Title: | Functions for analyzing SELEX-seq data |
---|---|
Description: | Tools for quantifying DNA binding specificities based on SELEX-seq data. |
Authors: | Chaitanya Rastogi, Dahong Liu, Lucas Melo, and Harmen J. Bussemaker |
Maintainer: | Harmen J. Bussemaker <[email protected]> |
License: | GPL (>=2) |
Version: | 1.39.0 |
Built: | 2025-01-17 04:53:11 UTC |
Source: | https://github.com/bioc/SELEX |
Functions to assist in discovering transcription factor DNA binding specificities from SELEX-seq experimental data according to the Slattery et al. paper. For a more comprehensive example, please look at the vignette. Sample data used in the Slattery, et. al. is stored in the extdata
folder for the package, and can be accessed using either the base R function system.file
or the package function selex.exampledata
.
Functions available:
selex.affinities |
Construct a K-mer affinity table |
selex.config |
Set SELEX system parameters |
selex.counts |
Construct or retrieve a K-mer count table |
selex.countSummary |
Summarize available K-mer count tables |
selex.defineSample |
Define annotation for an individual sample |
selex.exampledata |
Extract example data files |
selex.fastqPSFM |
Construct a diagnostic PSFM for a FASTQ file |
selex.getAttributes |
Display sample handle attributes |
selex.getRound0 |
Obtain round zero sample handle |
selex.getSeqfilter |
Display sequence filter attributes |
selex.infogain |
Compute or retrieve information gain between rounds |
selex.infogainSummary |
Summarize available information gain values |
selex.jvmStatus |
Display current JVM memory usage |
selex.kmax |
Calculate kmax for a dataset |
selex.kmerPSFM |
Construct a PSFM from a K-mer table |
selex.loadAnnotation |
Load a sample annotation file |
selex.mm |
Build or retrieve a Markov model |
selex.mmProb |
Compute prior probability of sequence using Markov model |
selex.mmSummary |
Summarize Markov model properties |
selex.revcomp |
Create forward-reverse complement data pairs |
selex.run |
Run a standard SELEX analysis |
selex.sample |
Create a sample handle |
selex.sampleSummary |
Show samples visible to the current SELEX session |
selex.saveAnnotation |
Save sample annotations to file |
selex.seqfilter |
Create a sequence filter |
selex.setwd |
Set or change the working directory |
selex.split |
Randomly split a dataset |
selex.summary |
Display all count table, Markov model, and information gain summaries |
Package: | SELEX |
Type: | Package |
Version: | .99 |
Date: | 2014-11-3 |
License: | GPL |
Chaitanya Rastogi, Dahong Liu, and Harmen Bussemaker
Maintainer: Harmen Bussemaker [email protected]
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database sampleFiles = selex.exampledata(workDir) # Load & display all sample files using XML database selex.loadAnnotation(sampleFiles[3]) selex.sampleSummary() # Create sample handles r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) r2 = selex.sample(seqName='R2.libraries', sampleName='ExdHox.R2', round=2) # Split the r0 sample into testing and training sets r0.split = selex.split(sample=r0) r0.split # Display all currently loaded samples selex.sampleSummary() # Find kmax on the test dataset k = selex.kmax(sample=r0.split$test) # Build the Markov model on the training dataset mm = selex.mm(sample=r0.split$train, order=NA, crossValidationSample=r0.split$test) # See Markov model R^2 values selex.mmSummary() # Kmer counting with an offset t1 = selex.counts(sample=r2, k=2, offset=14, markovModel=NULL) # Kmer counting with a Markov model (produces expected counts) t2 = selex.counts(sample=r2, k=4, markovModel=mm) # Display all available kmer statistics selex.countSummary() # Calculate information gain ig = selex.infogain(sample=r2, k=8, mm) # View information gain results selex.infogainSummary() # Perform the default analysis selex.run(trainingSample=r0.split$train, crossValidationSample=r0.split$test, infoGainSample=r2) # View all stats selex.summary()
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database sampleFiles = selex.exampledata(workDir) # Load & display all sample files using XML database selex.loadAnnotation(sampleFiles[3]) selex.sampleSummary() # Create sample handles r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) r2 = selex.sample(seqName='R2.libraries', sampleName='ExdHox.R2', round=2) # Split the r0 sample into testing and training sets r0.split = selex.split(sample=r0) r0.split # Display all currently loaded samples selex.sampleSummary() # Find kmax on the test dataset k = selex.kmax(sample=r0.split$test) # Build the Markov model on the training dataset mm = selex.mm(sample=r0.split$train, order=NA, crossValidationSample=r0.split$test) # See Markov model R^2 values selex.mmSummary() # Kmer counting with an offset t1 = selex.counts(sample=r2, k=2, offset=14, markovModel=NULL) # Kmer counting with a Markov model (produces expected counts) t2 = selex.counts(sample=r2, k=4, markovModel=mm) # Display all available kmer statistics selex.countSummary() # Calculate information gain ig = selex.infogain(sample=r2, k=8, mm) # View information gain results selex.infogainSummary() # Perform the default analysis selex.run(trainingSample=r0.split$train, crossValidationSample=r0.split$test, infoGainSample=r2) # View all stats selex.summary()
A function used to calculate and return the affinities and affinity standard errors of K-mers of length k
for a given dataset in addition to all the output provided by selex.counts
. A Markov model is necessary for evaluation.
selex.affinities(sample, k, minCount=100, top=-1, numSort=TRUE, offset=NULL, markovModel=NULL, seqfilter=NULL)
selex.affinities(sample, k, minCount=100, top=-1, numSort=TRUE, offset=NULL, markovModel=NULL, seqfilter=NULL)
sample |
A sample handle to the dataset on which K-mer counting should be perfomed. |
k |
K-mer length(s) to be counted. |
minCount |
The minimum number of counts for a K-mer to be output. |
top |
Give the first N K-mers (by count). |
numSort |
Sort K-mers in descending order by count. If |
offset |
Location of window for which K-mers should be counted for. If not provided, K-mers are counted across all windows. |
markovModel |
Markov model handle to use to predict previous round probabilities and expected counts. |
seqfilter |
A sequence filter object to include/exclude sequences that are read in from the FASTQ file. |
When a new seqfilter
object is provided, K-mer counting and affinity table construction is redone. See selex.seqfilter
for more details.
See ‘References’ for more details regarding K-mer counting and affinity calculation.
selex.affinities
returns a data frame containing the K-mer sequence, observed counts, predicted prior observation probability, predicted prior observed counts, affinities, and standard errors.
