| Title: | Open Reading Frames in Genomics |
|---|---|
| Description: | R package for analysis of transcript and translation features through manipulation of sequence data and NGS data like Ribo-Seq, RNA-Seq, TCP-Seq and CAGE. It is generalized in the sense that any transcript region can be analysed, as the name hints to it was made with investigation of ribosomal patterns over Open Reading Frames (ORFs) as it's primary use case. ORFik is extremely fast through use of C++, data.table and GenomicRanges. Package allows to reassign starts of the transcripts with the use of CAGE-Seq data, automatic shifting of RiboSeq reads, finding of Open Reading Frames for whole genomes and much more. |
| Authors: | Haakon Tjeldnes [aut, cre, dtc] (ORCID: <https://orcid.org/0000-0002-2077-747X>), Kornel Labun [aut, cph], Michal Swirski [ctb], Katarzyna Chyzynska [ctb, dtc], Yamila Torres Cleuren [ctb, ths], Eivind Valen [ths, fnd] |
| Maintainer: | Haakon Tjeldnes <[email protected]> |
| License: | MIT + file LICENSE |
| Version: | 1.33.0 |
| Built: | 2026-07-23 09:09:07 UTC |
| Source: | https://github.com/bioc/ORFik |
Main goals:
Finding Open Reading Frames (very fast) in the genome of interest or on the set of transcripts/sequences.
Utilities for metaplots of RiboSeq coverage over gene START and STOP codons allowing to spot the shift.
Shifting functions for the RiboSeq data.
Finding new Transcription Start Sites with the use of CageSeq data.
Various measurements of gene identity e.g. FLOSS, coverage, ORFscore, entropy that are recreated based on many scientific publications.
Utility functions to extend GenomicRanges for faster grouping, splitting, tiling etc.
Maintainer: Haakon Tjeldnes [email protected] (ORCID) [data contributor]
Authors:
Kornel Labun [email protected] [copyright holder]
Other contributors:
Michal Swirski [email protected] [contributor]
Katarzyna Chyzynska [email protected] [contributor, data contributor]
Yamila Torres Cleuren [email protected] [contributor, thesis advisor]
Eivind Valen [email protected] [thesis advisor, funder]
Useful links:
add_pseudo_5utrs_txdb_if_needed
add_pseudo_5utrs_txdb_if_needed( txdb, pseudo_5UTRS_if_needed = NULL, minimum_5UTR_percentage = 30 )add_pseudo_5utrs_txdb_if_needed( txdb, pseudo_5UTRS_if_needed = NULL, minimum_5UTR_percentage = 30 )
txdb |
a TxDb object |
pseudo_5UTRS_if_needed |
integer, default NULL. If defined > 0, will add pseudo 5' UTRs of maximum this length if 'minimum_5UTR_percentage" (default 30 mRNAs (coding transcripts) do not have a leader. (NULL and 0 are both the ignore command) |
minimum_5UTR_percentage |
numeric, default 30. What minimum percentage of mRNAs most have a 5' UTRs (leaders), to not do the pseudo_UTR addition. If percentage is higher, addition is ignored, set to 101 to always do it. |
txdb (new txdb if it was done, old if not)
Main use case is to add gene symbols to data.table outputs from ORFik with tx ids only, like the DTEG.analysis etc.
append_gene_symbols(dt, symbols_dt, extend_id = TRUE, id_col = "id")append_gene_symbols(dt, symbols_dt, extend_id = TRUE, id_col = "id")
dt |
a data.table, must have a id_col with transcript ids |
symbols_dt |
the data.table with symbols, must have a column with tx, transcript or value in the name. And only 1 of those! |
extend_id |
logical, if TRUE, paste together old id from dt, with the symbol id like: tx_id(symbol_id) |
id_col |
character, default "id". The name of the id column in dt. |
a data.table
library(data.table) df <- ORFik.template.experiment() cds_names <- names(loadRegion(df, "cds")) dt <- data.table(id = cds_names[-1], LFC = seq(5), p.value = 0.05) symbols_dt <- data.table(ensembl_tx_name = cds_names, ensembl_gene_id = txNamesToGeneNames(cds_names, df), external_gene_name = c("ATF4", "AAT1", "ML4", "AST2", "RPL4", "RPL12")) append_gene_symbols(dt, symbols_dt) append_gene_symbols(dt, symbols_dt, extend_id = FALSE)library(data.table) df <- ORFik.template.experiment() cds_names <- names(loadRegion(df, "cds")) dt <- data.table(id = cds_names[-1], LFC = seq(5), p.value = 0.05) symbols_dt <- data.table(ensembl_tx_name = cds_names, ensembl_gene_id = txNamesToGeneNames(cds_names, df), external_gene_name = c("ATF4", "AAT1", "ML4", "AST2", "RPL4", "RPL12")) append_gene_symbols(dt, symbols_dt) append_gene_symbols(dt, symbols_dt, extend_id = FALSE)
Usefull to see if short ORFs prediction is dependent on length.
Split cds first in two, a start part and stop part.
Then say how large the two parts can be and merge them together.
It will sample a value in range give.
Parts will be forced to not overlap and can not extend outside
original cds
artificial.orfs( cds, start5 = 1, end5 = 4, start3 = -4, end3 = 0, bin.if.few = TRUE )artificial.orfs( cds, start5 = 1, end5 = 4, start3 = -4, end3 = 0, bin.if.few = TRUE )
cds |
a GRangesList of orfs, must have width %% 3 == 0 and length >= 6 |
start5 |
integer, default: 1 (start of orf) |
end5 |
integer, default: 4 (max 4 codons from start codon) |
start3 |
integer, default -4 (max 4 codons from stop codon) |
end3 |
integer, default: 0 (end of orf) |
bin.if.few |
logical, default TRUE, instead of per codon,
do per 2, 3, 4 codons if you have few samples compared to lengths wanted,
If you have 4 cds' and you want 7 different lengths, which is the standard,
it will give you possible nt length: 6-12-18-24 instead of original
6-9-12-15-18-21-24. |
If artificial cds length is not divisible by 2, like 3 codons,
the second codon will always be from the start region etc.
Also If there are many very short original cds, the distribution
will be skewed towards more smaller artificial cds.
GRangesList of new ORFs (sorted: + strand increasing start, - strand decreasing start)
txdb <- ORFik.template.experiment() #cds <- loadRegion(txdb, "cds") ## To get enough CDSs, just replicate them # cds <- rep(cds, 100) #artificial.orfs(cds)txdb <- ORFik.template.experiment() #cds <- loadRegion(txdb, "cds") ## To get enough CDSs, just replicate them # cds <- rep(cds, 100) #artificial.orfs(cds)
Single exon format:
"1:14598834-14598914:+"
Multi-exon format (exon separator: ';'):
"1:15210514-15210562:+;1:15214895-15215025:+"
## S4 method for signature 'GRangesList' as.character(x, ...)## S4 method for signature 'GRangesList' as.character(x, ...)
x |
|
... |
Not used for now, to preserve generic requirement |
a character vector, 1 element per element in GRangesList
For all cds in txdb, that does not have a 5' leader: Start at 1 base upstream of cds and use CAGE, to assign leader start. All these leaders will be 1 exon based, if you really want exon splicings, you can use exon prediction tools, or run sequencing experiments.
assignTSSByCage( txdb, cage, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, preCleanup = TRUE, pseudoLength = 1 )assignTSSByCage( txdb, cage, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, preCleanup = TRUE, pseudoLength = 1 )
txdb |
a TxDb file, a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite) or an ORFik experiment |
cage |
Either a filePath for the CageSeq file as .bed .bam or .wig, with possible compressions (".gzip", ".gz", ".bgz"), or already loaded CageSeq peak data as GRanges or GAlignment. NOTE: If it is a .bam file, it will add a score column by running: convertToOneBasedRanges(cage, method = "5prime", addScoreColumn = TRUE) The score column is then number of replicates of read, if score column is something else, like read length, set the score column to NULL first. |
extension |
The maximum number of basses upstream of the TSS to search for CageSeq peak. |
filterValue |
The minimum number of reads on cage position, for it to be counted as possible new tss. (represented in score column in CageSeq data) If you already filtered, set it to 0. |
restrictUpstreamToTx |
a logical (FALSE). If TRUE: restrict leaders to not extend closer than 5 bases from closest upstream leader, set this to TRUE. |
removeUnused |
logical (FALSE), if False: (standard is to set them to original annotation), If TRUE: remove leaders that did not have any cage support. |
preCleanup |
logical (TRUE), if TRUE, remove all reads in region (-5:-1, 1:5) of all original tss in leaders. This is to keep original TSS if it is only +/- 5 bases from the original. |
pseudoLength |
a numeric, default 1. Add a pseudo length for all the UTRs. Will not extend a leader if it would make it go outside the defined seqlengths of the chromosome (for non circular chromosomes), or extending closer than 50 nucleotides to upstream cds. So this length is not guaranteed for all! |
Given a TxDb object, reassign the start site per transcript using max peaks from CageSeq data. A max peak is defined as new TSS if it is within boundary of 5' leader range, specified by 'extension' in bp. A max peak must also be higher than minimum CageSeq peak cutoff specified in 'filterValue'. The new TSS will then be the positioned where the cage read (with highest read count in the interval). If no CAGE supports a leader, the width will be set to 1 base.
a TxDb obect of reassigned transcripts
Other CAGE:
reassignTSSbyCage(),
reassignTxDbByCage()
txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") cagePath <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") ## Not run: assignTSSByCage(txdbFile, cagePath) #Minimum 20 cage tags for new TSS assignTSSByCage(txdbFile, cagePath, filterValue = 20) # Create pseudo leaders for the ones without hits assignTSSByCage(txdbFile, cagePath, pseudoLength = 100) # Create only pseudo leaders (in example 2 leaders are added) assignTSSByCage(txdbFile, cage = NULL, pseudoLength = 100) ## End(Not run)txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") cagePath <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") ## Not run: assignTSSByCage(txdbFile, cagePath) #Minimum 20 cage tags for new TSS assignTSSByCage(txdbFile, cagePath, filterValue = 20) # Create pseudo leaders for the ones without hits assignTSSByCage(txdbFile, cagePath, pseudoLength = 100) # Create only pseudo leaders (in example 2 leaders are added) assignTSSByCage(txdbFile, cage = NULL, pseudoLength = 100) ## End(Not run)
Map range coordinates between features in the genome and transcriptome (reference) space.
asTX( grl, reference, ignore.strand = FALSE, x.is.sorted = TRUE, tx.is.sorted = TRUE )asTX( grl, reference, ignore.strand = FALSE, x.is.sorted = TRUE, tx.is.sorted = TRUE )
grl |
a |
reference |
a GRangesList of ranges that include grl as a subset of ranges. Example: cds is grl and mrna can be reference |
ignore.strand |
When ignore.strand is TRUE, strand is ignored in
overlaps operations (i.e., all strands are considered "+") and the
strand in the output is '*'. |
x.is.sorted |
if x is a GRangesList object, are "-" strand groups pre-sorted in decreasing order within group, default: TRUE |
tx.is.sorted |
if transcripts is a GRangesList object, are "-" strand groups pre-sorted in decreasing order within group, default: TRUE |
Similar to GenomicFeatures' pmapToTranscripts, but in this version the grl ranges are compared to reference ranges with same name, not by index. This gives a large speedup, but also requires all objects must be named.
