| Title: | R bowtie wrapper |
|---|---|
| Description: | This package provides an R wrapper around the popular bowtie short read aligner and around SpliceMap, a de novo splice junction discovery and alignment tool. The package is used by the QuasR bioconductor package. We recommend to use the QuasR package instead of using Rbowtie directly. |
| Authors: | Florian Hahne [aut], Anita Lerch [aut], Michael Stadler [aut, cre] (ORCID: <https://orcid.org/0000-0002-2269-4934>) |
| Maintainer: | Michael Stadler <[email protected]> |
| License: | Artistic-2.0 | file LICENSE |
| Version: | 1.53.0 |
| Built: | 2026-05-30 05:27:14 UTC |
| Source: | https://github.com/bioc/Rbowtie |
This package provides an R wrapper around the popular bowtie short read aligner and around SpliceMap, a de novo splice junction discovery and alignment tool.
The package is used by the QuasR bioconductor package. We recommend to use
QuasR instead of using Rbowtie directly. QuasR provides a simpler
interface than Rbowtie and covers the whole analysis workflow of typical
high throughput sequencing experiments, starting from the raw sequence reads,
over pre-processing and alignment, up to quantification.
We also recommend to use Rhisat2 instead of SpliceMap for spliced alignment, which provides a more up-to-date and improved spliced short read aligner.
Florian Hahne, Anita Lerch, Michael B Stadler
Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10(3):R25 (2009).
Au KF, Jiang H, Lin L, Xing Y, Wong WH. Detection of splice junctions from paired-end RNA-seq data by SpliceMap. Nucleic Acids Research, 38(14):4570-8 (2010).
The following functions can be used to call the bowtie and bowtie-build binaries.
We recommend to use the QuasR package instead of using bowtie and bowtie_build directly. QuasR provides a simpler interface than Rbowtie and covers the whole analysis workflow of typical ultra-high throughput sequencing experiments, starting from the raw sequence reads, over pre-processing and alignment, up to quantification.
bowtie_build(references, outdir, ..., prefix = "index", force = FALSE, strict = TRUE, execute = TRUE) bowtie(sequences, index, ..., type = c("single", "paired", "crossbow"), outfile, force = FALSE, strict = TRUE, execute = TRUE) bowtie_build_usage() bowtie_usage() bowtie_version()bowtie_build(references, outdir, ..., prefix = "index", force = FALSE, strict = TRUE, execute = TRUE) bowtie(sequences, index, ..., type = c("single", "paired", "crossbow"), outfile, force = FALSE, strict = TRUE, execute = TRUE) bowtie_build_usage() bowtie_usage() bowtie_version()
references |
Character vector. The path to the files containing the references for which to build a bowtie index. |
outdir |
Character scalar. The path to the output directory in
which to store the bowtie index. If the directory already exists,
the function function will cast an error, unless
|
prefix |
Character scalar. The prefix to use for the bowtie index files. |
sequences |
If |
index |
Character scalar. The path to the bowtie index and prefix
to align against, in the form |
type |
Character scalar, one in |
outfile |
Character scalar. A path to a files used for the alignment output. If missing, the alignments will be returned as a regular R character vector. |
force |
Logical. Force overwriting of |
strict |
Logical. Turn off strict checking of input arguments. |
execute |
Logical scalar. Whether to execute the assembled shell
command. If |
... |
Additional arguments to be passed on to the binaries. See below for details. |
All additional arguments in ... are interpreted as additional
parameters to be passed on to the binaries. For flags, those are
supposed to be logicals (e.g., quiet=TRUE will be translated
into --q, q=TRUE in -q, and so on). Parameters
with additional input are supposed to be character or numeric vectors,
where the individual vector elements are collapsed into a single
comma-separated string (e.g., k=2 is translated into k
2, bmax=100 into --bmax 100, 3=letters[c(1,2,3)] into
-3 a,b,c, and so on). Note that some arguments to the bowtie
binary will be ignored if they are already handled as explicit
function arguments. See the output of bowtie_usage() and
bowtie_build_usage() for details about available parameters.
The output generated by calling the binaries. For bowtie_build
this is typically a report of the index generation, for
bowtie this can be a vector of aligments (if outfile is
missing), otherwise an empty character scalar.
bowtie_usage() and bowtie_build_usage() return the usage
information for the respective binaries.
bowtie_version() return the bowtie versions information.
Florian Hahne
Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25.