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
selex.counts
, selex.infogain
, selex.kmax
, selex.mm
r2Aff = selex.affinities(sample=r2, k=10, markovModel=mm)
r2Aff = selex.affinities(sample=r2, k=10, markovModel=mm)
A function used to set system parameters for the SELEX package. These parameters are stored as global options, which are checked at runtime. They can be permanently set in a .Rprofile file, or changed temporarily by the user by invoking selex.config
. It is important to set java.parameters
before loading the SELEX library. See ‘Details’ for more information.
selex.config(workingDir=NULL, verbose=NULL, maxThreadNumber=NULL)
selex.config(workingDir=NULL, verbose=NULL, maxThreadNumber=NULL)
workingDir |
Physical location on disk for the current working directory. The full system path must be specified. |
verbose |
Print more output to terminal. Useful for debugging. |
maxThreadNumber |
The maximum number of threads to be used while K-mer counting. If unspecified, 4 threads will be used. |
The working directory is used to store the output of all analyses performed by the selex package. If a certain calculation has already been performed in the given working directory, the previously computed values are returned. If the specified path does not exist, selex.config
will attempt to create it. By default, a temporary directory is used.
It is important to set the Java memory options before loading the SELEX library to allocate enough memory to the JVM. You can allocate memory by calling options
and setting java.parameters
. -Xmx
must prefix the memory value; the code below allocates 1500 MB of RAM:options(java.parameters="-Xmx1500M")
If the memory option is unspecified, the default JVM memory setting will be used.
Not applicable
## Initialize SELEX #options(java.parameters="-Xmx1500M") #library(SELEX) ## Set working directory and verbose to true workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=TRUE, maxThreadNumber=4)
## Initialize SELEX #options(java.parameters="-Xmx1500M") #library(SELEX) ## Set working directory and verbose to true workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=TRUE, maxThreadNumber=4)
A function used to count and return the number of instances K-mers of length k
appear within the sample
's variable regions. If an offset
value is provided, K-mer counting takes place at a fixed position within the variable region of the read. If a Markov model is supplied, the expected count and the probability of observing the K-mer are also returned.
selex.counts(sample, k, minCount=100, top=-1, numSort=TRUE, offset=NULL, markovModel=NULL, forceCalculation=FALSE, seqfilter=NULL, outputPath = "")
selex.counts(sample, k, minCount=100, top=-1, numSort=TRUE, offset=NULL, markovModel=NULL, forceCalculation=FALSE, seqfilter=NULL, outputPath = "")
sample |
A sample handle to the dataset on which K-mer counting should be perfomed. |
k |
K-mer length(s) to be counted. |
minCount |
The minimum number of counts for a K-mer to be output. |
top |
Give the first N K-mers (by count). |
numSort |
Sort K-mers in descending order by count. If |
offset |
Location of window for which K-mers should be counted for. If not provided, K-mers are counted across all windows. |
markovModel |
Markov model handle to use to predict previous round probabilities and expected counts. |
forceCalculation |
Forces K-mer counting to be performed again, even if a previous result exists. |
seqfilter |
A sequence filter object to include/exclude sequences that are read in from the FASTQ file. |
outputPath |
Prints the computed K-mer table to a plain text file. This is useful when the number of unique K-mers in the dataset exceeds R's memory limit. |
The offset
feature counts K-mers of length k
offset
bp away from the 5' end in the variable region. For example, if we have 16-mer variable regions and wish to count K-mers of length 12 at an offset of 3 bp, we are looking at the K-mers found only at the position indicated by the bolded nucleotides in the variable region:
5' NNNNNNNNNNNNNNNN 3'
Minimum count refers to the lowest count observed for a kmer of length k for a given sample. Total count is the sum of counts over all kmers of length k for a given sample. These statistics can be viewed for all K-mer lengths and samples counting was performed on using selex.countSummary
. When a new seqfilter
object is provided, K-mer counting is redone. See selex.seqfilter
for more details.
See ‘References’ for more details regarding the K-mer counting process.
selex.counts
returns a data frame containing the K-mer sequence and observed counts for a given sample if a Markov model has not been supplied.
If a Markov model is supplied, a data frame containing K-mer sequence, observed counts, predicted previous round probability, and predicted previous round expected counts is returned.
If the number of unique K-mers exceeds R's memory limit, selex.counts
will cause R to crash when returning a data frame containing the K-mers. The outputPath
option can be used to avoid such a situation, as the Java code will directly write the table to a plain text file at the specified location instead.
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
selex.affinities
, selex.countSummary
, selex.infogain
, selex.kmax
, selex.mm
, selex.run
# Kmer counting for a specific length on a given dataset t1 = selex.counts(sample=r2, k=8, minCount=1) # Kmer counting with an offset t2 = selex.counts(sample=r2, k=2, offset=14, markovModel=NULL) # Kmer counting with a Markov model (produces expected counts) t3 = selex.counts(sample=r2, k=4, markovModel=mm) # Display all available kmer statistics selex.countSummary()
# Kmer counting for a specific length on a given dataset t1 = selex.counts(sample=r2, k=8, minCount=1) # Kmer counting with an offset t2 = selex.counts(sample=r2, k=2, offset=14, markovModel=NULL) # Kmer counting with a Markov model (produces expected counts) t3 = selex.counts(sample=r2, k=4, markovModel=mm) # Display all available kmer statistics selex.countSummary()
This function returns the sample, kmer length, offset, minimum/maximum count, total count, and applied filters for either all count tables or a specified sample in the current working directory.
selex.countSummary(sample=NULL, displayFilter=FALSE)
selex.countSummary(sample=NULL, displayFilter=FALSE)
sample |
A sample handle to the sample for which K-mer count statistics should be returned. |
displayFilter |
Display all applied sequence filter attributes. |
Minimum count refers to the lowest count observed for a kmer of length k for a given sample. Total count is the sum of counts over all kmers of length k for a given sample.
selex.countSummary
returns a data frame containing the sample, kmer length, offset, minimum/maximum count, total count, and applied filters for all count tables in the current working directory. If sample
is provided, the above information is given for the specific sample only.
selex.countSummary()
selex.countSummary()
A function used to manually load SELEX sample metadata and make it visible to the current session, which can then be used to create a sample handle (see selex.sample
. It is functionally identical to selex.loadAnnotation
, except constrained to take manual inputs for a single sample.
selex.defineSample(seqName, seqFile=NULL, sampleName, round, varLength, leftBarcode, rightBarcode, leftFlank=NULL, rightFlank=NULL, round0SeqName=NULL, round0SampleName=NULL)
selex.defineSample(seqName, seqFile=NULL, sampleName, round, varLength, leftBarcode, rightBarcode, leftFlank=NULL, rightFlank=NULL, round0SeqName=NULL, round0SampleName=NULL)
seqName |
Desired sequencing run name |
seqFile |
Path to the FASTQ file containing the sample. Can be |
sampleName |
Desired sample name |
round |
Sample round |
varLength |
Length of the variable region |
leftBarcode |
Left barcode sequence |
rightBarcode |
Right barcode sequence |
leftFlank |
Left flank sequence |
rightFlank |
Right flank sequence |
round0SeqName |
The sequencing run name of the round 0 data associated with this sample |
round0SampleName |
The sample name of the round 0 data associated with this sample |
selex.defineSample
should be used for rapid testing or when it is not worthwhile to generate a generate a sample annotation file. Unlike selex.loadAnnotation
, the unique name requirement is relaxed, requiring only unique seqName
, seqFile
, and round
combinations. Only one seqFile
can be specified for a given seqName
; for example, the following will throw an error: selex.defineSample('Seq1', 'Seq1.fastq.gz', round=1, rightBarcode='CCAGCTG', ...)
selex.defineSample('Seq1', 'Seq2.fastq.gz', round=2, rightBarcode='CCAGCTG', ...)