a GRangesList in transcript coordinates
Other ExtendGenomicRanges:
coveragePerTiling(),
extendLeaders(),
extendTrailers(),
reduceKeepAttr(),
tile1(),
txSeqsFromFa(),
windowPerGroup()
seqname <- c("tx1", "tx2", "tx3") seqs <- c("ATGGGTATTTATA", "AAAAA", "ATGGGTAATA") grIn1 <- GRanges(seqnames = "1", ranges = IRanges(start = c(21, 10), end = c(23, 19)), strand = "-") grIn2 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1), end = c(5)), strand = "-") grIn3 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1010), end = c(1019)), strand = "-") grl <- GRangesList(grIn1, grIn2, grIn3) names(grl) <- seqname # Find ORFs test_ranges <- findMapORFs(grl, seqs, "ATG|TGG|GGG", "TAA|AAT|ATA", longestORF = FALSE, minimumLength = 0) # Genomic coordinates ORFs test_ranges # Transcript coordinate ORFs asTX(test_ranges, reference = grl) # seqnames will here be index of transcript it came fromseqname <- c("tx1", "tx2", "tx3") seqs <- c("ATGGGTATTTATA", "AAAAA", "ATGGGTAATA") grIn1 <- GRanges(seqnames = "1", ranges = IRanges(start = c(21, 10), end = c(23, 19)), strand = "-") grIn2 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1), end = c(5)), strand = "-") grIn3 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1010), end = c(1019)), strand = "-") grl <- GRangesList(grIn1, grIn2, grIn3) names(grl) <- seqname # Find ORFs test_ranges <- findMapORFs(grl, seqs, "ATG|TGG|GGG", "TAA|AAT|ATA", longestORF = FALSE, minimumLength = 0) # Genomic coordinates ORFs test_ranges # Transcript coordinate ORFs asTX(test_ranges, reference = grl) # seqnames will here be index of transcript it came from
experiment
What will each sample be called given the columns of the experiment? A column is included if more than 1 unique element value exist in that column.
bamVarName( df, skip.replicate = length(unique(df$rep)) == 1, skip.condition = length(unique(df$condition)) == 1, skip.stage = length(unique(df$stage)) == 1, skip.fraction = length(unique(df$fraction)) == 1, skip.experiment = !tryCatch(df@expInVarName, error = function(e) FALSE), skip.libtype = FALSE, fraction_prepend_f = TRUE )bamVarName( df, skip.replicate = length(unique(df$rep)) == 1, skip.condition = length(unique(df$condition)) == 1, skip.stage = length(unique(df$stage)) == 1, skip.fraction = length(unique(df$fraction)) == 1, skip.experiment = !tryCatch(df@expInVarName, error = function(e) FALSE), skip.libtype = FALSE, fraction_prepend_f = TRUE )
df |
an ORFik |
skip.replicate |
a logical (FALSE), don't include replicate in variable name. |
skip.condition |
a logical (FALSE), don't include condition in variable name. |
skip.stage |
a logical (FALSE), don't include stage in variable name. |
skip.fraction |
a logical (FALSE), don't include fraction |
skip.experiment |
a logical (FALSE), don't include experiment |
skip.libtype |
a logical (FALSE), don't include libtype |
fraction_prepend_f |
a logical (TRUE), include "f" in front of fraction, useful for knowing what fraction is. |
variable names of libraries (character vector)
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
df <- ORFik.template.experiment() bamVarName(df) ## without libtype bamVarName(df, skip.libtype = TRUE) ## Without experiment name bamVarName(df, skip.experiment = TRUE)df <- ORFik.template.experiment() bamVarName(df) ## without libtype bamVarName(df, skip.libtype = TRUE) ## Without experiment name bamVarName(df, skip.experiment = TRUE)
Open SRA in browser for specific bioproject
browseSRA(x, browser = getOption("browser"))browseSRA(x, browser = getOption("browser"))
x |
character, bioproject ID. |
browser |
a non-empty character string giving the name of the program to be used as the HTML browser. It should be in the PATH, or a full path specified. Alternatively, an R function to be called to invoke the browser. Under Windows |
invisible(NULL), opens webpage only
Other sra:
download.SRA(),
download.SRA.metadata(),
download.ebi(),
get_bioproject_candidates(),
install.sratoolkit(),
rename.SRA.files()
#browseSRA("PRJNA336542") #' # For windows make sure a valid browser is defined: browser <- getOption("browser") #browseSRA("PRJNA336542", browser)#browseSRA("PRJNA336542") #' # For windows make sure a valid browser is defined: browser <- getOption("browser") #browseSRA("PRJNA336542", browser)
Search for a txt file at location: file.path(refFolder(x), "canonical_isoforms.txt"), where x is an ORFik experiment.
canonical_isoforms(x)canonical_isoforms(x)
x |
an ORFik |
a character vector
df <- ORFik.template.experiment() canonical_isoforms(df)df <- ORFik.template.experiment() canonical_isoforms(df)
Search for a txt file at location: file.path(refFolder(x), "canonical_isoforms.txt"), where x is an ORFik experiment.
## S4 method for signature 'experiment' canonical_isoforms(x)## S4 method for signature 'experiment' canonical_isoforms(x)
x |
an ORFik |
a character vector
df <- ORFik.template.experiment() canonical_isoforms(df)df <- ORFik.template.experiment() canonical_isoforms(df)
Per AA / codon, analyse the coverage, get a multitude of features. For both A sites and P-sites (Input reads must be P-sites for now) This function takes inspiration from the codonDT paper, and among others returns the negative binomial estimates, but in addition many other features.
codon_usage( reads, cds, mrna, faFile, filter_table, filter_cds_mod3 = TRUE, min_counts_cds_filter = max(min(quantile(filter_table, 0.5), 1000), 1000), with_A_sites = TRUE, aligned_position = "center", code = GENETIC_CODE )codon_usage( reads, cds, mrna, faFile, filter_table, filter_cds_mod3 = TRUE, min_counts_cds_filter = max(min(quantile(filter_table, 0.5), 1000), 1000), with_A_sites = TRUE, aligned_position = "center", code = GENETIC_CODE )
reads |
either a single library (GRanges, GAlignment, GAlignmentPairs),
or a list of libraries returned from |
cds |
a GRangesList |
mrna |
a GRangesList |
faFile |
a FaFile from genome |
filter_table |
a matrix / vector of length equal to cds |
filter_cds_mod3 |
logical, default TRUE. Remove all ORFs that are not mod3, this speeds up the computation a lot, and usually removes malformed ORFs you would not want anyway. |
min_counts_cds_filter |
numeric, default:
|
with_A_sites |
logical, default TRUE. Not used yet, will also return A site scores. |
aligned_position |
what positions should be taken to calculate per-codon coverage. By default: "center", meaning that positions -1,0,1 will be taken. Alternative: "left", then positions 0,1,2 are taken. |
code |
a named character vector of size 64. Default: GENETIC_CODE. Change if organism does not use the standard code. |
The primary column to use is "mean_txNorm", this is the fair normalized score.
a data.table of rows per AA:codon. All values are given per library, per site (A or P) per codon type (start, internal, stop), sorted by the mean_txNorm_percentage column of the first library in the set, the columns are:
variable (character) : Library name
seq (character) : Amino acid:codon , for start codons: Amino acid is #, and stop codons are "*". So for human, there will be both #:ATG (the start sites), and M:ATG (internal ATGs)
sum (integer) : total counts per seq
sum_txNorm (integer) : total counts per seq normalized per tx
var (numeric) : variance of total counts per seq
N (integer) : total number of genes with this codon, per type (start, stop, internal codon)
N.total (integer) : total number of codons over all genes, per type (start, stop, internal codon)
mean_txNorm (numeric) : Default use output, the fair codon usage, normalized both for gene and genome level for codon and read counts
mean_txNorm_percentage : Percentage transform of mean_txNorm
dispersion : (mean^2) / (var - mean)
dispersion_txNorm : (mean_txNorm^2) / (var_txNorm - mean_txNorm)
alpha (numeric) : dirichlet alpha MOM estimator (imagine mean and variance of probability in 1 value, the lower the value, the higher the variance, mean is decided by the relative value between samples)
sum_txNorm (integer) : total counts per seq normalized per tx
relative_to_max_score (integer) : Max scaled percentage of mean_txNorm_percentage, so percentage on the ratio of mean_txNorm_percentage / max(mean_txNorm_percentage)
type (factor(character)) : "P" or "A"
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7196831/
Other codon:
codon_usage_exp(),
codon_usage_plot()
df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs ## For single library reads <- fimport(filepath(df[1,], "pshifted")) cds <- loadRegion(df, "cds", filterTranscripts(df)) mrna <- loadRegion(df, "mrna", names(cds)) filter_table <- assay(countTable(df, type = "summarized")[names(cds)]) faFile <- findFa(df) res <- codon_usage(reads, cds, mrna, faFile = faFile, filter_table = filter_table, min_counts_cds_filter = 10)df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs ## For single library reads <- fimport(filepath(df[1,], "pshifted")) cds <- loadRegion(df, "cds", filterTranscripts(df)) mrna <- loadRegion(df, "mrna", names(cds)) filter_table <- assay(countTable(df, type = "summarized")[names(cds)]) faFile <- findFa(df) res <- codon_usage(reads, cds, mrna, faFile = faFile, filter_table = filter_table, min_counts_cds_filter = 10)
Per AA / codon, analyse the coverage, get a multitude of features. For both A sites and P-sites (Input reads must be P-sites for now) This function takes inspiration from the codonDT paper, and among others returns the negative binomial estimates, but in addition many other features.
codon_usage_exp( df, reads, cds = loadRegion(df, "cds", filterTranscripts(df)), mrna = loadRegion(df, "mrna", names(cds)), filter_cds_mod3 = TRUE, filter_table = assay(countTable(df, type = "summarized")[names(cds)]), faFile = df@fafile, min_counts_cds_filter = max(min(quantile(filter_table, 0.5), 1000), 1000), with_A_sites = TRUE, code = GENETIC_CODE, aligned_position = "center" )codon_usage_exp( df, reads, cds = loadRegion(df, "cds", filterTranscripts(df)), mrna = loadRegion(df, "mrna", names(cds)), filter_cds_mod3 = TRUE, filter_table = assay(countTable(df, type = "summarized")[names(cds)]), faFile = df@fafile, min_counts_cds_filter = max(min(quantile(filter_table, 0.5), 1000), 1000), with_A_sites = TRUE, code = GENETIC_CODE, aligned_position = "center" )
df |
an ORFik |
reads |
either a single library (GRanges, GAlignment, GAlignmentPairs),
or a list of libraries returned from |
cds |
a GRangesList, the coding sequences, default:
|
mrna |
a GRangesList, the full mRNA sequences (matching by names
the cds sequences), default:
|
filter_cds_mod3 |
logical, default TRUE. Remove all ORFs that are not mod3, this speeds up the computation a lot, and usually removes malformed ORFs you would not want anyway. |
filter_table |
an numeric(integer) matrix, where rownames are the names of the full set of mRNA transcripts. This will be subsetted to the cds subset you use. Then CDSs are filtered from this table by the 'min_counts_cds_filter' argument. |
faFile |
|
min_counts_cds_filter |
numeric, default:
|
with_A_sites |
logical, default TRUE. Not used yet, will also return A site scores. |
code |
a named character vector of size 64. Default: GENETIC_CODE. Change if organism does not use the standard code. |
aligned_position |
what positions should be taken to calculate per-codon coverage. By default: "center", meaning that positions -1,0,1 will be taken. Alternative: "left", then positions 0,1,2 are taken. |
The primary column to use is "mean_txNorm", this is the fair normalized score.
