuideSet(): Create a PairedGuideSet object
Use the constructor link{PairedGuideSet} to create a
PairedGuideSet object.
library(crisprDesign) data(guideSetExample, package="crisprDesign") gs <- guideSetExample gs <- gs[order(BiocGenerics::start(gs))] gs1 <- gs[1:10] gs2 <- gs[1:10+10] pgs <- PairedGuideSet(gs1, gs2)library(crisprDesign) data(guideSetExample, package="crisprDesign") gs <- guideSetExample gs <- gs[order(BiocGenerics::start(gs))] gs1 <- gs[1:10] gs2 <- gs[1:10+10] pgs <- PairedGuideSet(gs1, gs2)
Obtain Pfam domains from biomaRt for all transcripts found in a gene model object.
preparePfamTable(txObject, mart_dataset)preparePfamTable(txObject, mart_dataset)
txObject |
A TxDb object or a
GRangesList object obtained using
|
mart_dataset |
String specifying dataset to be used by biomaRt for Pfam domains annotation . E.g. "hsapiens_gene_ensembl". |
A DataFrame object with the following columns:
ensembl_transcript_id Ensembl transcript ID.
pfam Pfam domain name.
pfam_start Start amino acid coordinate of the Pfam domain.
pfam_end End amino acid coordinate of the Pfam domain.
Jean-Philippe Fortin, Luke Hoberecht
data(grListExample, package="crisprDesign") if (interactive()){ pfamTable <- preparePfamTable(grListExample, mart_dataset="hsapiens_gene_ensembl") }data(grListExample, package="crisprDesign") if (interactive()){ pfamTable <- preparePfamTable(grListExample, mart_dataset="hsapiens_gene_ensembl") }
Convenience function to search for TSS coordinates.
queryTss(tssObject, queryColumn, queryValue, tss_window = NULL)queryTss(tssObject, queryColumn, queryValue, tss_window = NULL)
tssObject |
A GRanges containing genomic positions of transcription starting sites (TSSs). |
queryColumn |
String specifying which column of |
queryValue |
Character vector specifying the values to search for
in |
tss_window |
Numeric vector of length 2 establishing the genomic
region to return. The value pair sets the 5 prime and 3 prime limits,
respectively, of the genomic region with respect to the TSS. Use
negative value(s) to set limit(s) upstream of the TSS. Default is
|
A GRanges object. Searches yielding no results will return an empty GRanges object.
Luke Hoberecht, Jean-Philippe Fortin
queryTxObject for querying gene annotations.
data(tssObjectExample, package="crisprDesign") queryTss(tssObjectExample, queryColumn="gene_symbol", queryValue="IQSEC3")data(tssObjectExample, package="crisprDesign") queryTss(tssObjectExample, queryColumn="gene_symbol", queryValue="IQSEC3")
Convenience function to search for gene coordinates.
queryTxObject( txObject, featureType = c("transcripts", "exons", "cds", "fiveUTRs", "threeUTRs", "introns"), queryColumn, queryValue )queryTxObject( txObject, featureType = c("transcripts", "exons", "cds", "fiveUTRs", "threeUTRs", "introns"), queryColumn, queryValue )
txObject |
A TxDb object or a GRangesList
object obtained using |
featureType |
The genomic feature in |
queryColumn |
Character string specifying the column in
|
queryValue |
Vector specifying the value(s) to search for in
|
A GRanges object. Searches yielding no results will return an empty GRanges object.
Luke Hoberecht, Jean-Philippe Fortin
queryTss for querying TSS annotations.
data(grListExample, package="crisprDesign") queryTxObject(grListExample, featureType="cds", queryColumn="gene_symbol", queryValue="IQSEC3")data(grListExample, package="crisprDesign") queryTxObject(grListExample, featureType="cds", queryColumn="gene_symbol", queryValue="IQSEC3")
Function for ranking spacers using recommended crisprDesign criteria. CRISPRko, CRISPRa and CRISPRi modalities are supported.
rankSpacers( guideSet, tx_id = NULL, commonExon = FALSE, modality = c("CRISPRko", "CRISPRa", "CRISPRi"), useDistanceToTss = TRUE )rankSpacers( guideSet, tx_id = NULL, commonExon = FALSE, modality = c("CRISPRko", "CRISPRa", "CRISPRi"), useDistanceToTss = TRUE )
guideSet |
A GuideSet object. |
tx_id |
Optional string specifying transcript ID to use isoform-specific information for gRNA ranking. |
commonExon |
Should gRNAs targeting common exons by prioritized?
