The Structstrings package implements the widely used dot
bracket annotation to store base pairing information in structured RNA.
For example it is used in the ViennaRNA package (Lorenz et al. 2011), the tRNAscan-SE software
(Lowe and Eddy 1997) and the tRNAdb (Jühling et al. 2009).
Structstrings uses the infrastructure provided by the Biostrings package (H.
Pagès, P. Aboyoun, R. Gentleman, and S. DebRoy, n.d.) and derives
the class DotBracketString and related classes from the
BString class. From these base pair tables can be produced
for in depth analysis, for which the DotBracketDataFrame
class is derived from the DataFrame class. In addition, the
loop indices of the base pairs can be retrieved as a
LoopIndexList, a derivate if the IntegerList
class. Generally, all classes check automatically for the validity of
the base pairing information.
The conversion of the DotBracketString to the base pair
table and the loop indices is implemented in C for efficiency. The C
implementation to a large extent inspired by the ViennaRNA package.
This package was developed as an improvement for the
tRNA package. However, other projects might benefit as
well, so it was split of and improved upon.
The package is installed from Bioconductor and loaded.
if(!requireNamespace("BiocManager", quietly = TRUE))
install.packages("BiocManager")
BiocManager::install("Structstrings")
library(Structstrings)DotBracketString objects can be created from character
as any other XString. The validity of the structure
information is checked upon creation or modification of the object.
## 12-letter DotBracketString object
## seq: ((((....))))
# a StringSet with four hairpin structures, which are all equivalent
dbs <- DotBracketStringSet(c("((((....))))",
"<<<<....>>>>",
"[[[[....]]]]",
"{{{{....}}}}"))
dbs## DotBracketStringSet object of length 4:
## width seq
## [1] 12 ((((....))))
## [2] 12 <<<<....>>>>
## [3] 12 [[[[....]]]]
## [4] 12 {{{{....}}}}
# StringSetList for storing even more structure annotations
dbsl <- DotBracketStringSetList(dbs,rev(dbs))
dbsl## DotBracketStringSetList of length 2
## [[1]] ((((....)))) <<<<....>>>> [[[[....]]]] {{{{....}}}}
## [[2]] {{{{....}}}} [[[[....]]]] <<<<....>>>> ((((....))))
## Error in `validObject()`:
## ! invalid class "DotBracketString" object:
## Following structures are invalid:
## '1'.
## They contain unmatched positions.
Annotations can be converted using the convertAnnotation
function.
dbs[[2L]] <- convertAnnotation(dbs[[2L]],from = 2L, to = 1L)
dbs[[3L]] <- convertAnnotation(dbs[[3L]],from = 3L, to = 1L)
dbs[[4L]] <- convertAnnotation(dbs[[4L]],from = 4L, to = 1L)
# Note: convertAnnotation checks for presence of annotation and stops
# if there is any conflict.
dbs## DotBracketStringSet object of length 4:
## width seq
## [1] 12 ((((....))))
## [2] 12 ((((....))))
## [3] 12 ((((....))))
## [4] 12 ((((....))))
The dot bracket annotation can be turned into a base pairing table,
which allows the base pairing information to be queried more easily. For
example, the tRNA package makes uses this to identify the
structural elements for tRNAs.
For this purpose the class DotBracketDataFrame is
derived from DataFrame. This special DataFrame
can only contain 5 columns, pos, forward,
reverse character, base. The
first three are obligatory, whereas the last two are optional.
## DotBracketDataFrame with 12 rows and 4 columns
## pos forward reverse character
## <integer> <integer> <integer> <character>
## 1 1 1 12 (
## 2 2 2 11 (
## 3 3 3 10 (
## 4 4 4 9 (
## 5 5 0 0 .
## ... ... ... ... ...
## 8 8 0 0 .
## 9 9 9 4 )
## 10 10 10 3 )
## 11 11 11 2 )
## 12 12 12 1 )
The types of each column are also fixed as shown in the example
above. The fifth column not shown above must be an
XStringSet object.
Additionally, loop indices can be generated for the individual annotation types. These information can also be used to distinguish structure elements.
## [1] 1 2 3 4 4 4 4 4 4 3 2 1
# can also be constructed from DotBracketDataFrame and contains the same
# information
loopids2 <- getLoopIndices(dbdfl, bracket.type = 1L)
all(loopids == loopids2)##
## TRUE TRUE TRUE TRUE
The dot bracket annotation can be recreated from a
DotBracketDataFrame object with the function
getDotBracket(). If the character column is
present, this informations is just concatenated and used to create a
DotBracketString. If it is not present or
force.bracket is set to TRUE, the dot bracket
string is created from the base pairing information.
rec_dbs <- getDotBracket(dbdfl)
dbdf <- unlist(dbdfl)
dbdf$character <- NULL
dbdfl2 <- relist(dbdf,dbdfl)
# even if the character column is not set, the dot bracket string can be created
rec_dbs2 <- getDotBracket(dbdfl2)
rec_dbs3 <- getDotBracket(dbdfl, force = TRUE)
rec_dbs[[1L]]## 12-letter DotBracketString object
## seq: ((((....))))
## 12-letter DotBracketString object
## seq: ((((....))))
## 12-letter DotBracketString object
## seq: ((((....))))
Please be aware that getDotBracket() might return a
different output than original input, if this information is turned
around from a DotBracketString to
DotBracketDataFrame and back to a
DotBracketString. First the () annotation is
used followed by <>, [] and
{} in this order.