a data.table of rows per AA:codon. All values are given per library, per site (A or P) per codon type (start, internal, stop), sorted by the mean_txNorm_percentage column of the first library in the set, the columns are:
variable (character) : Library name
seq (character) : Amino acid:codon , for start codons: Amino acid is #, and stop codons are "*". So for human, there will be both #:ATG (the start sites), and M:ATG (internal ATGs)
sum (integer) : total counts per seq
sum_txNorm (integer) : total counts per seq normalized per tx
var (numeric) : variance of total counts per seq
N (integer) : total number of genes with this codon, per type (start, stop, internal codon)
N.total (integer) : total number of codons over all genes, per type (start, stop, internal codon)
mean_txNorm (numeric) : Default use output, the fair codon usage, normalized both for gene and genome level for codon and read counts
mean_txNorm_percentage : Percentage transform of mean_txNorm
dispersion : (mean^2) / (var - mean)
dispersion_txNorm : (mean_txNorm^2) / (var_txNorm - mean_txNorm)
alpha (numeric) : dirichlet alpha MOM estimator (imagine mean and variance of probability in 1 value, the lower the value, the higher the variance, mean is decided by the relative value between samples)
sum_txNorm (integer) : total counts per seq normalized per tx
relative_to_max_score (integer) : Max scaled percentage of mean_txNorm_percentage, so percentage on the ratio of mean_txNorm_percentage / max(mean_txNorm_percentage)
type (factor(character)) : "P" or "A"
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7196831/
Other codon:
codon_usage(),
codon_usage_plot()
df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs ## For single library res <- codon_usage_exp(df, fimport(filepath(df[1,], "pshifted")), min_counts_cds_filter = 10) # mean_txNorm is adviced scoring column # codon_usage_plot(res, res$mean_txNorm) # Default for plot function is the percentage scaled version of mean_txNorm # codon_usage_plot(res) # This gives check error ## For multiple libs res2 <- codon_usage_exp(df, outputLibs(df, type = "pshifted", output.mode = "list"), min_counts_cds_filter = 10) # codon_usage_plot(res2)df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs ## For single library res <- codon_usage_exp(df, fimport(filepath(df[1,], "pshifted")), min_counts_cds_filter = 10) # mean_txNorm is adviced scoring column # codon_usage_plot(res, res$mean_txNorm) # Default for plot function is the percentage scaled version of mean_txNorm # codon_usage_plot(res) # This gives check error ## For multiple libs res2 <- codon_usage_exp(df, outputLibs(df, type = "pshifted", output.mode = "list"), min_counts_cds_filter = 10) # codon_usage_plot(res2)
Plot codon_usage
codon_usage_plot( res, score_column = res$relative_to_max_score, ylab = "Ribo-seq library", legend.position = "none", limit = c(0, max(score_column)), midpoint = max(limit/2), monospace_font = TRUE, ignore_start_stop_codons = FALSE )codon_usage_plot( res, score_column = res$relative_to_max_score, ylab = "Ribo-seq library", legend.position = "none", limit = c(0, max(score_column)), midpoint = max(limit/2), monospace_font = TRUE, ignore_start_stop_codons = FALSE )
res |
a data.table of output from a codon_usage function |
score_column |
numeric, default: res$relative_to_max_score. Which parameter to use as score column. |
ylab |
character vector, names for libraries to show on Y axis |
legend.position |
character, default "none", do not display legend. |
limit |
numeric, 2 values for plot color limits. Default: c(0, max(score_column)) |
midpoint |
numeric, default: max(limit / 2). midpoint of color limit. |
monospace_font |
logical, default TRUE. Use monospace font, this does not work on systems (require specific font packages), set to FALSE if it crashes for you. |
ignore_start_stop_codons |
logical, default FALSE. If TRUE, remove start (#) and stop (*) codons. |
a ggplot object
Other codon:
codon_usage(),
codon_usage_exp()
df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs ## For multiple libs res2 <- codon_usage_exp(df, outputLibs(df, type = "pshifted", output.mode = "list"), min_counts_cds_filter = 10) # codon_usage_plot(res2, monospace_font = TRUE) # This gives check error codon_usage_plot(res2, monospace_font = FALSE) # monospace font looks betterdf <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs ## For multiple libs res2 <- codon_usage_exp(df, outputLibs(df, type = "pshifted", output.mode = "list"), min_counts_cds_filter = 10) # codon_usage_plot(res2, monospace_font = TRUE) # This gives check error codon_usage_plot(res2, monospace_font = FALSE) # monospace font looks better
For each unique read in the file, collapse into 1 and state in the fasta header how many reads existed of that type. This is done after trimming usually, works best for reads < 50 read length. Not so effective for 150 bp length mRNA-seq etc.
collapse.fastq( files, outdir = file.path(dirname(files[1]), "collapsed"), header.out.format = "ribotoolkit", compress = FALSE, prefix = "collapsed_" )collapse.fastq( files, outdir = file.path(dirname(files[1]), "collapsed"), header.out.format = "ribotoolkit", compress = FALSE, prefix = "collapsed_" )
files |
paths to fasta / fastq files to collapse. I tries to detect format per file, if file does not have .fastq, .fastq.gz, .fq or fq.gz extensions, it will be treated as a .fasta file format. |
outdir |
outdir to save files, default:
|
header.out.format |
character, default "ribotoolkit", else must be "fastx". How the read header of the output fasta should be formated: ribotoolkit: ">seq1_x55", sequence 1 has 55 duplicated reads collapsed. fastx: ">1-55", sequence 1 has 55 duplicated reads collapsed |
compress |
logical, default FALSE |
prefix |
character, default "collapsed_" Prefix to name of output file. |
invisible(NULL), files saved to disc in fasta format.
seqs <- rep(c("AAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "GGGGGGGGGGGGGGGGGGGG"), times = c(2,3)) fastq.folder <- tempfile() dir.create(fastq.folder) fastq.file <- file.path(fastq.folder, "test.fasta") writeXStringSet(DNAStringSet(seqs), filepath = fastq.file) infiles <- dir(fastq.folder, "fasta|fastq", full.names = TRUE) collapse.fastq(infiles) readDNAStringSet(file.path(fastq.folder, "collapsed", "collapsed_test.fasta")) # You see names says x3 of read 1 (GGGG...) and x2 of read 2 (AAAA....)seqs <- rep(c("AAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "GGGGGGGGGGGGGGGGGGGG"), times = c(2,3)) fastq.folder <- tempfile() dir.create(fastq.folder) fastq.file <- file.path(fastq.folder, "test.fasta") writeXStringSet(DNAStringSet(seqs), filepath = fastq.file) infiles <- dir(fastq.folder, "fasta|fastq", full.names = TRUE) collapse.fastq(infiles) readDNAStringSet(file.path(fastq.folder, "collapsed", "collapsed_test.fasta")) # You see names says x3 of read 1 (GGGG...) and x2 of read 2 (AAAA....)
For every GRanges, GAlignments read, with the same: seqname, start, (cigar) / width and strand, collapse and give a new meta column called "score", which contains the number of duplicates of that read. If score column already exists, will return input object!
collapseDuplicatedReads(x, addScoreColumn = TRUE, ...)collapseDuplicatedReads(x, addScoreColumn = TRUE, ...)
x |
a GRanges, GAlignments or GAlignmentPairs object |
addScoreColumn |
logical, default: (TRUE), if FALSE, only collapse and not keep score column of counts for collapsed reads. Returns directly without collapsing if reuse.score.column is FALSE and score is already defined. |
... |
alternative arguments for class instances. For example, see:
|
a GRanges, GAlignments, GAlignmentPairs or data.table object, same as input
gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)
For every GRanges, GAlignments read, with the same: seqname, start, (cigar) / width and strand, collapse and give a new meta column called "score", which contains the number of duplicates of that read. If score column already exists, will return input object!
## S4 method for signature 'data.table' collapseDuplicatedReads( x, addScoreColumn = TRUE, addSizeColumn = FALSE, reuse.score.column = TRUE, keepCigar = FALSE )## S4 method for signature 'data.table' collapseDuplicatedReads( x, addScoreColumn = TRUE, addSizeColumn = FALSE, reuse.score.column = TRUE, keepCigar = FALSE )
x |
a GRanges, GAlignments or GAlignmentPairs object |
addScoreColumn |
logical, default: (TRUE), if FALSE, only collapse and not keep score column of counts for collapsed reads. Returns directly without collapsing if reuse.score.column is FALSE and score is already defined. |
addSizeColumn |
logical (FALSE), if TRUE, add a size column that for each read, that gives original width of read. Useful if you need original read lengths. This takes care of soft clips etc. If collapsing reads, each unique range will be grouped also by size. |
reuse.score.column |
logical (TRUE), if addScoreColumn is TRUE, and a score column exists, will sum up the scores to create a new score. If FALSE, will skip old score column and create new according to number of replicated reads after conversion. If addScoreColumn is FALSE, this argument is ignored. |
keepCigar |
logical, default FALSE. Keep the cigar information |
a GRanges, GAlignments, GAlignmentPairs or data.table object, same as input
gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)
For every GRanges, GAlignments read, with the same: seqname, start, (cigar) / width and strand, collapse and give a new meta column called "score", which contains the number of duplicates of that read. If score column already exists, will return input object!
## S4 method for signature 'GAlignmentPairs' collapseDuplicatedReads(x, addScoreColumn = TRUE)## S4 method for signature 'GAlignmentPairs' collapseDuplicatedReads(x, addScoreColumn = TRUE)
x |
a GRanges, GAlignments or GAlignmentPairs object |
addScoreColumn |
logical, default: (TRUE), if FALSE, only collapse and not keep score column of counts for collapsed reads. Returns directly without collapsing if reuse.score.column is FALSE and score is already defined. |
a GRanges, GAlignments, GAlignmentPairs or data.table object, same as input
gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)
For every GRanges, GAlignments read, with the same: seqname, start, (cigar) / width and strand, collapse and give a new meta column called "score", which contains the number of duplicates of that read. If score column already exists, will return input object!