FALSE by default. If TRUE, |
modality |
String specifying the CRISPR modality. Should be one of the following: "CRISPRko", "CRISPRa", or "CRISPRi". |
useDistanceToTss |
Should distance to TSS be used to rank gRNAs
for CRISPRa and CRISPRi applications? TRUE by default.
For SpCas9 and human targets, this should be set to FALSE if
|
For each nuclease, we rank gRNAs based on several rounds of priority. For SpCas9, gRNAs with unique target sequences and without 1-or 2-mismatch off-targets located in coding regions are placed into the first round. Then, gRNAs with a small number of one- or two-mismatch off-targets (less than 5) are placed into the second round. Remaining gRNAs are placed into the third round. Finally, any gRNAs overlapping a common SNP (human only), containing a polyT stretch, or with extreme GC content (below 20 are placed into the fourth round.
If tx_id is specified, within each round of selection, gRNAs
targeting the first 85 percent of the specific transcript are
prioritized first. If tx_id is specified, and commonExon
is set to TRUE, gRNAs targeting common exons across isoforms are also
prioritized. If a conservation score is available, gRNAs
targeting conserved regions (phyloP conservation score greater than 0),
are also prioritized.
Within each bin, gRNAs are ranked by a composite on-target activity rank to prioritize active gRNAs. The composite on-target activity rank is calculated by taking the average rank across the DeepHF and RuleSet3 scores for CRISPRko. For CRISPRa or CRISPRi, the CRISPRai scores are used if available.
The process is identical for enAsCas12a, with the exception that the enPAMGb method is used as the composite score.
For CasRx, gRNAs targeting all isoforms of a given gene, with no 1- or 2-mismatch off-targets, are placed into the first round. gRNAs targeting at least 50 percent of the isoforms of a given gene, with no 1- or 2-mismatch off-targets, are placed into the second round. Remaining gRNAs are placed into the third round. Within each round of selection, gRNAs are further ranked by the CasRxRF on-target score.
A GuideSet object ranked from best to worst gRNAs,
with a column rank stored in mcols(guideSet) indicating
gRNA rank.
Luke Hoberecht, Jean-Philippe Fortin
data(guideSetExampleFullAnnotation, package="crisprDesign") gs <- rankSpacers(guideSetExampleFullAnnotation, tx_id = "ENST00000538872") gsdata(guideSetExampleFullAnnotation, package="crisprDesign") gs <- rankSpacers(guideSetExampleFullAnnotation, tx_id = "ENST00000538872") gs
Remove GuideSet gRNAs that overlap repeat elements.
removeRepeats(object, ...) ## S4 method for signature 'GuideSet' removeRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'PairedGuideSet' removeRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'NULL' removeRepeats(object)removeRepeats(object, ...) ## S4 method for signature 'GuideSet' removeRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'PairedGuideSet' removeRepeats(object, gr.repeats = NULL, ignore.strand = TRUE) ## S4 method for signature 'NULL' removeRepeats(object)
object |
A GuideSet object or a PairedGuideSet object. |
... |
Additional arguments, currently ignored. |
gr.repeats |
A GRanges object containing repeat elements regions. |
ignore.strand |
Should gene strand be ignored when annotating? TRUE by default. |
object filtered for spacer sequences not overlapping
any repeat elements. An inRepeats column is also appended in
mcols(object).
