Title: | An Ultra-Fast and All-in-One Fastq Preprocessor (Quality Control, Adapter, low quality and polyX trimming) and UMI Sequence Parsing). |
---|---|
Description: | Rfastp is an R wrapper of fastp developed in c++. fastp performs quality control for fastq files. including low quality bases trimming, polyX trimming, adapter auto-detection and trimming, paired-end reads merging, UMI sequence/id handling. Rfastp can concatenate multiple files into one file (like shell command cat) and accept multiple files as input. |
Authors: | Wei Wang [aut] , Ji-Dung Luo [ctb] , Thomas Carroll [cre, aut] |
Maintainer: | Thomas Carroll <[email protected]> |
License: | GPL-3 + file LICENSE |
Version: | 1.15.0 |
Built: | 2024-10-03 05:46:11 UTC |
Source: | https://github.com/bioc/Rfastp |
concatenate multiple fastq files into a single file.
catfastq(output, inputFiles, append = FALSE, paired = FALSE, shuffled = FALSE)
catfastq(output, inputFiles, append = FALSE, paired = FALSE, shuffled = FALSE)
output |
output file name [string] |
inputFiles |
a vector of input file names [vector] |
append |
a logical indicating append the files to a file already exists. |
paired |
a logical indicating split the input files into two halves. the first half merged into read1, the second half merged into read2. |
shuffled |
a logical indicating split the input file list into two halves. The R1/R2 files are inteleaved in the inputFiles vector. |
no returns.
Wei Wang
pe001_read1 <- system.file("extdata","splited_001_R1.fastq.gz", package="Rfastp") pe002_read1 <- system.file("extdata","splited_002_R1.fastq.gz", package="Rfastp") pe003_read1 <- system.file("extdata","splited_003_R1.fastq.gz", package="Rfastp") pe004_read1 <- system.file("extdata","splited_004_R1.fastq.gz", package="Rfastp") pe001_read2 <- system.file("extdata","splited_001_R2.fastq.gz", package="Rfastp") pe002_read2 <- system.file("extdata","splited_002_R2.fastq.gz", package="Rfastp") pe003_read2 <- system.file("extdata","splited_003_R2.fastq.gz", package="Rfastp") pe004_read2 <- system.file("extdata","splited_004_R2.fastq.gz", package="Rfastp") allR1 <- c(pe001_read1, pe002_read1, pe003_read1, pe004_read1) allR2 <- c(pe001_read2, pe002_read2, pe003_read2, pe004_read2) allreads <- c(allR1, allR2) allreads_shuffled <- c(pe001_read1, pe001_read2, pe002_read1, pe002_read2, pe003_read1, pe003_read2, pe004_read1, pe004_read2) outputPrefix <- tempfile(tmpdir = tempdir()) # a normal concatenation for single-end libraries. catfastq(output = paste0(outputPrefix, "_R1.fastq.gz"), inputFiles = allR1) # a normal concatenation for paired-end libraries. catfastq(output = paste0(outputPrefix, "merged_paired"), inputFiles = allreads, paired=TRUE) # Append to exist files (paired-end) catfastq(output=paste0(outputPrefix,"append_paired"), inputFiles=allreads, append=TRUE, paired=TRUE) # Input paired-end files are shuffled. catfastq(output=paste0(outputPrefix,"_shuffled_paired"), inputFiles=allreads_shuffled, paired=TRUE, shuffled=TRUE)
pe001_read1 <- system.file("extdata","splited_001_R1.fastq.gz", package="Rfastp") pe002_read1 <- system.file("extdata","splited_002_R1.fastq.gz", package="Rfastp") pe003_read1 <- system.file("extdata","splited_003_R1.fastq.gz", package="Rfastp") pe004_read1 <- system.file("extdata","splited_004_R1.fastq.gz", package="Rfastp") pe001_read2 <- system.file("extdata","splited_001_R2.fastq.gz", package="Rfastp") pe002_read2 <- system.file("extdata","splited_002_R2.fastq.gz", package="Rfastp") pe003_read2 <- system.file("extdata","splited_003_R2.fastq.gz", package="Rfastp") pe004_read2 <- system.file("extdata","splited_004_R2.fastq.gz", package="Rfastp") allR1 <- c(pe001_read1, pe002_read1, pe003_read1, pe004_read1) allR2 <- c(pe001_read2, pe002_read2, pe003_read2, pe004_read2) allreads <- c(allR1, allR2) allreads_shuffled <- c(pe001_read1, pe001_read2, pe002_read1, pe002_read2, pe003_read1, pe003_read2, pe004_read1, pe004_read2) outputPrefix <- tempfile(tmpdir = tempdir()) # a normal concatenation for single-end libraries. catfastq(output = paste0(outputPrefix, "_R1.fastq.gz"), inputFiles = allR1) # a normal concatenation for paired-end libraries. catfastq(output = paste0(outputPrefix, "merged_paired"), inputFiles = allreads, paired=TRUE) # Append to exist files (paired-end) catfastq(output=paste0(outputPrefix,"append_paired"), inputFiles=allreads, append=TRUE, paired=TRUE) # Input paired-end files are shuffled. catfastq(output=paste0(outputPrefix,"_shuffled_paired"), inputFiles=allreads_shuffled, paired=TRUE, shuffled=TRUE)
generate a ggplot2 object of Base Quality/GC content before and after QC.