## S4 method for signature 'GAlignments' collapseDuplicatedReads(x, addScoreColumn = TRUE, reuse.score.column = TRUE)## S4 method for signature 'GAlignments' collapseDuplicatedReads(x, addScoreColumn = TRUE, reuse.score.column = TRUE)
x |
a GRanges, GAlignments or GAlignmentPairs object |
addScoreColumn |
logical, default: (TRUE), if FALSE, only collapse and not keep score column of counts for collapsed reads. Returns directly without collapsing if reuse.score.column is FALSE and score is already defined. |
reuse.score.column |
logical (TRUE), if addScoreColumn is TRUE, and a score column exists, will sum up the scores to create a new score. If FALSE, will skip old score column and create new according to number of replicated reads after conversion. If addScoreColumn is FALSE, this argument is ignored. |
a GRanges, GAlignments, GAlignmentPairs or data.table object, same as input
gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)
For every GRanges, GAlignments read, with the same: seqname, start, (cigar) / width and strand, collapse and give a new meta column called "score", which contains the number of duplicates of that read. If score column already exists, will return input object!
## S4 method for signature 'GRanges' collapseDuplicatedReads( x, addScoreColumn = TRUE, addSizeColumn = FALSE, reuse.score.column = TRUE )## S4 method for signature 'GRanges' collapseDuplicatedReads( x, addScoreColumn = TRUE, addSizeColumn = FALSE, reuse.score.column = TRUE )
x |
a GRanges, GAlignments or GAlignmentPairs object |
addScoreColumn |
logical, default: (TRUE), if FALSE, only collapse and not keep score column of counts for collapsed reads. Returns directly without collapsing if reuse.score.column is FALSE and score is already defined. |
addSizeColumn |
logical (FALSE), if TRUE, add a size column that for each read, that gives original width of read. Useful if you need original read lengths. This takes care of soft clips etc. If collapsing reads, each unique range will be grouped also by size. |
reuse.score.column |
logical (TRUE), if addScoreColumn is TRUE, and a score column exists, will sum up the scores to create a new score. If FALSE, will skip old score column and create new according to number of replicated reads after conversion. If addScoreColumn is FALSE, this argument is ignored. |
a GRanges, GAlignments, GAlignmentPairs or data.table object, same as input
gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)gr <- rep(GRanges("chr1", 1:10,"+"), 2) collapseDuplicatedReads(gr)
Given a character vector, get all unique combinations of 2.
combn.pairs(x)combn.pairs(x)
x |
a character vector, will unique elements for you. |
a list of character vector pairs
df <- ORFik.template.experiment() ORFik:::combn.pairs(df[, "libtype"])df <- ORFik.template.experiment() ORFik:::combn.pairs(df[, "libtype"])
If you want to get all the NGS and/or sequence features easily,
you can use this function.
Each feature have a link to an article describing its creation and idea
behind it. Look at the functions in the feature family (in the "see also" section below)
to see all of them. Example, if you want to know what the "te" column is, check out:
?translationalEff.
A short description of each feature is also shown here:
** NGS features **
If not stated otherwise stated, the feature apply to Ribo-seq.
countRFP : raw counts of Ribo-seq
fpkmRFP : FPKM
fpkmRNA : FPKM of RNA-seq
te : Translation efficiency Ribo-seq / RNA-seq FPKM
floss : Fragment length similarity score
entropyRFP : Positional entropy
disengagementScores : downstream coverage from ORF
RRS : Ribosome release score
RSS : Ribosome staling score
ORFScores : Periodicity score, does frame 0 have more reads
ioScore : inside outside score: coverage ORF / coverage rest of transcript
startCodonCoverage : Coverage over start codon + 2nt before start codon
startRegionCoverage : Coverage over codon 2 & 3
startRegionRelative : Peakness of TIS, startCodonCoverage / startRegionCoverage, 0-n
** Sequence features **
kozak : Similarity to kozak sequence for organism score, 0-1
gc : GC percentage, 0-1
StartCodons : Start codon as a string, "ATG"
StopCodons : stop codon as a string, "TAA"
fractionLengths : ORF length compared to transcript, 0-1
** uORF features **
distORFCDS : Distance from ORF stop site to CDS, -n:n
inFrameCDS : Is ORF in frame with downstream CDS, T/F
isOverlappingCds : Is ORF overlapping with downstream CDS, T/F
rankInTx : ORF with most upstream start codon is 1, 1-n
computeFeatures( grl, RFP, RNA = NULL, Gtf, faFile = NULL, riboStart = 26, riboStop = 34, sequenceFeatures = TRUE, uorfFeatures = TRUE, grl.is.sorted = FALSE, weight.RFP = 1L, weight.RNA = 1L )computeFeatures( grl, RFP, RNA = NULL, Gtf, faFile = NULL, riboStart = 26, riboStop = 34, sequenceFeatures = TRUE, uorfFeatures = TRUE, grl.is.sorted = FALSE, weight.RFP = 1L, weight.RNA = 1L )
grl |
a |
RFP |
RiboSeq reads as |
RNA |
RnaSeq reads as |
Gtf |
a TxDb object of a gtf file or path to gtf, gff .sqlite etc. |
faFile |
a path to fasta indexed genome, an open |
riboStart |
usually 26, the start of the floss interval, see ?floss |
riboStop |
usually 34, the end of the floss interval |
sequenceFeatures |
a logical, default TRUE, include all sequence features, that is: Kozak, fractionLengths, distORFCDS, isInFrame, isOverlapping and rankInTx. uorfFeatures = FALSE will remove the 4 last. |
uorfFeatures |
a logical, default TRUE, include all uORF sequence features, that is: distORFCDS, isInFrame, isOverlapping and rankInTx |
grl.is.sorted |
logical (F), a speed up if you know argument grl is sorted, set this to TRUE. |
weight.RFP |
a vector (default: 1L). Can also be character name of column in RFP. As in translationalEff(weight = "score") for: GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. |
weight.RNA |
Same as weightRFP but for RNA weights. (default: 1L) |
If you used CageSeq to reannotate your leaders, your txDB object must
contain the reassigned leaders. Use [reassignTxDbByCage()] to get the txdb.
As a note the library is reduced to only reads overlapping 'tx', so the
library size in fpkm calculation is done on this subset. This will help
remove rRNA and other contaminants.
Also if you have only unique reads with a weight column, explaining the
number of duplicated reads, set weights to make calculations correct.
See getWeights
a data.table with scores, each column is one score type, name of columns are the names of the scores, i.g [floss()] or [fpkm()]
Other features:
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# Here we make an example from scratch # Usually the ORFs are found in orfik, which makes names for you etc. gtf <- system.file("extdata/references/danio_rerio", "annotations.gtf", package = "ORFik") ## location of the gtf file suppressWarnings(txdb <- loadTxdb(gtf)) # use cds' as ORFs for this example ORFs <- loadRegion(txdb, "cds") ORFs <- makeORFNames(ORFs) # need ORF names # make Ribo-seq data, RFP <- unlistGrl(firstExonPerGroup(ORFs)) computeFeatures(ORFs, RFP, Gtf = txdb) # For more details see vignettes.# Here we make an example from scratch # Usually the ORFs are found in orfik, which makes names for you etc. gtf <- system.file("extdata/references/danio_rerio", "annotations.gtf", package = "ORFik") ## location of the gtf file suppressWarnings(txdb <- loadTxdb(gtf)) # use cds' as ORFs for this example ORFs <- loadRegion(txdb, "cds") ORFs <- makeORFNames(ORFs) # need ORF names # make Ribo-seq data, RFP <- unlistGrl(firstExonPerGroup(ORFs)) computeFeatures(ORFs, RFP, Gtf = txdb) # For more details see vignettes.
If you have a txdb with correctly reassigned transcripts, use: [computeFeatures()]
computeFeaturesCage( grl, RFP, RNA = NULL, Gtf = NULL, tx = NULL, fiveUTRs = NULL, cds = NULL, threeUTRs = NULL, faFile = NULL, riboStart = 26, riboStop = 34, sequenceFeatures = TRUE, uorfFeatures = TRUE, grl.is.sorted = FALSE, weight.RFP = 1L, weight.RNA = 1L )computeFeaturesCage( grl, RFP, RNA = NULL, Gtf = NULL, tx = NULL, fiveUTRs = NULL, cds = NULL, threeUTRs = NULL, faFile = NULL, riboStart = 26, riboStop = 34, sequenceFeatures = TRUE, uorfFeatures = TRUE, grl.is.sorted = FALSE, weight.RFP = 1L, weight.RNA = 1L )
grl |
a |
RFP |
RiboSeq reads as |
RNA |
RnaSeq reads as |
Gtf |
a TxDb object of a gtf file or path to gtf, gff .sqlite etc. |
tx |
a GRangesList of transcripts, normally called from: exonsBy(Gtf, by = "tx", use.names = T) only add this if you are not including Gtf file If you are using CAGE, you do not need to reassign these to the cage peaks, it will do it for you. |
fiveUTRs |
fiveUTRs as GRangesList, if you used cage-data to extend 5' utrs, remember to input CAGE assigned version and not original! |
cds |
a GRangesList of coding sequences |
threeUTRs |
a GRangesList of transcript 3' utrs, normally called from: threeUTRsByTranscript(Gtf, use.names = T) |
faFile |
a path to fasta indexed genome, an open |
riboStart |
usually 26, the start of the floss interval, see ?floss |
riboStop |
usually 34, the end of the floss interval |
sequenceFeatures |
a logical, default TRUE, include all sequence features, that is: Kozak, fractionLengths, distORFCDS, isInFrame, isOverlapping and rankInTx. uorfFeatures = FALSE will remove the 4 last. |
uorfFeatures |
a logical, default TRUE, include all uORF sequence features, that is: distORFCDS, isInFrame, isOverlapping and rankInTx |
grl.is.sorted |
logical (F), a speed up if you know argument grl is sorted, set this to TRUE. |
weight.RFP |
a vector (default: 1L). Can also be character name of column in RFP. As in translationalEff(weight = "score") for: GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. |
weight.RNA |
Same as weightRFP but for RNA weights. (default: 1L) |
A specialized version if you don't have a correct txdb, for example with CAGE reassigned leaders while txdb is not updated. It is 2x faster for tested data. The point of this function is to give you the ability to input transcript etc directly into the function, and not load them from txdb. Each feature have a link to an article describing feature, try ?floss
a data.table with scores, each column is one score type, name of columns are the names of the scores, i.g [floss()] or [fpkm()]
Other features:
computeFeatures(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# a small example without cage-seq data: # we will find ORFs in the 5' utrs # and then calculate features on them if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { library(GenomicFeatures) # Get the gtf txdb file txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadDb(txdbFile) # Extract sequences of fiveUTRs. fiveUTRs <- fiveUTRsByTranscript(txdb, use.names = TRUE)[1:10] faFile <- BSgenome.Hsapiens.UCSC.hg19::Hsapiens tx_seqs <- extractTranscriptSeqs(faFile, fiveUTRs) # Find all ORFs on those transcripts and get their genomic coordinates fiveUTR_ORFs <- findMapORFs(fiveUTRs, tx_seqs) unlistedORFs <- unlistGrl(fiveUTR_ORFs) # group GRanges by ORFs instead of Transcripts fiveUTR_ORFs <- groupGRangesBy(unlistedORFs, unlistedORFs$names) # make some toy ribo seq and rna seq data starts <- unlistGrl(ORFik:::firstExonPerGroup(fiveUTR_ORFs)) RFP <- promoters(starts, upstream = 0, downstream = 1) score(RFP) <- rep(29, length(RFP)) # the original read widths # set RNA seq to duplicate transcripts RNA <- unlistGrl(exonsBy(txdb, by = "tx", use.names = TRUE)) #ORFik:::computeFeaturesCage(grl = fiveUTR_ORFs, RFP = RFP, # RNA = RNA, Gtf = txdb, faFile = faFile) } # See vignettes for more examples# a small example without cage-seq data: # we will find ORFs in the 5' utrs # and then calculate features on them if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { library(GenomicFeatures) # Get the gtf txdb file txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadDb(txdbFile) # Extract sequences of fiveUTRs. fiveUTRs <- fiveUTRsByTranscript(txdb, use.names = TRUE)[1:10] faFile <- BSgenome.Hsapiens.UCSC.hg19::Hsapiens tx_seqs <- extractTranscriptSeqs(faFile, fiveUTRs) # Find all ORFs on those transcripts and get their genomic coordinates fiveUTR_ORFs <- findMapORFs(fiveUTRs, tx_seqs) unlistedORFs <- unlistGrl(fiveUTR_ORFs) # group GRanges by ORFs instead of Transcripts fiveUTR_ORFs <- groupGRangesBy(unlistedORFs, unlistedORFs$names) # make some toy ribo seq and rna seq data starts <- unlistGrl(ORFik:::firstExonPerGroup(fiveUTR_ORFs)) RFP <- promoters(starts, upstream = 0, downstream = 1) score(RFP) <- rep(29, length(RFP)) # the original read widths # set RNA seq to duplicate transcripts RNA <- unlistGrl(exonsBy(txdb, by = "tx", use.names = TRUE)) #ORFik:::computeFeaturesCage(grl = fiveUTR_ORFs, RFP = RFP, # RNA = RNA, Gtf = txdb, faFile = faFile) } # See vignettes for more examples
Defines a folder for:
1. fastq files (raw data)
2. bam files (processed data)
3. references (organism annotation and STAR index)
4. experiments (Location to store and load all experiment .csv files)
Update or use another config using config.save() function.