For a DotBracketString containing only one type of
annotation this might not mean much, except if the
character string itself is evaluated. However, if
pseudoloops are present, this will lead potentially to a reformated and
simplified annotation.
## 52-letter DotBracketString object
## seq: ((((....[[[))))....((((....<<<<...))))]]]....>>>>...
## 52-letter DotBracketString object
## seq: ((((....<<<))))....<<<<....[[[[...>>>>>>>....]]]]...
To store a nucleotide sequence and a structure in one object, the
classes StructuredRNAStringSet are implemented.
data("dbs", package = "Structstrings")
data("nseq", package = "Structstrings")
sdbs <- StructuredRNAStringSet(nseq,dbs)
sdbs[1L]## A StructuredRNAStringSet instance containing:
##
## RNAStringSet object of length 1:
## width seq names
## [1] 72 GGGCGUGUGGUCUAGUGGUAUGA...GGGUUCAAUUCCCAGCUCGCCCC Sequence 1
##
## DotBracketStringSet object of length 1:
## width seq names
## [1] 72 (((((.(..(((.........))...(((.......)))))).))))). Sequence 1
## 72-letter RNAString object
## seq: GGGCGUGUGGUCUAGUGGUAUGAUUCUCGCUUUGGGUGCGAGAGGCCCUGGGUUCAAUUCCCAGCUCGCCCC
## 72-letter DotBracketString object
## seq: (((((.(..(((.........))).(((((.......))))).....(((((.......)))))).))))).
The base pair table can be directly accessed using
getBasePairing(). The base column is
automatically populated from the nucleotide sequence. This is a bit
slower than just creating the base pair table. Therefore this step can
be omitted by setting return.sequence to
FALSE.
## DotBracketDataFrame with 72 rows and 4 columns
## pos forward reverse character
## <integer> <integer> <integer> <character>
## 1 1 1 71 (
## 2 2 2 70 (
## 3 3 3 69 (
## 4 4 4 68 (
## 5 5 5 67 (
## ... ... ... ... ...
## 68 68 68 4 )
## 69 69 69 3 )
## 70 70 70 2 )
## 71 71 71 1 )
## 72 72 0 0 .
# returns the result without sequence information
dbdfl <- getBasePairing(sdbs, return.sequence = TRUE)
dbdfl[[1L]]## DotBracketDataFrame with 72 rows and 5 columns
## pos forward reverse character base
## <integer> <integer> <integer> <character> <RNAStringSet>
## 1 1 1 71 ( G
## 2 2 2 70 ( G
## 3 3 3 69 ( G
## 4 4 4 68 ( C
## 5 5 5 67 ( G
## ... ... ... ... ... ...
## 68 68 68 4 ) G
## 69 69 69 3 ) C
## 70 70 70 2 ) C
## 71 71 71 1 ) C
## 72 72 0 0 . C
## R version 4.6.0 (2026-04-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 26.04 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.32.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] Structstrings_1.29.0 Biostrings_2.81.3 Seqinfo_1.3.0
## [4] XVector_0.53.0 IRanges_2.47.2 S4Vectors_0.51.3
## [7] BiocGenerics_0.59.7 generics_0.1.4 BiocStyle_2.41.0
##
## loaded via a namespace (and not attached):
## [1] vctrs_0.7.3 crayon_1.5.3 cli_3.6.6
## [4] knitr_1.51 rlang_1.2.0 xfun_0.59
## [7] stringi_1.8.7 otel_0.2.0 jsonlite_2.0.0
## [10] glue_1.8.1 buildtools_1.0.0 htmltools_0.5.9
## [13] maketools_1.3.2 sys_3.4.3 sass_0.4.10
## [16] rmarkdown_2.31 evaluate_1.0.5 jquerylib_0.1.4
## [19] fastmap_1.2.0 yaml_2.3.12 lifecycle_1.0.5
## [22] stringr_1.6.0 BiocManager_1.30.27 compiler_4.6.0
## [25] digest_0.6.39 R6_2.6.1 magrittr_2.0.5
## [28] bslib_0.11.0 tools_4.6.0 cachem_1.1.0