Langmead B, Schatz M, Lin J, Pop M, Salzberg SL. Searching for SNPs with cloud computing. Genome Biology 10:R134.
td <- tempdir() ## Building a bowtie index refs <- dir(system.file(package="Rbowtie", "samples", "refs"), full=TRUE) tmp <- bowtie_build(references=refs, outdir=file.path(td, "index"), force=TRUE) head(tmp) dir(file.path(td, "index")) tmp2 <- bowtie_build(references=refs, outdir=file.path(td,"indexColor"), force=TRUE, C=TRUE) dir(file.path(td, "indexColor")) head(tmp2) ## Alignments reads <- system.file(package="Rbowtie", "samples", "reads", "reads.fastq") tmp <- bowtie(sequences=reads, index=file.path(td, "index", "index")) tmp bowtie(sequences=reads, index=file.path(td, "index", "index"), outfile=file.path(td, "alignments.txt"), best=TRUE, force=TRUE) readLines(file.path(td, "alignments.txt")) bowtie(sequences=list("TGGGTGGGGTATTCTAGAAATTTCTATTAATCCT", "TCTGTTCAAGTCAGATGGTCACCAATCTGAAGAC"), index=file.path(td, "index", "index"), type="paired", c=TRUE)td <- tempdir() ## Building a bowtie index refs <- dir(system.file(package="Rbowtie", "samples", "refs"), full=TRUE) tmp <- bowtie_build(references=refs, outdir=file.path(td, "index"), force=TRUE) head(tmp) dir(file.path(td, "index")) tmp2 <- bowtie_build(references=refs, outdir=file.path(td,"indexColor"), force=TRUE, C=TRUE) dir(file.path(td, "indexColor")) head(tmp2) ## Alignments reads <- system.file(package="Rbowtie", "samples", "reads", "reads.fastq") tmp <- bowtie(sequences=reads, index=file.path(td, "index", "index")) tmp bowtie(sequences=reads, index=file.path(td, "index", "index"), outfile=file.path(td, "alignments.txt"), best=TRUE, force=TRUE) readLines(file.path(td, "alignments.txt")) bowtie(sequences=list("TGGGTGGGGTATTCTAGAAATTTCTATTAATCCT", "TCTGTTCAAGTCAGATGGTCACCAATCTGAAGAC"), index=file.path(td, "index", "index"), type="paired", c=TRUE)
The following function can be used to call the SpliceMap binaries.
We recommend to use the QuasR package instead of using SpliceMap directly. QuasR provides a simpler interface than SpliceMap and covers the whole analysis workflow of typical ultra-high throughput sequencing experiments, starting from the raw sequence reads, over pre-processing and alignment, up to quantification.
SpliceMap(cfg)SpliceMap(cfg)
cfg |
A list containing named elements with SpliceMap parameters (see sQuoteDetails or SpliceMap documentation). |
The SpliceMap function performes the same steps as the
runSpliceMap binary from the SpliceMap software package,
but using R functions to improve compatibility on Windows.
While the original SpliceMap software package is able to call
different tools to find sub-read alignments, the SpliceMap
function from the Rbowtie package works only with bowtie
contained in the package itself. Further modifications from the
original version include the reporting of unmapped reads at the end of
the output sam file, and the restriction to a single (pair) of input
sequence file(s).
The cfg argument is a list with SpliceMap configuration
parameters that would normally be specified using the SpliceMap
configuration file. Here is a list of supported parameters extracted
from the sample config file that is distributed with SpliceMap:
genome_dir (single character value)
Directory of the chromosome files in FASTA format, or path to a
single FASTA file containing all chromosomes. If a directory, each chromosome
can be in a separate file or chromosomes can be concatenated, ie. chr1.fa, chr2.fa, ...
reads_list1 and reads_list2 (single character values)
These are the two input sequence files. reads_list2 can be
missing if reads are not paired-end. Note: reads_list1 must
be the first pair, and pair-reads should be in the
“forward-reverse” format.
read_format (single character value)
Format of the sequencer reads, also make sure reads are not split
over multiple lines. Choices are: FASTA, FASTQ, RAW
quality_format (single character value)
Format of the quality string if FASTQ is used. Choices are:
phred-33 Phred base 33 (same as Sanger format)
phred-64 Phred base 64 (same as Illumina 1.3+)
solexa Format used by solexa machines
outfile (single character value)
Name of the output file (spliced alignments in SAM format). If a
file with this name already exists, SpliceMap will stop with
an exception. Note that unmapped reads will be appended to the end
of the output file (for paired-end experiments, only pairs without
alignments for any read are considered unmapped).
temp_path (single character value)
Directory name of the directory that stores temporary files. All
temporary files will be created in a subfolder of
temp_path and will be removed when SpliceMap finishes
successfully or failed at an intermediate step.