config( file = config_file(old_config_location = old_config_location), old_config_location = "~/Bio_data/ORFik_config.csv" )config( file = config_file(old_config_location = old_config_location), old_config_location = "~/Bio_data/ORFik_config.csv" )
file |
location of config csv, default: config_file(old_config_location = old_config_location) |
old_config_location |
path, old config location before BiocFileCache implementation. Will copy this to cache directory and delete old version. This is done to follow bioc rules on not writing to user home directory. |
a named character vector of length 3
## Make with default config path #config()## Make with default config path #config()
Get path for ORFik config in cache
config_file( cache = BiocFileCache::getBFCOption("CACHE"), query = "ORFik_config", ask = interactive(), old_config_location = "~/Bio_data/ORFik_config.csv" )config_file( cache = BiocFileCache::getBFCOption("CACHE"), query = "ORFik_config", ask = interactive(), old_config_location = "~/Bio_data/ORFik_config.csv" )
cache |
path to bioc cache directory with rname from query argument.
Default is: |
query |
default: "ORFik_config". Exact rname of the file in cache. |
ask |
logical, default interactive(). |
old_config_location |
path, old config location before BiocFileCache implementation. Will copy this to cache directory and delete old version. This is done to follow bioc rules on not writing to user home directory. |
a file path in cache
config_file() # Another config path config_file(query = "ORFik_config_2")config_file() # Another config path config_file(query = "ORFik_config_2")
Defines a folder for:
1. fastq files (raw_data)
2. bam files (processed data)
3. references (organism annotation and STAR index)
4. Experiment (name of experiment)
config.exper( experiment, assembly, type, config = ORFik::config(), sub_dir_single = file.path(type, experiment, ""), name_with_type_suffix = TRUE )config.exper( experiment, assembly, type, config = ORFik::config(), sub_dir_single = file.path(type, experiment, ""), name_with_type_suffix = TRUE )
experiment |
short name of experiment (must be valid as a folder name) |
assembly |
name of organism and assembly (must be valid as a folder name) |
type |
name of sequencing type, Ribo-seq, RNA-seq, CAGE.. Can be more than one. |
config |
a named character vector of length 3,
default: |
sub_dir_single |
character, path. Default: |
name_with_type_suffix |
logical, default TRUE. Make fastq name like 'fastq RNA-seq', setting it to FALSE gives name 'fastq'. Only allowed when length(type) == 1 |
named character vector of paths for experiment
# Where should files go in general? ORFik::config() # Paths for project: "Alexaki_Human" containing Ribo-seq and RNA-seq: #config.exper("Alexaki_Human", "Homo_sapiens_GRCh38_101", c("Ribo-seq", "RNA-seq"))# Where should files go in general? ORFik::config() # Paths for project: "Alexaki_Human" containing Ribo-seq and RNA-seq: #config.exper("Alexaki_Human", "Homo_sapiens_GRCh38_101", c("Ribo-seq", "RNA-seq"))
Defines a folder for fastq files (raw_data), bam files (processed data) and references (organism annotation and STAR index)
config.save( file = config_file(), fastq.dir = file.path(base.dir, "raw_data"), bam.dir = file.path(base.dir, "processed_data"), reference.dir = file.path(base.dir, "references"), exp.dir = file.path(base.dir, "ORFik_experiments/"), base.dir = "~/Bio_data", conf = data.frame(type = c("fastq", "bam", "ref", "exp"), directory = c(fastq.dir, bam.dir, reference.dir, exp.dir)) )config.save( file = config_file(), fastq.dir = file.path(base.dir, "raw_data"), bam.dir = file.path(base.dir, "processed_data"), reference.dir = file.path(base.dir, "references"), exp.dir = file.path(base.dir, "ORFik_experiments/"), base.dir = "~/Bio_data", conf = data.frame(type = c("fastq", "bam", "ref", "exp"), directory = c(fastq.dir, bam.dir, reference.dir, exp.dir)) )
file |
location of config csv, default: config_file(old_config_location = old_config_location) |
fastq.dir |
directory where ORFik puts fastq file directories,
default: file.path(base.dir, "raw_data"), which is retrieved with:
|
bam.dir |
directory where ORFik puts bam file directories,
default: file.path(base.dir, "processed_data"), which is retrieved with:
|
reference.dir |
directory where ORFik puts reference file directories,
default: file.path(base.dir, "references"), which is retrieved with:
|
exp.dir |
directory where ORFik puts experiment csv files,
default: file.path(base.dir, "ORFik_experiments/"), which is retrieved with:
|
base.dir |
base directory for all output directories, default: "~/Bio_data" |
conf |
data.frame of complete conf object, default: data.frame(type = c("fastq", "bam", "ref", "exp"), directory = c(fastq.dir, bam.dir, reference.dir, exp.dir)) |
invisible(NULL), file saved to disc
# Overwrite default config, with new base directory for files #config.save(base.dir = "/media/Bio_data/") # Output files go here instead # of ~/Bio_data ## Dont do this, but for understanding here is how to make a second config #new_config_path <- config_file(query = "ORFik_config_2") #config.save(new_config_path, "/media/Bio_data/raw_data/", # "/media/Bio_data/processed_data", /media/Bio_data/references/)# Overwrite default config, with new base directory for files #config.save(base.dir = "/media/Bio_data/") # Output files go here instead # of ~/Bio_data ## Dont do this, but for understanding here is how to make a second config #new_config_path <- config_file(query = "ORFik_config_2") #config.save(new_config_path, "/media/Bio_data/raw_data/", # "/media/Bio_data/processed_data", /media/Bio_data/references/)
Saved by default in folder "ofst" relative to default libraries of experiment. Speeds up loading of full files compared to bam by large margins.
convert_bam_to_ofst( df, in_files = filepath(df, "default"), out_dir = file.path(libFolder(df, unique_mappers = only_unique_mappers), "ofst"), verbose = TRUE, strandMode = rep(0, length(in_files)), only_unique_mappers = uniqueMappers(df) )convert_bam_to_ofst( df, in_files = filepath(df, "default"), out_dir = file.path(libFolder(df, unique_mappers = only_unique_mappers), "ofst"), verbose = TRUE, strandMode = rep(0, length(in_files)), only_unique_mappers = uniqueMappers(df) )
df |
an ORFik |
in_files |
paths to input files, default:
|
out_dir |
paths to output files, default
|
verbose |
logical, default TRUE, message about library output status. |
strandMode |
numeric, default 0. Only used for paired end bam files. One of (0: strand = *, 1: first read of pair is +, 2: first read of pair is -). See ?strandMode. Note: Sets default to 0 instead of 1, as readGAlignmentPairs uses 1. This is to guarantee hits, but will also make mismatches of overlapping transcripts in opposite directions. |
only_unique_mappers |
logical, default |
If you want to keep bam files loaded or faster conversion if you already have them loaded, use ORFik::convertLibs instead
invisible(NULL), files saved to disc
Other lib_converters:
convertLibs(),
convert_to_bigWig(),
convert_to_covRle(),
convert_to_covRleList()
df <- ORFik.template.experiment.zf() ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "ofst") convert_bam_to_ofst(df, out_dir = folder_to_save) fimport(file.path(folder_to_save, "ribo-seq.ofst")) folder_to_save_unique <- file.path(tempdir(), "unique_mappers", "ofst") convert_bam_to_ofst(df, out_dir = folder_to_save_unique, only_unique_mappers = TRUE) fimport(file.path(folder_to_save_unique, "ribo-seq.ofst"))df <- ORFik.template.experiment.zf() ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "ofst") convert_bam_to_ofst(df, out_dir = folder_to_save) fimport(file.path(folder_to_save, "ribo-seq.ofst")) folder_to_save_unique <- file.path(tempdir(), "unique_mappers", "ofst") convert_bam_to_ofst(df, out_dir = folder_to_save_unique, only_unique_mappers = TRUE) fimport(file.path(folder_to_save_unique, "ribo-seq.ofst"))
Convert to BigWig
convert_to_bigWig( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "bigwig"), split.by.strand = TRUE, split.by.readlength = FALSE, seq_info = seqinfo(df), weight = "score", is_pre_collapsed = FALSE, verbose = TRUE )convert_to_bigWig( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "bigwig"), split.by.strand = TRUE, split.by.readlength = FALSE, seq_info = seqinfo(df), weight = "score", is_pre_collapsed = FALSE, verbose = TRUE )
df |
an ORFik |
in_files |
paths to input files, default pshifted files:
|
out_dir |
paths to output files, default
|
split.by.strand |
logical, default TRUE, split into forward and reverse strand RleList inside covRle object. |
split.by.readlength |
logical, default FALSE, split into files for each readlength, defined by readWidths(x) for each file. |
seq_info |
SeqInfo object, default |
weight |
integer, numeric or single length character. Default "score". Use score column in loaded in_files. |
is_pre_collapsed |
logical, default FALSE. Have you already collapsed reads with collapse.by.scores, so each positions is only in 1 GRanges object with a score column per readlength? Set to TRUE, only if you are sure, will give a speedup. |
verbose |
logical, default TRUE, message about library output status. |
invisible(NULL), files saved to disc
Other lib_converters:
convertLibs(),
convert_bam_to_ofst(),
convert_to_covRle(),
convert_to_covRleList()
df <- ORFik.template.experiment()[10,] ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "bigwig") convert_to_bigWig(df, out_dir = folder_to_save) fimport(file.path(folder_to_save, c("RFP_Mutant_rep2_forward.bigWig", "RFP_Mutant_rep2_reverse.bigWig")))df <- ORFik.template.experiment()[10,] ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "bigwig") convert_to_bigWig(df, out_dir = folder_to_save) fimport(file.path(folder_to_save, c("RFP_Mutant_rep2_forward.bigWig", "RFP_Mutant_rep2_reverse.bigWig")))
Saved by default in folder "cov_RLE" relative to default libraries of experiment