However, seqFile
can be omitted if a new sample is being specified with the same seqName
: selex.defineSample('Seq1', 'Seq1.fastq.gz', round=1, rightBarcode='CCAGCTG', ...)
selex.defineSample('Seq1', NULL, round=1, rightBarcode='CCACGTC', ...)
The sequencing run name and sample name of the round 0 file associated with a later-round sample can be provided to keep samples and their random pools in order.
Not applicable
selex.getAttributes
, selex.loadAnnotation
, selex.sample
, selex.sampleSummary
, selex.saveAnnotation
selex.defineSample(seqName='R0.libraries', seqFile=exampleFiles[1], sampleName='R0.barcodeGC', round = 0, varLength = 16, leftBarcode = 'TGG', rightBarcode= 'CCAGCTG')
selex.defineSample(seqName='R0.libraries', seqFile=exampleFiles[1], sampleName='R0.barcodeGC', round = 0, varLength = 16, leftBarcode = 'TGG', rightBarcode= 'CCAGCTG')
A function used to extract the sample files embedded in this package. The package contains 2 FASTQ files (R0.fastq.gz
and ExdHox.R2.fastq.gz
, and an XML configuration file (config.xml
).
selex.exampledata(outputFolder)
selex.exampledata(outputFolder)
outputFolder |
Location on disk where the files should be extracted. |
Not applicable
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database exampleFiles = selex.exampledata(workDir)
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database exampleFiles = selex.exampledata(workDir)
A function used to calculate and return the PFSM (Position Specific Frequency Matrix) for an entire FASTQ file, regardless of barcode or other sequence filtering.
selex.fastqPSFM(seqName)
selex.fastqPSFM(seqName)
seqName |
A sequencing run name for the desired FASTQ file; this must match a sequencing run name of a sample currently visible to the SELEX session. |
The output can be used by the seqLogo
package to create a sequence logo.
selex.fastqPSFM
returns a matrix containing the frequences for each base at every position.
# Display all currently loaded samples selex.sampleSummary() # Make PSFMs for the two visible FASTQ files: psfm1 = selex.fastqPSFM(seqName='R0.libraries') psfm2 = selex.fastqPSFM(seqName='R2.libraries') # Can make sequence logos using the seqLogo package: #library(seqLogo) #seqLogo(makePWM(t(psfm1)))
# Display all currently loaded samples selex.sampleSummary() # Make PSFMs for the two visible FASTQ files: psfm1 = selex.fastqPSFM(seqName='R0.libraries') psfm2 = selex.fastqPSFM(seqName='R2.libraries') # Can make sequence logos using the seqLogo package: #library(seqLogo) #seqLogo(makePWM(t(psfm1)))
A function used to output sample handle's sequencing run name, sample name, round, left and right barcode, file path, and variable region length of the sample handle.
selex.getAttributes(sample)
selex.getAttributes(sample)
sample |
A sample handle. |
selex.getAttributes
returns a data frame containing the sequencing run name, sample name, round, left and right barcode, file path, and variable region length of the sample handle.
selex.defineSample
, selex.loadAnnotation
, selex.sample
, selex.sampleSummary
# Create a sample handle r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) # Use the sample handle to display sample properties selex.getAttributes(r0)
# Create a sample handle r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) # Use the sample handle to display sample properties selex.getAttributes(r0)
A function used to return the sample handle of the round zero file associated with the input sample
.
selex.getRound0(sample)
selex.getRound0(sample)
sample |
A sample handle. |
selex.getRound0
returns a sample handle to the corresponding round zero file. The latter needs to be defined in the annotation table. If not, an error will be generated.
#Show currently visible samples selex.sampleSummary() #Return the matched roound zero file r2 = selex.sample(seqName='R2.libraries', sampleName='ExdHox.R2', round=2) r0 = selex.getRound0(r2) selex.getAttributes(r0)
#Show currently visible samples selex.sampleSummary() #Return the matched roound zero file r2 = selex.sample(seqName='R2.libraries', sampleName='ExdHox.R2', round=2) r0 = selex.getRound0(r2) selex.getAttributes(r0)
Display all regular expressions used in a sequence filter object.
selex.getSeqfilter(regex)
selex.getSeqfilter(regex)
regex |
A sequence filter object. |
A character string containing the regular expressions used in a sequence filter object.
selex.getSeqfilter(regex)
selex.getSeqfilter(regex)
A function used to compute and store the information gain for various K-mer lengths on sample
using markovModel
to predict prior probabilities.
selex.infogain(sample, k=NULL, markovModel, seqfilter=NULL, checkBarcode=TRUE)
selex.infogain(sample, k=NULL, markovModel, seqfilter=NULL, checkBarcode=TRUE)
sample |
A sample handle to the dataset on which to perform the analysis. |
k |
The range of K-mer lengths for which the information gain should be calculated. If |
markovModel |
A Markov model handle. |
seqfilter |
A sequence filter object to include/exclude sequences that are read in from the FASTQ file. |
checkBarcode |
Checks to see if the sample barcodes used to construct the Markov model match those in the current sample, and prevents computation if they do not match. |
selex.infogainSummary
is required to view the computed information gain values. When a new seqfilter
object is provided, the information gain analysis is redone. See selex.seqfilter
for more details.
See ‘References’ for more on the computation of information gain values.
selex.infogain
returns the highest information gain value.
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
selex.infogainSummary
, selex.mm
, selex.run
# Calculate information gain for a fixed range ig1 = selex.infogain(sample=r2, k=c(8:10), markovModel=mm) # View the results selex.infogainSummary()[,c(1,2,3,4,5)] # Now calculate for the default range ig2 = selex.infogain(sample=r2, markovModel=mm) # View the results again selex.infogainSummary()[,c(1,2,3,4,5)]
# Calculate information gain for a fixed range ig1 = selex.infogain(sample=r2, k=c(8:10), markovModel=mm) # View the results selex.infogainSummary()[,c(1,2,3,4,5)] # Now calculate for the default range ig2 = selex.infogain(sample=r2, markovModel=mm) # View the results again selex.infogainSummary()[,c(1,2,3,4,5)]
This function returns the sample, Kmer length, information gain value, Markov model/type, and applied filters for either all computed information gain values or a specified sample in the current working directory.
selex.infogainSummary(sample=NULL, displayFilter=FALSE)
selex.infogainSummary(sample=NULL, displayFilter=FALSE)
sample |
A sample handle to the sample for which information gain statistics should be returned. |
displayFilter |
Display all applied sequence filter attributes. |
selex.infogainSummary
returns a data frame containing the sample, Kmer length, information gain value, Markov model/type, and applied filters for all computed information gain values in the current working directory. If sample
is provided, the above information is given for the specific sample only.