max_intron (single integer value)
Maximum intron size, this is absolute 99th-percentile
maximum. Introns beyond this size will be ignored. If you don't set
this, we will assume a mamalian genome (400,000)
min_intron (single integer value)
25-th intron size, this is the lower 25th-percentile intron
size. This is not the smallest size that SpliceMap will search. That
is about ~25bp. If you don't set this, we will assume a mammalian
genome (20,000)
max_multi_hit (single integer value)
Maximum number of multi-hits. If a 25-mer seed has more than this
many multi-hits, it will be discarded. Default is 10.
full_read_length (single integer value)
Full read length. SpliceMap will only use the first
“full_read_length” bp for mapping. If the read is shorter
than “full_read_length”, the full read will be used before
head clip. If you don't set this parameter, SpliceMap will use as
many as possible. This is for the case where the reads might have
N's at the end. It is always desireable to cut off the N's
head_clip_length (single integer value)
Number of bases to clip off the head of the read. This clipping is
applied after “full_read_length”
seed_mismatch (single integer value)
Number of mismatches allowed in half-seeding. Choices are
0,1(default) or 2
read_mismatch (single integer value)
Maximum number of mismatches allowed in entire read. No limit on
value, however SpliceMap can only identify reads with a maximum of 2
mismatches per 25bp. Default is 2.
max_clip_allowed (single integer value)
Maximum number of bases allowed to be soft clipped from the ends of
reads during alignment. This is required as mismatches near
junctions could cause parts of a a read to not map. Default is 40.
num_chromosome_together (single integer value)
Number of chromosomes to process at once, to take advantage of
multi-core systems. The child processes are created using the
makeCluster function from the parallel
package. This is not threading, so it will take extra
memory. However, running 2 at a time should be fine on current
hardware. Default = 2
bowtie_base_dir (single character value)
Base of bowtie index, this should be the same genome as the
chromosome files eg. if you bowtie files are
“genome/hg18/genome.1.ewbt”, ... then your base dir is
“genome/hg18/genome”
num_threads (single integer values)
Number of threads to use for bowtie mapping. Default value is 2
try_hard (single character value)
Try hard? Choices are “yes” or “no”. Default value is
“yes” (about 15% slower).
selectSingleHit (single logical value)
If TRUE and multiple alignments are found for a read (pair),
only a single alignment is selected randomly and reported. This is a
new paramater only available in the R version of
SpliceMap, but not in the original implementation that could
report several alignments per read (pair).
The following parameters are mandatory:
genome_dir
reads_list1 (reads_list2 for paired-end experiments)
read_format
quality_format
bowtie_base_dir
outfile
temp_path
num_threads
quality_format
selectSingleHit
An invisible character vector of length one with the file name of the generated output SAM file.
An exception is thrown if a failure is detected at one of the many steps.
Michael Stadler
Au KF, Jiang H, Lin L, Xing Y, Wong WH. Detection of splice junctions from paired-end RNA-seq data by SpliceMap. Nucleic Acids Research, 38(14):4570-8 (2010).
makeCluster from package parallel
## Building a bowtie index refDir <- system.file(package="Rbowtie", "samples", "refs") indexDir <- file.path(tempdir(), "refsIndex") tmp <- bowtie_build(references=dir(refDir, full=TRUE), outdir=indexDir, prefix="index", force=TRUE) ## Alignments readsFiles <- system.file(package="Rbowtie", "samples", "reads", "reads.fastq") samFiles <- file.path(tempdir(), "splicedAlignments.sam") cfg <- list(genome_dir=refDir, reads_list1=readsFiles, read_format="FASTQ", quality_format="phred-33", outfile=samFiles, temp_path=tempdir(), max_intron=400000, min_intron=20000, max_multi_hit=10, seed_mismatch=1, read_mismatch=2, num_chromosome_together=2, bowtie_base_dir=file.path(indexDir, "index"), num_threads=4, try_hard="yes", selectSingleHit=TRUE) res <- SpliceMap(cfg)## Building a bowtie index refDir <- system.file(package="Rbowtie", "samples", "refs") indexDir <- file.path(tempdir(), "refsIndex") tmp <- bowtie_build(references=dir(refDir, full=TRUE), outdir=indexDir, prefix="index", force=TRUE) ## Alignments readsFiles <- system.file(package="Rbowtie", "samples", "reads", "reads.fastq") samFiles <- file.path(tempdir(), "splicedAlignments.sam") cfg <- list(genome_dir=refDir, reads_list1=readsFiles, read_format="FASTQ", quality_format="phred-33", outfile=samFiles, temp_path=tempdir(), max_intron=400000, min_intron=20000, max_multi_hit=10, seed_mismatch=1, read_mismatch=2, num_chromosome_together=2, bowtie_base_dir=file.path(indexDir, "index"), num_threads=4, try_hard="yes", selectSingleHit=TRUE) res <- SpliceMap(cfg)