convert_to_covRle( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "cov_RLE"), split.by.strand = TRUE, split.by.readlength = FALSE, seq_info = seqinfo(df), weight = "score", format = "qs", verbose = TRUE )convert_to_covRle( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "cov_RLE"), split.by.strand = TRUE, split.by.readlength = FALSE, seq_info = seqinfo(df), weight = "score", format = "qs", verbose = TRUE )
df |
an ORFik |
in_files |
paths to input files, default pshifted files:
|
out_dir |
paths to output files, default
|
split.by.strand |
logical, default TRUE, split into forward and reverse strand RleList inside covRle object. |
split.by.readlength |
logical, default FALSE, split into files for each readlength, defined by readWidths(x) for each file. |
seq_info |
SeqInfo object, default |
weight |
integer, numeric or single length character. Default "score". Use score column in loaded in_files. |
format |
chatacter, default "qs", alternative "rds". File format to save R object. |
verbose |
logical, default TRUE, message about library output status. |
invisible(NULL), files saved to disc
Other lib_converters:
convertLibs(),
convert_bam_to_ofst(),
convert_to_bigWig(),
convert_to_covRleList()
df <- ORFik.template.experiment()[10,] ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "cov_RLE") convert_to_covRle(df, out_dir = folder_to_save) fimport(file.path(folder_to_save, "RFP_Mutant_rep2.covqs"))df <- ORFik.template.experiment()[10,] ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "cov_RLE") convert_to_covRle(df, out_dir = folder_to_save) fimport(file.path(folder_to_save, "RFP_Mutant_rep2.covqs"))
Useful to store reads separated by readlength, for much faster coverage calculation. Saved by default in folder "cov_RLE_List" relative to default libraries of experiment
convert_to_covRleList( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "cov_RLE_List"), out_dir_merged = file.path(libFolder(df), "cov_RLE"), split.by.strand = TRUE, seq_info = seqinfo(df), weight = "score", format = "qs", verbose = TRUE )convert_to_covRleList( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "cov_RLE_List"), out_dir_merged = file.path(libFolder(df), "cov_RLE"), split.by.strand = TRUE, seq_info = seqinfo(df), weight = "score", format = "qs", verbose = TRUE )
df |
an ORFik |
in_files |
paths to input files, default pshifted files:
|
out_dir |
paths to output files, default
|
out_dir_merged |
character vector of paths, default:
|
split.by.strand |
logical, default TRUE, split into forward and reverse strand RleList inside covRle object. |
seq_info |
SeqInfo object, default |
weight |
integer, numeric or single length character. Default "score". Use score column in loaded in_files. |
format |
chatacter, default "qs", alternative "rds". File format to save R object. |
verbose |
logical, default TRUE, message about library output status. |
invisible(NULL), files saved to disc
Other lib_converters:
convertLibs(),
convert_bam_to_ofst(),
convert_to_bigWig(),
convert_to_covRle()
df <- ORFik.template.experiment()[10,] ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "cov_RLE_List") folder_to_save_merged <- file.path(tempdir(), "cov_RLE") ORFik:::convert_to_covRleList(df, out_dir = folder_to_save, out_dir_merged = folder_to_save_merged) fimport(file.path(folder_to_save, "RFP_Mutant_rep2.covqs"))df <- ORFik.template.experiment()[10,] ## Usually do default folder, here we use tmpdir folder_to_save <- file.path(tempdir(), "cov_RLE_List") folder_to_save_merged <- file.path(tempdir(), "cov_RLE") ORFik:::convert_to_covRleList(df, out_dir = folder_to_save, out_dir_merged = folder_to_save_merged) fimport(file.path(folder_to_save, "RFP_Mutant_rep2.covqs"))
Will split files by chromosome for faster loading for now. This feature might change in the future!
convert_to_fstWig( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "fstwig"), split.by.strand = TRUE, split.by.readlength = FALSE, seq_info = seqinfo(df), weight = "score", is_pre_collapsed = FALSE, verbose = TRUE )convert_to_fstWig( df, in_files = filepath(df, "pshifted"), out_dir = file.path(libFolder(df), "fstwig"), split.by.strand = TRUE, split.by.readlength = FALSE, seq_info = seqinfo(df), weight = "score", is_pre_collapsed = FALSE, verbose = TRUE )
df |
an ORFik |
in_files |
paths to input files, default pshifted files:
|
out_dir |
paths to output files, default
|
split.by.strand |
logical, default TRUE, split into forward and reverse strand RleList inside covRle object. |
split.by.readlength |
logical, default FALSE, split into files for each readlength, defined by readWidths(x) for each file. |
seq_info |
SeqInfo object, default |
weight |
integer, numeric or single length character. Default "score". Use score column in loaded in_files. |
is_pre_collapsed |
logical, default FALSE. Have you already collapsed reads with collapse.by.scores, so each positions is only in 1 GRanges object with a score column per readlength? Set to TRUE, only if you are sure, will give a speedup. |
verbose |
logical, default TRUE, message about library output status. |
invisible(NULL), files saved to disc
Export as either .ofst, .wig, .bigWig,.bedo (legacy format) or .bedoc (legacy format) files:
Export files as .ofst for fastest load speed into R.
Export files as .wig / bigWig for use in IGV or other genome browsers.
The input files are checked if they exist from: envExp(df).
convertLibs( df, out.dir = libFolder(df), addScoreColumn = TRUE, addSizeColumn = TRUE, must.overlap = NULL, method = "None", type = "ofst", input.type = "ofst", reassign.when.saving = FALSE, envir = envExp(df), force = TRUE, library.names = bamVarName(df), libs = outputLibs(df, type = input.type, chrStyle = must.overlap, library.names = library.names, output.mode = "list", force = force, BPPARAM = BPPARAM), BPPARAM = bpparam() )convertLibs( df, out.dir = libFolder(df), addScoreColumn = TRUE, addSizeColumn = TRUE, must.overlap = NULL, method = "None", type = "ofst", input.type = "ofst", reassign.when.saving = FALSE, envir = envExp(df), force = TRUE, library.names = bamVarName(df), libs = outputLibs(df, type = input.type, chrStyle = must.overlap, library.names = library.names, output.mode = "list", force = force, BPPARAM = BPPARAM), BPPARAM = bpparam() )
df |
an ORFik |
out.dir |
optional output directory, default: libFolder(df), if it is NULL, it will just reassign R objects to simplified libraries. Will then create a final folder specfied as: paste0(out.dir, "/", type, "/"). Here the files will be saved in format given by the type argument. |
addScoreColumn |
logical, default TRUE, if FALSE will not add replicate numbers as score column, see ORFik::convertToOneBasedRanges. |
addSizeColumn |
logical, default TRUE, if FALSE will not add size (width) as size column, see ORFik::convertToOneBasedRanges. Does not apply for (GAlignment version of.ofst) or .bedoc. Since they contain the original cigar. |
must.overlap |
default (NULL), else a GRanges / GRangesList object, so only reads that overlap (must.overlap) are kept. This is useful when you only need the reads over transcript annotation or subset etc. |
method |
character, default "None", the method to reduce ranges,
for more info see |
type |
character, output format, default "ofst". Alternatives: "ofst", "bigWig", "wig","bedo" or "bedoc". Which format you want. Will make a folder within out.dir with this name containing the files. |
input.type |
character, input type "ofst". Remember this function uses the loaded libraries if existing, so this argument is usually ignored. Only used if files do not already exist. |
reassign.when.saving |
logical, default FALSE. If TRUE, will reassign library to converted form after saving. Ignored when out.dir = NULL. |
envir |
environment to save to, default
|
force |
logical, default TRUE If TRUE, reload library files even if
matching named variables are found in environment used by experiment
(see |
library.names |
character vector, names of libraries, default: name_decider(df, naming) |
libs |
list, output of outputLibs as list of GRanges/GAlignments/GAlignmentPairs objects. Set input.type and force arguments to define parameters. |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
We advice you to not use this directly, as other function are more safe for library type conversions. See family description below. This is mostly used internally in ORFik. It is only adviced to use if large bam files are already loaded in R and conversions are wanted from those.
See export.ofst, export.wiggle,
export.bedo and export.bedoc
for information on file formats.
If libraries of the experiment are
already loaded into environment (default: .globalEnv) is will export
using those files as templates. If they are not in environment the
.ofst files from the bam files are loaded (unless you are converting
to .ofst then the .bam files are loaded).
invisible NULL (saves files to disc or R .GlobalEnv)
Other lib_converters:
convert_bam_to_ofst(),
convert_to_bigWig(),
convert_to_covRle(),
convert_to_covRleList()
df <- ORFik.template.experiment() #convertLibs(df, out.dir = NULL) # Keep only 5' ends of reads #convertLibs(df, out.dir = NULL, method = "5prime")df <- ORFik.template.experiment() #convertLibs(df, out.dir = NULL) # Keep only 5' ends of reads #convertLibs(df, out.dir = NULL, method = "5prime")
There are 5 ways of doing this
1. Take 5' ends, reduce away rest (5prime)
2. Take 3' ends, reduce away rest (3prime)
3. Tile to 1-mers and include all (tileAll)
4. Take middle point per GRanges (middle)
5. Get original with metacolumns (None)
You can also do multiple at a time, then output is GRangesList, where
each list group is the operation (5prime is [1], 3prime is [2] etc)
Many other ways to do this have their own functions, like startSites and
stopSites etc.
To retain information on original width, set addSizeColumn to TRUE.