curvePlot(json, curves = "quality_curves")
curvePlot(json, curves = "quality_curves")
json |
the output json of function rfastq. [json] |
curves |
plots for Base Quality("quality_curves") or GC content("content_curves"). default is "quality_curves" |
a ggplot2 object.
Wei Wang
outputPrefix <- tempfile(tmpdir = tempdir()) se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix, thread = 4) # Base Quality plot is the default output: p1 <- curvePlot(se_json_report) p1 p2 <- curvePlot(se_json_report, curves = "content_curves")
outputPrefix <- tempfile(tmpdir = tempdir()) se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix, thread = 4) # Base Quality plot is the default output: p1 <- curvePlot(se_json_report) p1 p2 <- curvePlot(se_json_report, curves = "content_curves")
generate a data frame of the Fastq QC summary.
qcSummary(json)
qcSummary(json)
json |
the output json of function rfastq. [json] |
a data frame.
Wei Wang
outputPrefix <- tempfile(tmpdir = tempdir()) se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix, thread = 4) df_summary <- qcSummary(se_json_report)
outputPrefix <- tempfile(tmpdir = tempdir()) se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix, thread = 4) df_summary <- qcSummary(se_json_report)
Quality control (Cut adapter, low quality trimming, polyX trimming, UMI handling, and etc.) of fastq files.
rfastp( read1, read2 = "", outputFastq, unpaired = "", failedOut = "", merge = FALSE, mergeOut = "", phred64 = FALSE, interleaved = FALSE, fixMGIid = FALSE, adapterTrimming = TRUE, adapterSequenceRead1 = "auto", adapterSequenceRead2 = "auto", adapterFasta = "", trimFrontRead1 = 0, trimTailRead1 = 0, trimFrontRead2 = 0, trimTailRead2 = 0, maxLengthRead1 = 0, maxLengthRead2 = 0, forceTrimPolyG = FALSE, disableTrimPolyG = FALSE, minLengthPolyG = 10, trimPolyX = FALSE, minLengthPolyX = 10, cutWindowSize = 4, cutLowQualTail = FALSE, cutSlideWindowRight = FALSE, cutLowQualFront = FALSE, cutMeanQual = 20, cutFrontWindowSize = 4, cutFrontMeanQual = 20, cutTailWindowSize = 4, cutTailMeanQual = 20, cutSlideWindowSize = 4, cutSlideWindowQual = 20, qualityFiltering = TRUE, qualityFilterPhred = 15, qualityFilterPercent = 40, maxNfilter = 5, averageQualFilter = 0, lengthFiltering = TRUE, minReadLength = 15, maxReadLength = 0, lowComplexityFiltering = FALSE, minComplexity = 30, index1Filter = "", index2Filter = "", maxIndexMismatch = 0, correctionOverlap = FALSE, minOverlapLength = 30, maxOverlapMismatch = 5, maxOverlapMismatchPercentage = 20, umi = FALSE, umiLoc = "", umiLength = 0, umiPrefix = "", umiSkipBaseLength = 0, umiNoConnection = FALSE, umiIgnoreSeqNameSpace = FALSE, overrepresentationAnalysis = FALSE, overrepresentationSampling = 20, splitOutput = 0, splitByLines = 0, thread = 2, verbose = TRUE )
rfastp( read1, read2 = "", outputFastq, unpaired = "", failedOut = "", merge = FALSE, mergeOut = "", phred64 = FALSE, interleaved = FALSE, fixMGIid = FALSE, adapterTrimming = TRUE, adapterSequenceRead1 = "auto", adapterSequenceRead2 = "auto", adapterFasta = "", trimFrontRead1 = 0, trimTailRead1 = 0, trimFrontRead2 = 0, trimTailRead2 = 0, maxLengthRead1 = 0, maxLengthRead2 = 0, forceTrimPolyG = FALSE, disableTrimPolyG = FALSE, minLengthPolyG = 10, trimPolyX = FALSE, minLengthPolyX = 10, cutWindowSize = 4, cutLowQualTail = FALSE, cutSlideWindowRight = FALSE, cutLowQualFront = FALSE, cutMeanQual = 20, cutFrontWindowSize = 4, cutFrontMeanQual = 20, cutTailWindowSize = 4, cutTailMeanQual = 20, cutSlideWindowSize = 4, cutSlideWindowQual = 20, qualityFiltering = TRUE, qualityFilterPhred = 15, qualityFilterPercent = 40, maxNfilter = 5, averageQualFilter = 0, lengthFiltering = TRUE, minReadLength = 15, maxReadLength = 0, lowComplexityFiltering = FALSE, minComplexity = 30, index1Filter = "", index2Filter = "", maxIndexMismatch = 0, correctionOverlap = FALSE, minOverlapLength = 30, maxOverlapMismatch = 5, maxOverlapMismatchPercentage = 20, umi = FALSE, umiLoc = "", umiLength = 0, umiPrefix = "", umiSkipBaseLength = 0, umiNoConnection = FALSE, umiIgnoreSeqNameSpace = FALSE, overrepresentationAnalysis = FALSE, overrepresentationSampling = 20, splitOutput = 0, splitByLines = 0, thread = 2, verbose = TRUE )