selex.infogainSummary()
selex.infogainSummary()
A function that displays the current JVM memory usage.
selex.jvmStatus()
selex.jvmStatus()
selex.jvmStatus
is useful for verifying the proper installaztion and initialization of rJava. Setting verbose=FALSE
in selex.config
will disable terminal ouput and a call to selex.jvmStatus
will display nothing. If the current JVM memory allocation is suboptimal, settings can be changed using the memSize
option in selex.config
.
selex.jvmStatus
does not return a value.
selex.jvmStatus()
selex.jvmStatus()
This function returns the longest oligonucleotide length k such that all DNA sequences of length k (‘K-mers’) are found at least a minimum count number of times for the given sample.
selex.kmax(sample, threshold=100, seqfilter=NULL)
selex.kmax(sample, threshold=100, seqfilter=NULL)
sample |
A sample handle. |
threshold |
The minimum count to be used. |
seqfilter |
A sequence filter object to include/exclude sequences that are read in from the FASTQ file. |
The kmax value is used to build the Markov model training and cross-validation datasets. While selex.mm
contains a default kmax constructor, running selex.kmax
can be useful in building analysis-specific Markov models. selex.kmax
discovers the kmax value by building K-mer count tables; after completion, the K-mer count tables can be viewed using selex.counts
. When a new seqfilter
object is provided, the kmax value is recomputed. See selex.seqfilter
for more details.
selex.kmax
returns the kmax value.
selex.counts
, selex.mm
, selex.sample
, selex.seqfilter
kmax = selex.kmax(sample=r0, threshold=50)
kmax = selex.kmax(sample=r0, threshold=50)
A function used to calculate and return the PFSM (Position Specific Frequency Matrix) for a K-mer table of length k
from sample
. If an offset
value is provided, K-mer counting takes place at a fixed position within the variable region.
selex.kmerPSFM(sample, k, offset=NULL)
selex.kmerPSFM(sample, k, offset=NULL)
sample |
A sample handle to the dataset on which K-mer counting should be perfomed. |
k |
K-mer length(s) to be counted. |
offset |
Location of window for which K-mers should be counted for. If not provided, K-mers are counted across all windows. |
A K-mer table will be constructed for the specified sample
, length k
, and offset
if it does not already exist.
The output can be used by the seqLogo
package to create a sequence logo.
selex.kmerPSFM
returns a matrix containing the frequences for each base at every position.
# Build the PSFM psfm1 = selex.kmerPSFM(sample=r0, k=8, 0) # Can make sequence logos using the seqLogo package: #library(seqLogo) #seqLogo(makePWM(t(psfm1)))
# Build the PSFM psfm1 = selex.kmerPSFM(sample=r0, k=8, 0) # Can make sequence logos using the seqLogo package: #library(seqLogo) #seqLogo(makePWM(t(psfm1)))
A function used to load sample metadata contained within a sample annotation file and make it visible to the current SELEX session. These samples can then be used to create sample handles (see selex.sample
).
selex.loadAnnotation(config_path, data_folder=NULL)
selex.loadAnnotation(config_path, data_folder=NULL)
config_path |
Location on disk to the sample annotation file. |
data_folder |
Location on disk where FASTQ sample files are stored. This is either an absolute path, or relative to the location of the annotation file. If unspecified, it uses the parent folder of the annotation file. |
A sample annotation file is an XML file that acts as a database storing metadata for different SELEX experiments. Here, a SELEX experiment refers to a single SELEX round that has been sequenced. Such a database allows the user to explicitly store all relevant information in a structured manner for easy future access.
A sample annotation file is provided below. Every annotation file can contain multiple SequencingRunInfo
instances; every instance within an annotation file must contain a unique name. If multiple annotation files are used in a given SELEX session, all such names must be unique. For example, the following annotation files A and B
File A <SequencingRunInfo name="exdUbx.Run1">
and <SequencingRunInfo name="exdUbx.Run2">
File B <SequencingRunInfo name="exdUbx.Run1">
have a legal naming system if either File A or File B is used in a single SELEX session, but have an invalid naming system if both are used. In general, it is a good idea to ensure that every SequencingRunInfo
name is unique. Every SequencingRunInfo
instance references a single FASTQ file. The user has the option of providing additional metadata regarding the FASTQ file.
A SequencingRunInfo
instance can contain multiple Sample
s. Every Sample
name within a SequencingRunInfo
instance must contain a unique name and round combination. For example, <Sample name="exdLab", round="0">
and <Sample name="exdLab", round="1">
is a valid name Sample
name combinations while <Sample name="exdLab", round="0">
and <Sample name="exdLab", round="0">
is not. Non Round 0 Sample
s have the option of referencing a Round 0 file, working as a checking mechanism to prevent the wrong Round 0 sample from being used to analyze a later round sample.
Once samples have been loaded into the current SELEX session, a sample handle can be generated using the SequencingRunInfo
name, Sample
name, and Round
number. Sample handles make it easier to reference individual Sample
s while running an analysis. See selex.sample
for more information.