To compress data, 1 GRanges object per unique read, set addScoreColumn to
TRUE. This will give you a score column with how many duplicated reads there
were in the specified region.
convertToOneBasedRanges( gr, method = "5prime", addScoreColumn = FALSE, addSizeColumn = FALSE, after.softclips = TRUE, along.reference = FALSE, reuse.score.column = TRUE )convertToOneBasedRanges( gr, method = "5prime", addScoreColumn = FALSE, addSizeColumn = FALSE, after.softclips = TRUE, along.reference = FALSE, reuse.score.column = TRUE )
gr |
GRanges, GAlignment or GAlignmentPairs object to reduce. |
method |
character, default |
addScoreColumn |
logical (FALSE), if TRUE, add a score column that sums up the hits per unique range. This will make each read unique, so that each read is 1 time, and score column gives the number of collapsed hits. A useful compression. If addSizeColumn is FALSE, it will not differentiate between reads with same start and stop, but different length. If addSizeColumn is FALSE, it will remove it. Collapses after conversion. |
addSizeColumn |
logical (FALSE), if TRUE, add a size column that for each read, that gives original width of read. Useful if you need original read lengths. This takes care of soft clips etc. If collapsing reads, each unique range will be grouped also by size. |
after.softclips |
logical (TRUE), include softclips in width. Does not apply if along.reference is TRUE. |
along.reference |
logical (FALSE), example: The cigar "26MI2" is by default width 28, but if along.reference is TRUE, it will be 26. The length of the read along the reference. Also "1D20M" will be 21 if by along.reference is TRUE. Intronic regions (cigar: N) will be removed. So: "1M200N19M" is 20, not 220. |
reuse.score.column |
logical (TRUE), if addScoreColumn is TRUE, and a score column exists, will sum up the scores to create a new score. If FALSE, will skip old score column and create new according to number of replicated reads after conversion. If addScoreColumn is FALSE, this argument is ignored. |
NOTE: Note: For cigar based ranges (GAlignments), the 5' end is the first non clipped base (neither soft clipped or hard clipped from 5'). This is following the default of bioconductor. For special case of GAlignmentPairs, 5prime will only use left (first) 5' end and read and 3prime will use only right (last) 3' end of read in pair. tileAll and middle can possibly find poinst that are not in the reads since: lets say pair is 1-5 and 10-15, middle is 7, which is not in the read.
Converted GRanges object
Other utils:
bedToGR(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
gr <- GRanges("chr1", 1:10,"+") # 5 prime ends convertToOneBasedRanges(gr) # is equal to convertToOneBasedRanges(gr, method = "5prime") # 3 prime ends convertToOneBasedRanges(gr, method = "3prime") # With lengths convertToOneBasedRanges(gr, addSizeColumn = TRUE) # With score (# of replicates) gr <- rep(gr, 2) convertToOneBasedRanges(gr, addSizeColumn = TRUE, addScoreColumn = TRUE)gr <- GRanges("chr1", 1:10,"+") # 5 prime ends convertToOneBasedRanges(gr) # is equal to convertToOneBasedRanges(gr, method = "5prime") # 3 prime ends convertToOneBasedRanges(gr, method = "3prime") # With lengths convertToOneBasedRanges(gr, addSizeColumn = TRUE) # With score (# of replicates) gr <- rep(gr, 2) convertToOneBasedRanges(gr, addSizeColumn = TRUE, addScoreColumn = TRUE)
Get correlation between columns
cor_plot( dt_cor, col = c(low = "blue", high = "red", mid = "white", na.value = "white"), limit = c(ifelse(min(dt_cor$Cor, na.rm = TRUE) < 0, -1, 0), 1), midpoint = mean(limit), label_name = "Pearson\nCorrelation", text_size = 4, legend.position = c(0.4, 0.7), legend.direction = "horizontal" )cor_plot( dt_cor, col = c(low = "blue", high = "red", mid = "white", na.value = "white"), limit = c(ifelse(min(dt_cor$Cor, na.rm = TRUE) < 0, -1, 0), 1), midpoint = mean(limit), label_name = "Pearson\nCorrelation", text_size = 4, legend.position = c(0.4, 0.7), legend.direction = "horizontal" )
dt_cor |
a data.table, with column Cor |
col |
colors c(low = "blue", high = "red", mid = "white", na.value = "white") |
limit |
default (-1, 1), defined by:
|
midpoint |
midpoint of correlation values in label coloring. |
label_name |
name of correlation method, default
|
text_size |
size of correlation numbers |
legend.position |
default c(0.4, 0.7), other: "top", "right",.. |
legend.direction |
default "horizontal", or "vertical" |
a ggplot (heatmap)
Get correlation between columns
cor_table( dt, method = c("pearson", "spearman")[1], upper_triangle = TRUE, decimals = 2, melt = TRUE, na.rm.melt = TRUE )cor_table( dt, method = c("pearson", "spearman")[1], upper_triangle = TRUE, decimals = 2, melt = TRUE, na.rm.melt = TRUE )
dt |
a data.table |
method |
c("pearson", "spearman")[1] |
upper_triangle |
logical, default TRUE. Make lower triangle values NA. |
decimals |
numeric, default 2. How many decimals for correlation |
melt |
logical, default TRUE. |
na.rm.melt |
logical, default TRUE. Remove NA values from melted table. |
a data.table with 3 columns, Var1, Var2 and Cor
Get correlation plot of raw counts and/or log2(count + 1) over
selected region in: c("mrna", "leaders", "cds", "trailers")
Note on correlation: Pearson correlation, using pairwise observations
to fill in NA values for the covariance matrix.
correlation.plots( df, output.dir, region = "mrna", type = "fpkm", height = 400, width = 400, size = 0.15, plot.ext = ".pdf", complex.correlation.plots = TRUE, data_for_pairs = countTable(df, region, type = type), as_gg_list = FALSE, text_size = 4, method = c("pearson", "spearman")[1] )correlation.plots( df, output.dir, region = "mrna", type = "fpkm", height = 400, width = 400, size = 0.15, plot.ext = ".pdf", complex.correlation.plots = TRUE, data_for_pairs = countTable(df, region, type = type), as_gg_list = FALSE, text_size = 4, method = c("pearson", "spearman")[1] )
df |
an ORFik |
output.dir |
directory to save to, named : cor_plot, cor_plot_log2 and/or cor_plot_simple with either .pdf or .png |
region |
a character (default: mrna), make raw count matrices of whole mrnas or one of (leaders, cds, trailers) |
type |
which value to use, "fpkm", alternative "counts". |
height |
numeric, default 400 (in mm) |
width |
numeric, default 400 (in mm) |
size |
numeric, size of dots, default 0.15. Deprecated. |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
complex.correlation.plots |
logical, default TRUE. Add in addition to simple correlation plot two computationally heavy dots + correlation plots. Useful for deeper analysis, but takes longer time to run, especially on low-quality gpu computers. Set to FALSE to skip these. |
data_for_pairs |
a data.table from ORFik::countTable of counts wanted. Default is fpkm of all mRNA counts over all libraries. |
as_gg_list |
logical, default FALSE. Return as a list of ggplot objects instead of as a grob. Gives you the ability to modify plots more directly. |
text_size |
size of correlation numbers |
method |
c("pearson", "spearman")[1] |
invisible(NULL) / if as_gg_list is TRUE, return a list of raw plots.
Similar to countOverlaps, but takes an optional weight column. This is usually the score column
countOverlapsW(query, subject, weight = NULL, ...)countOverlapsW(query, subject, weight = NULL, ...)
query |
IRanges, IRangesList, GRanges, GRangesList object. Usually transcript a transcript region. |
subject |
GRanges, GRangesList, GAlignment or covRle, usually reads. |
weight |
(default: NULL), if defined either numeric or character name of valid meta column in subject. If weight is single numeric, it is used for all. A normall weight is the score column given as weight = "score". GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Ignored if subject is covRle. |
... |
additional arguments passed to countOverlaps/findOverlaps |
a named vector of number of overlaps to subject weigthed by 'weight' column.
Other features:
computeFeatures(),
computeFeaturesCage(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
gr1 <- GRanges(seqnames="chr1", ranges=IRanges(start = c(4, 9, 10, 30), end = c(4, 15, 20, 31)), strand="+") gr2 <- GRanges(seqnames="chr1", ranges=IRanges(start = c(1, 4, 15, 25), end = c(2, 4, 20, 26)), strand=c("+"), score=c(10, 20, 15, 5)) countOverlaps(gr1, gr2) countOverlapsW(gr1, gr2, weight = "score")gr1 <- GRanges(seqnames="chr1", ranges=IRanges(start = c(4, 9, 10, 30), end = c(4, 15, 20, 31)), strand="+") gr2 <- GRanges(seqnames="chr1", ranges=IRanges(start = c(1, 4, 15, 25), end = c(2, 4, 20, 26)), strand=c("+"), score=c(10, 20, 15, 5)) countOverlaps(gr1, gr2) countOverlapsW(gr1, gr2, weight = "score")
Used to quickly load pre-created read count tables to R.
If df is experiment:
Extracts by getting /QC_STATS directory, and searching for region
Requires ORFikQC to have been run on experiment,
to get default count tables!
countTable( df, region = "mrna", type = "count", collapse = FALSE, count.folder = "default", full_path = countTablePath(df, region, count.folder) )countTable( df, region = "mrna", type = "count", collapse = FALSE, count.folder = "default", full_path = countTablePath(df, region, count.folder) )
df |
an ORFik |
region |
a character vector (default: "mrna"), make raw count matrices of whole mrnas or one of (leaders, cds, trailers). |
type |
character, default: "count" (raw counts matrix). Which object type and normalization do you want ? "summarized" (SummarizedExperiment object), "deseq" (Deseq2 experiment, design will be all valid non-unique columns except replicates, change by using DESeq2::design, normalization alternatives are: "fpkm", "log2fpkm" or "log10fpkm". |
collapse |
a logical/character (default FALSE), if TRUE all samples within the group SAMPLE will be collapsed to one. If "all", all groups will be merged into 1 column called merged_all. Collapse is defined as rowSum(elements_per_group) / ncol(elements_per_group) |
count.folder |
character, default "auto" (Use count tables from
original bam files stored in "QC_STATS", these are like HTseq count tables).
To load your custome count tables from pshifted reads, set to "pshifted"
(remember to create the pshifted tables first!). If you
have custom ranges, like reads over uORFs stored in a folder called
"/uORFs" relative to the bam files, set to "uORFs". Always create these
custom count tables with |
full_path |
Full path to countTable, default: countTablePath(df, region, count.folder) |
If df is path to folder: Loads the the file in that directory with the regex region.rds, where region is what is defined by argument, if multiple exist, see if any start with "countTable_", if so, subset. If loaded as SummarizedExperiment or deseq, the colData will be made from ORFik.experiment information.
a data.table/SummarizedExperiment/DESeq object of columns as counts / normalized counts per library, column name is name of library. Rownames must be unique for now. Might change.