read1 |
read1 input file name(s). [vector] |
read2 |
read2 input file name(s). [vector] |
outputFastq |
string of /path/prefix for output fastq [string] |
unpaired |
for PE input, output file name for reads which the mate reads failed to pass the QC [string], default NULL, discard it. [string] |
failedOut |
file to store reads that cannot pass the filters default NULL, discard it. [string] |
merge |
for PE input, A logical(1) indicating whether merge each pair of reads into a single read if they are overlaped, unmerged reads will be write to 'output' file. Default is FALSE. the 'mergeOut' must be set if TRUE. |
mergeOut |
under 'merge' mode, file to store the merged reads. [string] |
phred64 |
A logical indicating whether the input is using phred64 scoring (it will be converted to phred33, so the output will still be . phred33) |
interleaved |
A logical indicating whether <read1> is an interleaved FASTQ which contains both read1 and read2. Default is FALSE. |
fixMGIid |
the MGI FASTQ ID format is not compatible with many BAM operation tools, enable this option to fix it. Default is FALSE |
adapterTrimming |
A logical indicating whether run adapter trimming. Default is 'TRUE' |
adapterSequenceRead1 |
the adapter for read1. For SE data, if not specified, the adapter will be auto-detected. For PE data, this is used if R1/R2 are found not overlapped. |
adapterSequenceRead2 |
the adapter for read2 (PE data only). This is used if R1/R2 are found not overlapped. If not specified, it will be the same as <adapterSequenceRead1> |
adapterFasta |
specify a FASTA file to trim both read1 and read2 (if PE) by all the sequences in this FASTA file. |
trimFrontRead1 |
trimming how many bases in front for read1, default is 0. |
trimTailRead1 |
trimming how many bases in tail for read1, default is 0' |
trimFrontRead2 |
trimming how many bases in front for read2. If it's not specified, it will follow read1's settings |
trimTailRead2 |
trimming how many bases in tail for read2. If it's not specified, it will follow read1's settings |
maxLengthRead1 |
if read1 is longer than maxLengthRead1, then trim read1 at its tail to make it as long as maxLengthRead1 Default 0 means no limitation. |
maxLengthRead2 |
if read2 is longer than maxLengthRead2, then trim read2 at its tail to make it as long as maxLengthRead2. Default 0 means no limitation. If it's not specified, it will follow read1's settings. |
forceTrimPolyG |
A logical indicating force polyG tail trimming, trimming is only automatically enabled for Illumina NextSeq/NovaSeq . data. |
disableTrimPolyG |
A logical indicating disable polyG tail trimming. |
minLengthPolyG |
the minimum length to detect polyG in the read tail. 10 by default. |
trimPolyX |
A logical indicating force polyX tail trimming. |
minLengthPolyX |
the minimum length to detect polyX in the read tail. 10 by default. |
cutWindowSize |
the window size option shared by cutLowQualFront, cutLowQualTail, or cutSlideWindowRight. Range: 1~1000, default: 4 |
cutLowQualTail |
A logical indiccating move a sliding window from tail (3') to front, drop the bases in the window if its mean quality < threshold, stop otherwise. Default is 'FALSE' |
cutSlideWindowRight |
A logical indicating move a sliding window from front to tail, if meet one window with mean quality < threshold, drop the bases in the window and the right part, and then stop. Default is 'FALSE' |