Not applicable
Sample annotation files are structured as follows:
<?xml version="1.0" encoding="UTF-8"?>
<SELEXSequencingConfig xmlns:xsi="http://www.columbia.edu/" xsi:noNamespaceSchemaLocation="selex.xsd">
<SequencingRunInfo name="exdUbx.exdScr.0"> <!– information needed for differentiating multiple sequencing info instances –>
<DataFile>/Users/Documents/Data/Run1.fastq.gz</DataFile> <!– absolute or relative path –>
<SequencingPlatform>Illumina</SequencingPlatform> <!– #optional –>
<ResearcherName>John Smith</ResearcherName> <!– #optional –>
<ResearcherEmail>[email protected]</ResearcherEmail> <!– #optional –>
<SequencingFacilityName>Columbia University Genome Center</SequencingFacilityName> <!– #optional –>
<SequencingFacilityEmail>[email protected]</SequencingFacilityEmail> <!– #optional –>
<Description>Ubx/Scr Round 0 Probes</Description> <!– #optional –>
<Notes>Our first SELEX Run</Notes> <!– #optional –>
<Sample name="barcodeCCAGCTG.v1" round="0">
<Protein>Probes</Protein>
<Concentration></Concentration> <!– #optional –>
<VariableRegionLength>16</VariableRegionLength>
<LeftFlank>GTTCAGAGTTCTACAGTCCGACGATCTGG</LeftFlank>
<RightFlank>CCAGCTGTCGTATGCCGTCTTCTGCTTG</RightFlank>
<LeftBarcode>TGG</LeftBarcode>
<RightBarcode>CCAGCTG</RightBarcode>
<Round0></Round0>
<Notes></Notes> <!– #optional –>
</Sample>
<Sample name="barcodeCCACGTC.v1" round="0">
<Protein>Probes</Protein>
<Concentration></Concentration>
<VariableRegionLength>16</VariableRegionLength>
<LeftFlank>GTTCAGAGTTCTACAGTCCGACGATCTGG</LeftFlank>
<RightFlank>CCACGTCTCGTATGCCGTCTTCTGCTTG</RightFlank>
<LeftBarcode>TGG</LeftBarcode>
<RightBarcode>CCACGTC</RightBarcode>
<Round0></Round0>
<Notes></Notes>
</Sample>
</SequencingRunInfo>
<!– #New FASTQ file below –>
<SequencingRunInfo name="exdUbx.exdScr.L.2">
<DataFile>/Users/Documents/Data/Run2.fastq.gz</DataFile>
<SequencingPlatform>Illumina</SequencingPlatform>
<ResearcherName>John Smith</ResearcherName>
<ResearcherEmail>[email protected]</ResearcherEmail>
<SequencingFacilityName>Columbia University Genome Center</SequencingFacilityName>
<SequencingFacilityEmail>[email protected]</SequencingFacilityEmail>
<Description>Ubx/Scr Round 2</Description>
<Notes>Our first SELEX Run</Notes>
<Sample name="barcodeCCAGCTG.v1.low" round="2">
<Protein>hmExdUbx</Protein>
<Concentration>low</Concentration>
<VariableRegionLength>16</VariableRegionLength>
<LeftFlank>GTTCAGAGTTCTACAGTCCGACGATCTGG</LeftFlank>
<RightFlank>CCAGCTGTCGTATGCCGTCTTCTGCTTG</RightFlank>
<LeftBarcode>TGG</LeftBarcode>
<RightBarcode>CCAGCTG</RightBarcode>
<Round0 sequencingName="exdUbx.exdScr.0" sampleName="barcodeCCAGCTG.v1"/>
<Notes></Notes>
</Sample>
</SequencingRunInfo>
</SELEXSequencingConfig>
selex.defineSample
, selex.getAttributes
, selex.sample
, selex.sampleSummary
, selex.saveAnnotation
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database sampleFiles = selex.exampledata(workDir) # Load & display all sample files using XML database selex.loadAnnotation(sampleFiles[3]) selex.sampleSummary() # Create a sample handle r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) # Use the sample handle to display sample properties selex.getAttributes(r0)
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database sampleFiles = selex.exampledata(workDir) # Load & display all sample files using XML database selex.loadAnnotation(sampleFiles[3]) selex.sampleSummary() # Create a sample handle r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) # Use the sample handle to display sample properties selex.getAttributes(r0)
A function used to compute and store a Markov model built by training and cross-validating on specified files. It returns a Markov model handle to conveniently reference the calculated model in other SELEX functions.
selex.mm(sample, order=NA, crossValidationSample=NULL, Kmax= NULL, seqfilter=NULL, mmMethod="DIVISION", mmWithLeftFlank=FALSE)
selex.mm(sample, order=NA, crossValidationSample=NULL, Kmax= NULL, seqfilter=NULL, mmMethod="DIVISION", mmWithLeftFlank=FALSE)
sample |
A sample handle to the training dataset. |
order |
The order of the Markov model to be built. If |
crossValidationSample |
A sample handle to the cross-validation dataset. If |
Kmax |
The K-mer length to determine model fit on. If |
seqfilter |
A sequence filter object to include/exclude sequences that are read in from the FASTQ file. |
mmMethod |
A character string indicating the algorithm used to evaluate the Markov model conditional probabilities. Can be either |
mmWithLeftFlank |
Predict expected counts by considering the sequences in the left flank of the variable region. See ‘Details’. |
selex.mm
builds an N-th order Markov model by training the model on the sample
dataset and tests its accuracy by attempting to predict the K-mer counts of the cross-validation dataset. This K-mer length is determined either by setting Kmax
or by an internal call to selex.kmax
. If a cross-validation dataset does not exist, selex.split
can be used to partition a dataset into testing and training datasets.
The Markov model uses conditional probabilities to predict the probability of observing a given K-mer. For example, let us consider the following 6-mer sequence:
AGGCTA
If a fourth-order Markov model were to predict the prior observation probability of the above sequence, the following would have to be evaluated:
These conditional probabilities can be evaluated using one of two algorithms. The TRANSITION
algorithm relies on K-mer counts of length equal to the order of the Markov model. For the example above,
The DIVISION
algorithm relies on K-mer frequencies for lengths equal to Markov model order and order-1. For the example above,
The the flanking sequences in the left flank of the variable region can be taken into consideration when predicting prior observation probabilities by setting mmWithLeftFlank
to TRUE
. If the left barcode of the sequence in the example above is TGG, P(AGG) in the prior probability becomes
After computation, the Markov model is stored in the working directory. When a new seqfilter
object is provided, the Markov model is reconstructed. See selex.seqfilter
for more details. See ‘References’ for more details regarding the model construction process. selex.mmSummary
can be used to view the R^2 values for all orders that have been computed for the Markov model. If crossValidationSample
is NULL
, the resulting Markov model will not be displayed by selex.mmSummary
.
selex.mm
returns a Markov model handle.
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
selex.counts
, selex.infogain
, selex.kmax
, selex.mmSummary
, selex.run
, selex.split
mm = selex.mm(sample=r0.split$train, order=NA, crossValidationSample=r0.split$test) # View Markov model R^2 values selex.mmSummary()
mm = selex.mm(sample=r0.split$train, order=NA, crossValidationSample=r0.split$test) # View Markov model R^2 values selex.mmSummary()
A function used to calculate and return the prior observation probability of a DNA sequence seqStr
as predicted by Markov model markovModel
.
selex.mmProb(seqStr, markovModel)
selex.mmProb(seqStr, markovModel)
seqStr |
A character string representing the DNA sequence to be evaluated. |
markovModel |
A Markov model handle. |
selex.mm
returns the prior observation probability of seqStr
.
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
# Build the Markov model on the training dataset mm = selex.mm(sample=r0.split$train, order=NA, crossValidationSample=r0.split$test) # Compute expected Markov model probability value for a random 12-mer selex.mmProb(seqStr="ATTGCAGACTTG", markovModel=mm)
# Build the Markov model on the training dataset mm = selex.mm(sample=r0.split$train, order=NA, crossValidationSample=r0.split$test) # Compute expected Markov model probability value for a random 12-mer selex.mmProb(seqStr="ATTGCAGACTTG", markovModel=mm)
This function returns sample, order, Markov model type, R^2 value, cross validation sample/length, and applied filters for either all computed Markov models or a specified sample in the current working directory.
selex.mmSummary(sample=NULL, displayFilter=FALSE)
selex.mmSummary(sample=NULL, displayFilter=FALSE)
sample |
A sample handle to the sample for which Markov model information should be returned. |
displayFilter |
Display all applied sequence filter attributes. |
selex.mmSummary
returns a data frame containing the sample, order, Markov model type, R^2 value, cross validation sample/length, and applied filters for all computed Markov models in the current working directory. If sample
is provided, the above information is given for the specific sample only.
selex.mmSummary()
selex.mmSummary()
A function used to find and return the reverse complement of K-mers and the values associated with them. It is useful for calculating forward/reverse complement symmetrized values.