Jean-Philippe Fortin, Luke Hoberecht
link{addRepeats}.
data(guideSetExample, package="crisprDesign") data(grRepeatsExample, package="crisprDesign") guideSet <- removeRepeats(guideSetExample, gr.repeats=grRepeatsExample)data(guideSetExample, package="crisprDesign") data(grRepeatsExample, package="crisprDesign") guideSet <- removeRepeats(guideSetExample, gr.repeats=grRepeatsExample)
Remove gRNAs targeting secondary targets
removeSpacersWithSecondaryTargets( guideSet, geneID, geneColumn = "gene_id", ignoreGenesWithoutSymbols = TRUE, ignoreReadthroughs = TRUE )removeSpacersWithSecondaryTargets( guideSet, geneID, geneColumn = "gene_id", ignoreGenesWithoutSymbols = TRUE, ignoreReadthroughs = TRUE )
guideSet |
A GuideSet object. |
geneID |
String specifying gene ID of the main gene target. |
geneColumn |
Column in |
ignoreGenesWithoutSymbols |
Should gene without gene symbols be ignored when removing co-targeting gRNAs? |
ignoreReadthroughs |
Should readthrough genes be ignored when removing co-targeting gRNAs? |
The protospacer target sequence of gRNAs can be located in overlapping genes, and this function allows users to filter out such gRNAs. This ensures remaining gRNAs are targeting only one gene.
A GuideSet object with gRNAs targeting multiple targets removed.
Jean-Philippe Fortin
Example of a GRanges object containing genomic coordinates of SNPs in the neighborhood of human gene IQSEC3 (ENSG00000120645).
data(snpObjectExample, package="crisprDesign")data(snpObjectExample, package="crisprDesign")
A GRanges object.
Example of a GRanges containing transcription starting site (TSS) coordinates for human gene IQSEC3 (ENSG00000120645).
data(tssObjectExample, package="crisprDesign")data(tssObjectExample, package="crisprDesign")
GRanges object of length 2 corresponding to the 2 TSSs of gene IQSEC3.
The TSS coordinates were obtained from the two transcript
stored in the grListExample object for gene IQSEC3.
Convenience function to reformat a TxDb object into a GRangesList.
TxDb2GRangesList( txdb, standardChromOnly = TRUE, genome = NULL, seqlevelsStyle = c("UCSC", "NCBI") )TxDb2GRangesList( txdb, standardChromOnly = TRUE, genome = NULL, seqlevelsStyle = c("UCSC", "NCBI") )
txdb |
A TxDb object. |
standardChromOnly |
Should only standard chromosomes be kept? TRUE by default. |
genome |
Optional string specifying genome. e.g. "hg38", to be
added to |
seqlevelsStyle |
String specifying which style should be used for sequence names. "UCSC" by default (including "chr"). "NCBI" will omit "chr" in the sequence names. |
A named GRangesList of length 7 with the
following elements:
transcripts, exons, introns, cds,
fiveUTRs, threeUTRs and tss.
Jean-Philippe Fortin, Luke Hoberecht
getTxDb to obtain a TxDb object.
if (interactive()){ # To obtain a TxDb for Homo sapiens from Ensembl: txdb <- getTxDb() # To convert to a GRanges list: txdb <- TxDb2GRangesList(txdb) }if (interactive()){ # To obtain a TxDb for Homo sapiens from Ensembl: txdb <- getTxDb() # To convert to a GRanges list: txdb <- TxDb2GRangesList(txdb) }
Update OPS library with additional gRNAs
updateOpsLibrary( opsLibrary, df, n_guides = 4, gene_field = "gene", min_dist_edit = 2, dist_method = c("hamming", "levenshtein"), splitByChunks = FALSE )updateOpsLibrary( opsLibrary, df, n_guides = 4, gene_field = "gene", min_dist_edit = 2, dist_method = c("hamming", "levenshtein"), splitByChunks = FALSE )
opsLibrary |
data.frame obtained from |
df |
data.frame containing information about additional candidate gRNAs to add to the OPS library. |
n_guides |
Integer specifying how many gRNAs per gene should be selected. 4 by default. |
gene_field |
String specifying the column in |
min_dist_edit |
Integer specifying the minimum distance edit required for barcodes to be considered dissimilar. Barcodes that have edit distances less than the min_dist_edit will not be included in the library. 2 by default. |
dist_method |
String specifying distance method. Must be either "hamming" (default) or "levenshtein". |
splitByChunks |
Should distances be calculated in a chunk-wise manner? FALSE by default. Highly recommended when the set of query barcodes is large to reduce memory footprint. |
A data.frame containing the original gRNAs from
the input opsLibrary data.frame as well as additional
gRNAs selected from the input data.frame df.