cutLowQualFront |
A logical indiccating move a sliding window from front (5') to tail, drop the bases in the window if its mean quality < threshold, stop otherwise. Default is 'FALSE' |
cutMeanQual |
the mean quality requirement option shared by cutLowQualFront, cutLowQualTail or cutSlideWindowRight. Range: 1~36, default: 20 |
cutFrontWindowSize |
the window size option of cutLowQualFront, default to cutWindowSize if not specified. default: 4 |
cutFrontMeanQual |
the mean quality requirement option for cutLowQualFront, default to cutMeanQual if not specified. default: 20 |
cutTailWindowSize |
the window size option of cutLowQualTail, default to cutWindowSize if not specified. default: 4 |
cutTailMeanQual |
the mean quality requirement option for cutLowQualTail, default to cutMeanQual if not specified. default: 20 |
cutSlideWindowSize |
the window size option of cutSlideWindowRight, default to cutWindowSize if not specified. default: 4 |
cutSlideWindowQual |
the mean quality requirement option for cutSlideWindowRight, default to cutMeanQual if not specified. default: 20 |
qualityFiltering |
A logical indicating run quality filtering. Default is 'TRUE'. |
qualityFilterPhred |
the minimum quality value that a base is qualified. Default 15 means phred quality >=Q15 is qualified. |
qualityFilterPercent |
Maximum percents of bases are allowed to be unqualified (0~100). Default 40 means 40% |
maxNfilter |
maximum number of N allowed in the sequence. read/pair is discarded if failed to pass this filter. Default is 5 |
averageQualFilter |
if one read's average quality score < 'averageQualFilter', then this read/pair is discarded. Default 0 means no requirement. |
lengthFiltering |
A logical indicating whether run lenght filtering. Default: TRUE |
minReadLength |
reads shorter than minReadLength will be discarded, default is 15. |
maxReadLength |
reads longer than maxReadLength will be discarded, default 0 means no limitation. |
lowComplexityFiltering |
A logical indicating whethere run low complexity filter. The complexity is defined as the percentage of base that is different from its next base (base[i] != base[i+1]). Default is 'FALSE' |
minComplexity |
the threshold for low complexity filter (0~100). Default is 30, which means 30% complexity is required. (int [=30]) |
index1Filter |
specify a file contains a list of barcodes of index1 to be filtered out, one barcode per line. |
index2Filter |
specify a file contains a list of barcodes of index2 to be filtered out, one barcode per line. |
maxIndexMismatch |
the allowed difference of index barcode for index filtering, default 0 means completely identical. |
correctionOverlap |
A logical indicating run base correction in overlapped regions (only for PE data), default is 'FALSE' |
minOverlapLength |
the minimum length to detect overlapped region of PE reads. This will affect overlap analysis based PE merge, adapter trimming and correction. 30 by default. |
maxOverlapMismatch |
the maximum number of mismatched bases to detect overlapped region of PE reads. This will affect overlap analysis based PE merge, adapter trimming and correction. 5 by default. |
maxOverlapMismatchPercentage |
the maximum percentage of mismatched bases to detect overlapped region of PE reads. This will affect overlap analysis based PE merge, adapter trimming and correction. Default 20 means 20% |
umi |
A logical indicating whethere preprocessing unique molecular identifier (UMI). Default: 'FALSE' |
umiLoc |
specify the location of UMI, can be (index1/index2/read1/read2/per_index/per_read) |
umiLength |
length of UMI if the UMI is in read1/read2. |
umiPrefix |
an string indication the following string is UMI (i.e. prefix=UMI, UMI=AATTCG, final=UMIAATTCG). Only letters, numbers, and '#" allowed. No prefix by default. |