selex.revcomp(kmer,value)
selex.revcomp(kmer,value)
kmer |
A string array representing K-mers. |
value |
An array of associated values. |
selex.revcomp
finds and returns the reverse complement and associated value of every input K-mer, if it exists. If a reverse complement does not exist for a given K-mer, it is removed from the output. For example, consider the following K-mer and value arrays:
ACGT | .34 | |
GCTA | .22 | |
CGAC | .98 | |
TAGC | .19 |
The output of selex.revcomp
will be:
ACGT | .34 | ACGT | .34 | |||
GCTA | .22 | TAGC | .19 | |||
TAGC | .19 | GCTA | .22 |
selex.revcomp
returns a data frame containing the original K-mers and values, along with their reverse complements and associated values.
selex.affinities
, selex.counts
# Find round 2 affinities r2Aff = selex.affinities(sample=r2, k=10, markovModel=mm) # Find the reverse complement affinities and standard errors Aff = selex.revcomp(kmer=r2Aff$Kmer, value=r2Aff$Affinity) SE = selex.revcomp(kmer=r2Aff$Kmer, value=r2Aff$SE) # Find the forward/reverse complement symmetrized Affinity and SE values symAff = (Aff$Value+Aff$Reverse.Complement.Values)/2 symSE = sqrt((SE$Value^2+SE$Reverse.Complement.Values^2)/2) # Final Result final = data.frame(Kmer=Aff$Kmer, Affinity=Aff$Value, SymmetrizedAffinity=symAff/max(symAff), SE=SE$Value, SymmetrizedSE=symSE/max(symAff)) final = final[order(-final$SymmetrizedAffinity),]
# Find round 2 affinities r2Aff = selex.affinities(sample=r2, k=10, markovModel=mm) # Find the reverse complement affinities and standard errors Aff = selex.revcomp(kmer=r2Aff$Kmer, value=r2Aff$Affinity) SE = selex.revcomp(kmer=r2Aff$Kmer, value=r2Aff$SE) # Find the forward/reverse complement symmetrized Affinity and SE values symAff = (Aff$Value+Aff$Reverse.Complement.Values)/2 symSE = sqrt((SE$Value^2+SE$Reverse.Complement.Values^2)/2) # Final Result final = data.frame(Kmer=Aff$Kmer, Affinity=Aff$Value, SymmetrizedAffinity=symAff/max(symAff), SE=SE$Value, SymmetrizedSE=symSE/max(symAff)) final = final[order(-final$SymmetrizedAffinity),]
A function used to, in one shot,
Determine kmax on the crossValidationSample
with the minimum count determined by minCount
Build a Markov model on the trainingSample
and test it on the crossValidationSample
with kmax length K-mers used to determine model fit, and constructed using mmMethod
Calculate information gain for infoRange
K-mer lengths on the infoGainSample
, using the Markov model order with the highest R^2 to predict previous round values.
selex.run(trainingSample, crossValidationSample, minCount=100, infoGainSample, infoRange=NULL, mmMethod="DIVISION", mmWithLeftFlank=FALSE)
selex.run(trainingSample, crossValidationSample, minCount=100, infoGainSample, infoRange=NULL, mmMethod="DIVISION", mmWithLeftFlank=FALSE)
trainingSample |
A sample handle to the training dataset. |
crossValidationSample |
A sample handle to the cross-validation dataset. |
minCount |
The minimum count to be used. |
infoGainSample |
A sample handle to the dataset on which to perform the information gain analysis. |
infoRange |
The range of K-mer lengths for which the information gain should be calculated. If |
mmMethod |
A character string indicating the algorithm used to evaluate the Markov model conditional probabilities. Can be either |
mmWithLeftFlank |
Predict expected counts by considering the sequences in the left flank of the variable region. |
Please see the individual functions or ‘References’ for more details.
Not applicable
Slattery, M., Riley, T.R., Liu, P., Abe, N., Gomez-Alcala, P., Dror, I., Zhou, T., Rohs, R., Honig, B., Bussemaker, H.J.,and Mann, R.S. (2011) Cofactor binding evokes latent differences in DNA binding specificity between Hox proteins. Cell 147:1270–1282.
Riley, T.R., Slattery, M., Abe, N., Rastogi, C., Liu, D., Mann, R.S., and Bussemaker, H.J. (2014) SELEX-seq: a method for characterizing the complete repertoire of binding site preferences for transcription factor complexes. Methods Mol. Biol. 1196:255–278.
selex.counts
, selex.countSummary
, selex.infogain
, selex.infogainSummary
, selex.mm
, selex.mmSummary
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database sampleFiles = selex.exampledata(workDir) # Load all sample files using XML database selex.loadAnnotation(sampleFiles[3]) # Create sample handles r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) r2 = selex.sample(seqName='R2.libraries', sampleName='ExdHox.R2', round=2) # Split the r0 sample into testing and training datasets r0.split = selex.split(sample=r0) # Run entire analysis selex.run(trainingSample=r0.split$train, crossValidationSample=r0.split$test, infoGainSample=r2) # Display results selex.mmSummary()[,c(1,2,3,4,5,6)] selex.infogainSummary()[,c(1,2,3,4,5)]
#Initialize the SELEX package #options(java.parameters="-Xmx1500M") #library(SELEX) # Configure the current session workDir = file.path(".", "SELEX_workspace") selex.config(workingDir=workDir,verbose=FALSE, maxThreadNumber= 4) # Extract sample data from package, including XML database sampleFiles = selex.exampledata(workDir) # Load all sample files using XML database selex.loadAnnotation(sampleFiles[3]) # Create sample handles r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) r2 = selex.sample(seqName='R2.libraries', sampleName='ExdHox.R2', round=2) # Split the r0 sample into testing and training datasets r0.split = selex.split(sample=r0) # Run entire analysis selex.run(trainingSample=r0.split$train, crossValidationSample=r0.split$test, infoGainSample=r2) # Display results selex.mmSummary()[,c(1,2,3,4,5,6)] selex.infogainSummary()[,c(1,2,3,4,5)]
A function used to create a sample handle for conveniently referencing visible samples in other SELEX functions.
selex.sample(seqName, sampleName, round, index=NULL)
selex.sample(seqName, sampleName, round, index=NULL)
seqName |
Sequencing run name |
sampleName |
Sample name |
round |
Sample round |
index |
Row number of desired sample when using |
A sample is considered ‘visible’ to the current SELEX session when its metadata has been loaded or defined and the sample's sequencing run info name, sample name, and round is displayed when selex.sampleSummary
is called. Alternatively, a row number from selex.sampleSummary
can be used to reference a sample.
A sample handle is an object that contains a reference to one visible sample. This object can be passed to SELEX functions instead of explicitly passing all sample information (such as variable region length, barcodes, round, FASTQ file location, etc).
selex.sample
returns a sample handle object.
selex.defineSample
, selex.getAttributes
, selex.loadAnnotation
, selex.sampleSummary
r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) r2 = selex.sample(index=3)
r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) r2 = selex.sample(index=3)
A function used to calculate and return the PFSM (Position Specific Frequency Matrix) for a sample, regardless of sequence filtering.
selex.samplePSFM(sample)
selex.samplePSFM(sample)
sample |
A sample handle to the dataset on which the PSFM is calculated. |
The output can be used by the seqLogo
package to create a sequence logo.
selex.samplePSFM
returns a matrix containing the frequences for each base at every position.