Jean-Philippe Fortin
data(guideSetExample, package="crisprDesign") guideSet <- unique(guideSetExample) guideSet <- addOpsBarcodes(guideSet) guideSet1 <- guideSet[1:200] guideSet2 <- guideSet[201:400] df1 <- data.frame(ID=names(guideSet1), spacer=spacers(guideSet1, as.character=TRUE), opsBarcode=as.character(guideSet1$opsBarcode)) df2 <- data.frame(ID=names(guideSet2), spacer=spacers(guideSet2, as.character=TRUE), opsBarcode=as.character(guideSet2$opsBarcode)) # Creating mock gene: df1$gene <- rep(paste0("gene",1:10),each=20) df2$gene <- rep(paste0("gene",1:10+10),each=20) df1$rank <- rep(1:20,10) df2$rank <- rep(1:20,10) opsLib <- designOpsLibrary(df1) opsLib <- updateOpsLibrary(opsLib, df2)data(guideSetExample, package="crisprDesign") guideSet <- unique(guideSetExample) guideSet <- addOpsBarcodes(guideSet) guideSet1 <- guideSet[1:200] guideSet2 <- guideSet[201:400] df1 <- data.frame(ID=names(guideSet1), spacer=spacers(guideSet1, as.character=TRUE), opsBarcode=as.character(guideSet1$opsBarcode)) df2 <- data.frame(ID=names(guideSet2), spacer=spacers(guideSet2, as.character=TRUE), opsBarcode=as.character(guideSet2$opsBarcode)) # Creating mock gene: df1$gene <- rep(paste0("gene",1:10),each=20) df2$gene <- rep(paste0("gene",1:10+10),each=20) df1$rank <- rep(1:20,10) df2$rank <- rep(1:20,10) opsLib <- designOpsLibrary(df1) opsLib <- updateOpsLibrary(opsLib, df2)
Validate gRNA library for optical pooled screening
validateOpsLibrary( df, min_dist_edit = 2, dist_method = c("hamming", "levenshtein") )validateOpsLibrary( df, min_dist_edit = 2, dist_method = c("hamming", "levenshtein") )
df |
data.frame containing information about candidate gRNAs from which to build the OPS library. See details. |
min_dist_edit |
Integer specifying the minimum distance edit required for barcodes to be considered dissimilar. |
dist_method |
String specifying distance method. Must be either "hamming" (default) or "levenshtein". |
The original df is all checks pass.
Otherwise, a stop error.
Jean-Philippe Fortin
data(guideSetExample, package="crisprDesign") guideSet <- unique(guideSetExample) guideSet <- addOpsBarcodes(guideSet) df <- data.frame(ID=names(guideSet), spacer=spacers(guideSet, as.character=TRUE), opsBarcode=as.character(guideSet$opsBarcode)) df$gene <- rep(paste0("gene",1:40),each=20) df$rank <- rep(1:20,40) opsLib <- designOpsLibrary(df) opsLib <- validateOpsLibrary(opsLib)data(guideSetExample, package="crisprDesign") guideSet <- unique(guideSetExample) guideSet <- addOpsBarcodes(guideSet) df <- data.frame(ID=names(guideSet), spacer=spacers(guideSet, as.character=TRUE), opsBarcode=as.character(guideSet$opsBarcode)) df$gene <- rep(paste0("gene",1:40),each=20) df$rank <- rep(1:20,40) opsLib <- designOpsLibrary(df) opsLib <- validateOpsLibrary(opsLib)