umiSkipBaseLength |
if the UMI is in read1/read2, skip 'umiSkipBaseLength' bases following UMI, default is 0. |
umiNoConnection |
an logical indicating remove "_" between the UMI prefix string and the UMI string. Default is FALSE. |
umiIgnoreSeqNameSpace |
an logical indicating ignore the space in the sequence name. Default is FALSE, the umi tag will be inserted into the sequence name before the first SPACE. |
overrepresentationAnalysis |
A logical indicating overrepresentation analysis. Default is 'FALSE' |
overrepresentationSampling |
one in 'overrepresentationSampling' reads will be computed for overrepresentation analysis (1~10000), smaller is slower, default is 20. |
splitOutput |
number of files to be splitted (2~999). a sequential number prefix will be added to output name. Default is 0 (no split) |
splitByLines |
split output by limiting lines of each file(>=1000), a sequential number prefix will be added to output name ( 0001.out.fq, 0002.out.fq...), default is 0 (disabled). |
thread |
owrker thread number, default is 2 |
verbose |
output verbose log information |
returns a json object of the report.
Thomas Carroll, Wei Wang
# preprare for the input and output files. # if the output file exists, it will be OVERWRITEN. se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp") pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp") outputPrefix <- tempfile(tmpdir = tempdir()) # a normal single-end file se_json_report <- rfastp(read1 = se_read1, outputFastq=paste0(outputPrefix, "_se"), thread = 4) # merge paired-end data by overlap: pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE, outputFastq = paste0(outputPrefix, '_unpaired'), mergeOut = paste0(outputPrefix, '_merged.fastq.gz')) # a clipr example clipr_json_report <- rfastp(read1 = se_read1, outputFastq = paste0(outputPrefix, '_clipr'), disableTrimPolyG = TRUE, cutLowQualFront = TRUE, cutFrontWindowSize = 29, cutFrontMeanQual = 20, cutLowQualTail = TRUE, cutTailWindowSize = 1, cutTailMeanQual = 5, minReadLength = 29, adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG' )
# preprare for the input and output files. # if the output file exists, it will be OVERWRITEN. se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") pe_read1 <- system.file("extdata","reads1.fastq.gz",package="Rfastp") pe_read2 <- system.file("extdata","reads2.fastq.gz",package="Rfastp") outputPrefix <- tempfile(tmpdir = tempdir()) # a normal single-end file se_json_report <- rfastp(read1 = se_read1, outputFastq=paste0(outputPrefix, "_se"), thread = 4) # merge paired-end data by overlap: pe_json_report <- rfastp(read1 = pe_read1, read2 = pe_read2, merge = TRUE, outputFastq = paste0(outputPrefix, '_unpaired'), mergeOut = paste0(outputPrefix, '_merged.fastq.gz')) # a clipr example clipr_json_report <- rfastp(read1 = se_read1, outputFastq = paste0(outputPrefix, '_clipr'), disableTrimPolyG = TRUE, cutLowQualFront = TRUE, cutFrontWindowSize = 29, cutFrontMeanQual = 20, cutLowQualTail = TRUE, cutTailWindowSize = 1, cutTailMeanQual = 5, minReadLength = 29, adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG' )
generate a data frame of the Fastq trim summary.
trimSummary(json)
trimSummary(json)
json |
the output json of function rfastq. [json] |
a data frame.
Wei Wang
outputPrefix <- tempfile(tmpdir = tempdir()) se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix, thread = 4, adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG') trim_summary <- trimSummary(se_json_report)
outputPrefix <- tempfile(tmpdir = tempdir()) se_read1 <- system.file("extdata","Fox3_Std_small.fq.gz",package="Rfastp") se_json_report <- rfastp(read1 = se_read1, outputFastq = outputPrefix, thread = 4, adapterSequenceRead1 = 'GTGTCAGTCACTTCCAGCGG') trim_summary <- trimSummary(se_json_report)