# Display all currently loaded samples selex.sampleSummary() r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) # Make PSFMs for the two visible FASTQ files: psfm1 = selex.samplePSFM(r0) # Can make sequence logos using the seqLogo package: #library(seqLogo) #seqLogo(makePWM(t(psfm1)))
# Display all currently loaded samples selex.sampleSummary() r0 = selex.sample(seqName="R0.libraries", sampleName="R0.barcodeGC", round=0) # Make PSFMs for the two visible FASTQ files: psfm1 = selex.samplePSFM(r0) # Can make sequence logos using the seqLogo package: #library(seqLogo) #seqLogo(makePWM(t(psfm1)))
A function used to output the sequencing run names, sample names, rounds, left and right barcodes, and file paths of all samples that have been currently loaded from sequencing run info files or defined using selex.defineSample
.
selex.sampleSummary()
selex.sampleSummary()
selex.sampleSummary
displays all the samples currently visible to the SELEX session. A sample is ‘visible’ to the current SELEX session when its metadata has been loaded or defined and can be used to create a sample handle from its sequencing run info name, sample name, and round (see selex.sample
). Alternatively, a sample handle can also be specified using its row number as returned by selex.sampleSummary
.
selex.sampleSummary
returns a data frame containing sequencing run names, sample names, rounds, left and right barcodes, and file paths.
selex.defineSample
, selex.getAttributes
, selex.loadAnnotation
, selex.sample
, selex.saveAnnotation
selex.sampleSummary()
selex.sampleSummary()
A function used to save sample metadata visible to the current SELEX session in a sample annotation file.
selex.saveAnnotation(filePath)
selex.saveAnnotation(filePath)
filePath |
Location on disk to create the sample annotation file. The full system path must be specified. |
A sample annotation file is an XML file that acts as a database storing metadata for different SELEX experiments. selex.saveAnnotation
provides a convenient way to permanently store manually entered sample information using selex.defineSample
. For more information on the XML format used to store the information, see selex.loadAnnotation
.
Not applicable
selex.defineSample
, selex.loadAnnotation
, selex.sampleSummary
selex.defineSample(seqName='R0.libraries', seqFile=sampleFiles[1], sampleName='R0.barcodeGC', round=0, varLength=16, leftBarcode='TGG', rightBarcode='CCAGCTG') selex.saveAnnotation(paste0(workDir, "sample_annotations.xml"))
selex.defineSample(seqName='R0.libraries', seqFile=sampleFiles[1], sampleName='R0.barcodeGC', round=0, varLength=16, leftBarcode='TGG', rightBarcode='CCAGCTG') selex.saveAnnotation(paste0(workDir, "sample_annotations.xml"))
A function used to create a sequence filter object to conveniently and precisely include or exclude sequences from being counted or displayed. The filters are formed using Java regular expressions and can be used by a variety of functions within the package.
selex.seqfilter(variableRegionIncludeRegex=NULL, variableRegionExcludeRegex=NULL, variableRegionGroupRegex=NULL, kmerIncludeRegex=NULL, kmerExcludeRegex=NULL, kmerIncludeOnly=NULL, viewIncludeRegex=NULL, viewExcludeRegex=NULL, viewIncludeOnly=NULL)
selex.seqfilter(variableRegionIncludeRegex=NULL, variableRegionExcludeRegex=NULL, variableRegionGroupRegex=NULL, kmerIncludeRegex=NULL, kmerExcludeRegex=NULL, kmerIncludeOnly=NULL, viewIncludeRegex=NULL, viewExcludeRegex=NULL, viewIncludeOnly=NULL)
variableRegionIncludeRegex |
Include reads with variable regions containing this regular expression. |
variableRegionExcludeRegex |
Exclude reads with variable regions containing this regular expression. |
variableRegionGroupRegex |
Select subsequences of variable regions matching this regular expression. |
kmerIncludeRegex |
Perform K-mer counting on variable regions containing this regular expression. |
kmerExcludeRegex |
Perform K-mer counting on variable regions not containing this regular expression. |
kmerIncludeOnly |
Perform K-mer counting on variable regions exactly matching this regular expression. |
viewIncludeRegex |
Display K-mers containing this reguar expression. |
viewExcludeRegex |
Display K-mers not containing this regular expression. |
viewIncludeOnly |
Display K-mers exactly matching this regular expression. |
The filters described by selex.seqfilter
are used to filter sequences in the different stages of the K-mer counting process: read filtering, variable region filtering, and K-mer filtering.
Read Filtering | Variable Region Filtering | K-mer Filtering | ||
variableRegionIncludeRegex |
kmerIncludeRegex |
viewIncludeRegex |
||
variableRegionExcludeRegex |
kmerExcludeRegex |
viewExcludeRegex |
||
variableRegionGroupRegex |
kmerIncludeOnly |
viewIncludeOnly
|
Read filtering includes or excludes reads from the FASTQ file, acting as additional filters to those used to extract the variable regions. For example, consider an experimental design where the left barcode is TGG, right right barcode is TTAGC, and the variable region length is 10. FASTQ reads will be rejected unless they have the correct format; the sequences below represent hypothetical FASTQ reads:
5' TGG NNNNNNNNNN TTAGC 3' | template | |
5' TCG ATCAGTGGAC TTAGC 3' | fails (left match failed) | |
5' TGG NAGGTCAGAC TTAGC 3' | fails (indeterminate base in variable region) | |
5' TGG ATCAGTGGAC TTAGC 3' | passes |
The read filter options then act as additional filters on the 10-bp variable region. variableRegionGroupRegex
has the added functionality of selecting substrings from the variable region itself. Using the same example, variableRegionGroupRegex
could be used to select 5-mers regions flanked by AA on the left and the right (or AA NNNNN AA):
5' TCG ATCAGTGGAC TTAGC 3' | fails template (left match failed) | |
5' TGG ATCAGTGGAC TTAGC 3' | passes template, fails filter (no match) | |
5' TGG TAAGTGCCAA TTAGC 3' | passes template and filter |
When the variableRegionGroupRegex
filter matches, only the subsequence will be used in future counting. In the above example, this would be GTGCC.
After the variable regions have been extracted from the FASTQ file, the next step involves K-mer counting. Variable region filtering comes into play here, allowing or preventing K-mer counting on these sequences. Lastly, K-mer filtering determines what K-mers are returned or displayed in tables.
Any function utilizing sequence filters will recompute results if, for a given sample, new values for the read filtering or variable region filter options are provided.
selex.seqfilter
returns a sequence filter object.
selex.affinities
, selex.counts
, selex.getSeqfilter
, selex.infogain
, selex.kmax
, selex.mm
# Raw K-mer counts my.counts1 = selex.counts(sample=r0, k=16, top=100) # Include reads whose variable regions begin with TGTA regex = selex.seqfilter(variableRegionIncludeRegex="^TGTA") my.counts2 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude reads whose variables regions begin with TGT regex = selex.seqfilter(variableRegionExcludeRegex="^TGT") my.counts3 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Extract 13-bp substring from reads whose variable regions begin with TGT regex = selex.seqfilter(variableRegionGroupRegex="^TGT([ACGT]{13})") my.counts4 = selex.counts(sample=r0, k=13, top=100, seqfilter=regex) # Extract 5-bp substring from reads whose variable regions begin with TGT regex = selex.seqfilter(variableRegionGroupRegex="^TGT([ACGT]{5})") my.counts5 = selex.counts(sample=r0, k=5, top=100, seqfilter=regex) # Select variable regions beginning with A and ending with G regex = selex.seqfilter(kmerIncludeRegex="^A.{14}G") my.counts6 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude variable regions beginning with A and ending with G regex = selex.seqfilter(kmerExcludeRegex="^A.{14}G") my.counts7 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude variable regions beginning with A and ending with G, and display # 16-mers that start and end with T regex = selex.seqfilter(kmerExcludeRegex="^A.{14}G", viewIncludeRegex="^T[ACTG]{14}T") my.counts8 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude variable regions beginning with A and ending with G, and display # 16-mers that do not start and end with T regex = selex.seqfilter(kmerExcludeRegex="^A.{14}G", viewExcludeRegex="^T[ACTG]{14}T") my.counts9 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Only count variable regions containing TGTAAAATCAGTGCTG or TGTAAGTGGACTCTCG regex = selex.seqfilter(kmerIncludeOnly=c('TGTAAAATCAGTGCTG', 'TGTAAGTGGACTCTCG')) my.counts10 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Only display results for the K-mers TGTAAAATCAGTGCTG and TGTAAGTGGACTCTCG regex = selex.seqfilter(viewIncludeOnly=c('TGTAAAATCAGTGCTG', 'TGTAAGTGGACTCTCG')) my.counts11 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex)
# Raw K-mer counts my.counts1 = selex.counts(sample=r0, k=16, top=100) # Include reads whose variable regions begin with TGTA regex = selex.seqfilter(variableRegionIncludeRegex="^TGTA") my.counts2 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude reads whose variables regions begin with TGT regex = selex.seqfilter(variableRegionExcludeRegex="^TGT") my.counts3 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Extract 13-bp substring from reads whose variable regions begin with TGT regex = selex.seqfilter(variableRegionGroupRegex="^TGT([ACGT]{13})") my.counts4 = selex.counts(sample=r0, k=13, top=100, seqfilter=regex) # Extract 5-bp substring from reads whose variable regions begin with TGT regex = selex.seqfilter(variableRegionGroupRegex="^TGT([ACGT]{5})") my.counts5 = selex.counts(sample=r0, k=5, top=100, seqfilter=regex) # Select variable regions beginning with A and ending with G regex = selex.seqfilter(kmerIncludeRegex="^A.{14}G") my.counts6 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude variable regions beginning with A and ending with G regex = selex.seqfilter(kmerExcludeRegex="^A.{14}G") my.counts7 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude variable regions beginning with A and ending with G, and display # 16-mers that start and end with T regex = selex.seqfilter(kmerExcludeRegex="^A.{14}G", viewIncludeRegex="^T[ACTG]{14}T") my.counts8 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Exclude variable regions beginning with A and ending with G, and display # 16-mers that do not start and end with T regex = selex.seqfilter(kmerExcludeRegex="^A.{14}G", viewExcludeRegex="^T[ACTG]{14}T") my.counts9 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Only count variable regions containing TGTAAAATCAGTGCTG or TGTAAGTGGACTCTCG regex = selex.seqfilter(kmerIncludeOnly=c('TGTAAAATCAGTGCTG', 'TGTAAGTGGACTCTCG')) my.counts10 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex) # Only display results for the K-mers TGTAAAATCAGTGCTG and TGTAAGTGGACTCTCG regex = selex.seqfilter(viewIncludeOnly=c('TGTAAAATCAGTGCTG', 'TGTAAGTGGACTCTCG')) my.counts11 = selex.counts(sample=r0, k=16, top=100, seqfilter=regex)
A function that changes the current working directory.
selex.setwd(path)
selex.setwd(path)
path |
Physical location on disk for the current working directory. The full system path must be specified. |
The working directory must be specified for every selex.run. This directory is used to store the output of all analyses performed by the selex package. If a certain calculation has already been performed in the given working directory, the previously computed values are returned. If the specified path does not exist, selex.config
will attempt to create it.
Not applicable
workDir = file.path(".", "SELEX_workspace") # Change the current working directory selex.setwd(path=workDir)
workDir = file.path(".", "SELEX_workspace") # Change the current working directory selex.setwd(path=workDir)
A function used to randomly split and store a dataset into smaller fractions as defined by ratios
. This is useful in generating cross-validation datasets for Markov Model testing when none are available.
selex.split(sample, ratios=NA)
selex.split(sample, ratios=NA)
sample |
A sample handle to the dataset to be split. |
ratios |
The fractions with with new datasets should be generated. If |
selex.split
saves the newly generated datasets in the current working directory and makes them visible to the current SELEX session. Naming convention of new samples: New sequence name = <seqName>.split.x ; New sample name = <sampleName>.split.x .
Not applicable
selex.defineSample
, selex.loadAnnotation
, selex.mm
, selex.sampleSummary
# Split the r0 sample into testing and training datasets r0.split = selex.split(sample=r0) # show information about subsamples names(r0.split) r0.split$info selex.getAttributes(r0.split$train) # Display all currently loaded samples selex.sampleSummary()
# Split the r0 sample into testing and training datasets r0.split = selex.split(sample=r0) # show information about subsamples names(r0.split) r0.split$info selex.getAttributes(r0.split$train) # Display all currently loaded samples selex.sampleSummary()
This function returns the summaries of either all the calculated count tables, Markov models, and information gain values in the current working directory or those for a specific sample.
selex.summary(sample=NULL, displayFilter=FALSE)
selex.summary(sample=NULL, displayFilter=FALSE)
sample |
A sample handle to the sample for which summaries should be returned. |
displayFilter |
Display all applied sequence filter attributes. |
selex.summary
returns a list containing the following components:
countSummary |
a data frame containing the sample, kmer length, offset, minimum/maximum count, total count, and applied filters for either all count tables or a specified sample in the current working directory. |
markovModel |
a data frame containing the sample, order, Markov model type, R^2 value, cross validation sample/length, and applied filters for either all computed Markov models or a specified sample in the current working directory. |
informationGain |
a data frame containing the sample, Kmer length, information gain value, Markov model/type, and applied filters for either all computed information gain values or a specified sample in the current working directory. |
selex.counts
, selex.countSummary
, selex.infogain
, selex.infogainSummary
, selex.mm
, selex.mmSummary
selex.summary()
selex.summary()