Other countTable:
countTable_regions()
# Make experiment df <- ORFik.template.experiment() # Make QC report to get counts ++ (not needed for this template) # ORFikQC(df) # Get count Table of mrnas # countTable(df, "mrna") # Get count Table of cds # countTable(df, "cds") # Get count Table of mrnas as fpkm values # countTable(df, "mrna", type = "count") # Get count Table of mrnas with collapsed replicates # countTable(df, "mrna", collapse = TRUE) # Get count Table of mrnas as summarizedExperiment # countTable(df, "mrna", type = "summarized") # Get count Table of mrnas as DESeq2 object, # for differential expression analysis # countTable(df, "mrna", type = "deseq")# Make experiment df <- ORFik.template.experiment() # Make QC report to get counts ++ (not needed for this template) # ORFikQC(df) # Get count Table of mrnas # countTable(df, "mrna") # Get count Table of cds # countTable(df, "cds") # Get count Table of mrnas as fpkm values # countTable(df, "mrna", type = "count") # Get count Table of mrnas with collapsed replicates # countTable(df, "mrna", collapse = TRUE) # Get count Table of mrnas as summarizedExperiment # countTable(df, "mrna", type = "summarized") # Get count Table of mrnas as DESeq2 object, # for differential expression analysis # countTable(df, "mrna", type = "deseq")
By default will make count tables over mRNA, leaders, cds and trailers for all libraries in experiment. Saved as "qs" or "rds" format files.
countTable_regions( df, out.dir = libFolder(df), longestPerGene = FALSE, geneOrTxNames = "tx", regions = c("mrna", "leaders", "cds", "trailers"), type = "count", lib.type = "ofst", weight = "score", rel.dir = "QC_STATS", forceRemake = FALSE, library.names = bamVarName(df), format = "qs", path_prefix = if (!is.null(out.dir)) { pasteDir(file.path(out.dir, rel.dir, "countTable_")) } else { NULL }, libraries = outputLibs(df, chrStyle = seqinfo(df), paths = filepath(df, lib.type), type = lib.type, force = FALSE, library.names = library.names, BPPARAM = BiocParallel::SerialParam()), BPPARAM = bpparam() )countTable_regions( df, out.dir = libFolder(df), longestPerGene = FALSE, geneOrTxNames = "tx", regions = c("mrna", "leaders", "cds", "trailers"), type = "count", lib.type = "ofst", weight = "score", rel.dir = "QC_STATS", forceRemake = FALSE, library.names = bamVarName(df), format = "qs", path_prefix = if (!is.null(out.dir)) { pasteDir(file.path(out.dir, rel.dir, "countTable_")) } else { NULL }, libraries = outputLibs(df, chrStyle = seqinfo(df), paths = filepath(df, lib.type), type = lib.type, force = FALSE, library.names = library.names, BPPARAM = BiocParallel::SerialParam()), BPPARAM = bpparam() )
df |
an ORFik |
out.dir |
character, output directory, default:
|
longestPerGene |
a logical (default FALSE), if FALSE all transcript isoforms per gene. Ignored if "region" is not a character of either: "mRNA","tx", "cds", "leaders" or "trailers". |
geneOrTxNames |
a character vector (default "tx"), should row names keep trancript names ("tx") or change to gene names ("gene") |
regions |
a character vector, default: c("mrna", "leaders", "cds", "trailers"), make raw count matrices of whole regions specified. Can also be a custom GRangesList of for example uORFs or a subset of cds etc. |
type |
default: "count" (raw counts matrix), alternative is "fpkm", "log2fpkm" or "log10fpkm" |
lib.type |
a character(default: "default"), load files in experiment or some precomputed variant, either "ofst", "pshifted" or "cov" These are made with ORFik:::convertLibs() or shiftFootprintsByExperiment(). Can also be custom user made folders inside the experiments bam folder. Format "cov" (i.e. covRle format) is by far the fastest to use if existing. |
weight |
numeric or character, a column to score overlaps by. Default "score", will check for a metacolumn called "score" in libraries. If not found, will not use weights. |
rel.dir |
relative output directory for out.dir, default: "QC_STATS". For pshifted, write "pshifted". |
forceRemake |
logical, default FALSE. If TRUE, will not look for existing file count table files. |
library.names |
character, default: bamVarName(df). Names to load libraries as to environment and names to display in plots. |
format |
character, default "qs", alternative: "rds". Which format to save summarizedExperiment. |
path_prefix |
the prefix names of tables, default: |
libraries |
The call to output libraries, the input is not used! Default:
|
BPPARAM |
how many cores/threads to use? default: bpparam() |
a list of data.table, 1 data.table per region. The regions will be the names the list elements.
Other countTable:
countTable()
##Make experiment df <- ORFik.template.experiment() ## Create count tables for all default regions countTable_regions(df, NULL) ## Pshifted reads (first create pshiftead libs) # countTable_regions(df, lib.type = "pshifted", rel.dir = "pshifted")##Make experiment df <- ORFik.template.experiment() ## Create count tables for all default regions countTable_regions(df, NULL) ## Pshifted reads (first create pshiftead libs) # countTable_regions(df, lib.type = "pshifted", rel.dir = "pshifted")
Convert coverage RleList to data.table
coverage_to_dt( coverage, keep.names = TRUE, withFrames = FALSE, weight = "score", drop.zero.dt = FALSE, fraction = NULL )coverage_to_dt( coverage, keep.names = TRUE, withFrames = FALSE, weight = "score", drop.zero.dt = FALSE, fraction = NULL )
coverage |
RleList with names |
keep.names |
logical (TRUE), keep names or not. If as.data.table is TRUE, names (genes column) will be a factor column, if FALSE it will be an integer column (index of gene), so first input grl element is 1. Dropping names gives ~ 20 % speedup. If drop.zero.dt is FALSE, data.table will not return names, will use index (to avoid memory explosion). |
withFrames |
a logical (FALSE), only available if as.data.table is TRUE, return the ORF frame, 1,2,3, where position 1 is 1, 2 is 2 and 4 is 1 etc. |
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
drop.zero.dt |
logical FALSE, if TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 positions are used in some sense. (mean, median, zscore coverage will only scale differently) |
fraction |
integer or character, a description column. Useful for grouping multiple outputs together. If returned as Rle, this is added as: metadata(coverage) <- list(fraction = fraction). If as.data.table it will be added as an additional column. |
a data.table with column names c("count" [numeric or integer], "genes" [integer], "position" [integer])
Extends the function with direct genome coverage input,
see coverageByTranscript for original function.
coverageByTranscriptC(x, transcripts, ignore.strand = !strandMode(x))coverageByTranscriptC(x, transcripts, ignore.strand = !strandMode(x))
x |
a covRle (one RleList for each strand in object), must have defined and correct seqlengths in its SeqInfo object. |
transcripts |
|
ignore.strand |
a logical (default: length(x) == 1) |
Integer Rle of coverage, 1 per transcript
Get coverage from fst large coverage format
coverageByTranscriptFST(grl, fst_index, columns = NULL)coverageByTranscriptFST(grl, fst_index, columns = NULL)
grl |
a GRangesList |
fst_index |
a path to an existing fst index file |
columns |
NULL or character, default NULL. Else must be a subset of names in the fst files. Run ids etc. |
a list, each element is a data.table of coverage
library(data.table) library(ORFik) grl <- GRangesList("1:1-5:+") tempdir <- tempdir() fst_index <- file.path(tempdir, "coverage_index.fst") mock_run_names <- c("SRR1010101", "SRR1010102", "SRR1010103") coverage_file <- file.path(tempdir, paste0("coverage_1_part1_", c("forward", "reverse"), ".fst")) mock_coverage <- setnames(setDT(lapply(mock_run_names, function(x) { sample(seq(0, 100), 100, replace = TRUE, prob = c(0.95, rep(0.01, 100)))})), mock_run_names) mock_index <- data.table(chr = "1", start = 1, end = nrow(mock_coverage), file_forward = coverage_file[1], file_reverse = coverage_file[2]) fst::write_fst(mock_index, fst_index) fst::write_fst(mock_coverage, coverage_file[1]) coverageByTranscriptFST(grl, fst_index) coverageByTranscriptFST(grl, fst_index, c("SRR1010101", "SRR1010102"))library(data.table) library(ORFik) grl <- GRangesList("1:1-5:+") tempdir <- tempdir() fst_index <- file.path(tempdir, "coverage_index.fst") mock_run_names <- c("SRR1010101", "SRR1010102", "SRR1010103") coverage_file <- file.path(tempdir, paste0("coverage_1_part1_", c("forward", "reverse"), ".fst")) mock_coverage <- setnames(setDT(lapply(mock_run_names, function(x) { sample(seq(0, 100), 100, replace = TRUE, prob = c(0.95, rep(0.01, 100)))})), mock_run_names) mock_index <- data.table(chr = "1", start = 1, end = nrow(mock_coverage), file_forward = coverage_file[1], file_reverse = coverage_file[2]) fst::write_fst(mock_index, fst_index) fst::write_fst(mock_coverage, coverage_file[1]) coverageByTranscriptFST(grl, fst_index) coverageByTranscriptFST(grl, fst_index, c("SRR1010101", "SRR1010102"))
Extends the function with weights,
see coverageByTranscript for original function.
coverageByTranscriptW( x, transcripts, ignore.strand = FALSE, weight = 1L, seqinfo.x.is.correct = FALSE )coverageByTranscriptW( x, transcripts, ignore.strand = FALSE, weight = 1L, seqinfo.x.is.correct = FALSE )
x |
reads ( |
transcripts |
|
ignore.strand |
a logical (default: FALSE) |
weight |
a vector (default: 1L), if single number applies for all, else it must be the string name of a defined meta column in "x", that gives number of times a read was found. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment was found 5 times. |
seqinfo.x.is.correct |
logical, default FALSE. If you know x, has correct seqinfo, then you can save some computation time by setting this to TRUE. |
Integer Rle of coverage, 1 per transcript
Creates a ggplot representing a heatmap of coverage:
Rows : Position in region
Columns : Read length
Index intensity : (color) coverage scoring per index.
Coverage rows in heat map is fraction, usually fractions is divided into unique read lengths (standard Illumina is 76 unique widths, with some minimum cutoff like 15.) Coverage column in heat map is score, default zscore of counts. These are the relative positions you are plotting to. Like +/- relative to TIS or TSS.
coverageHeatMap( coverage, output = NULL, scoring = "zscore", legendPos = "right", addFracPlot = FALSE, xlab = "Position relative to start site", ylab = "Protected fragment length", colors = "default", title = NULL, increments.y = "auto", gradient.max = max(coverage$score) )coverageHeatMap( coverage, output = NULL, scoring = "zscore", legendPos = "right", addFracPlot = FALSE, xlab = "Position relative to start site", ylab = "Protected fragment length", colors = "default", title = NULL, increments.y = "auto", gradient.max = max(coverage$score) )
coverage |
a data.table, e.g. output of scaledWindowCoverage |
output |
character string (NULL), if set, saves the plot as pdf or png to path given. If no format is given, is save as pdf. |
scoring |
character vector, default "zscore", Which scoring did you use to create? either of zscore, transcriptNormalized, sum, mean, median, .. see ?coverageScorings for info and more alternatives. |
legendPos |
a character, Default "right". Where should the fill legend be ? ("top", "bottom", "right", "left") |
addFracPlot |
Add margin histogram plot on top of heatmap with fractions per positions |
xlab |
the x-axis label, default "Position relative to start site" |
ylab |
the y-axis label, default "Protected fragment length" |
colors |
character vector, default: "default", this gives you: c("white", "yellow2", "yellow3", "lightblue", "blue", "navy"), do "high" for more high contrasts, or specify your own colors. |
title |
a character, default NULL (no title), what is the top title of plot? |
increments.y |
increments of y axis, default "auto". Or a numeric value < max position & > min position. |
gradient.max |
numeric, defualt: max(coverage$score). What data value should the top color be ? Good to use if you want to compare 2 samples, with the same color intensity, in that case set this value to the max score of the 2 coverage tables. |
Colors:
Remember if you want to change anything like colors, just return the
ggplot object, and reassign like: obj + scale_color_brewer() etc.
Standard colors are:
0 reads in whole readlength : gray
few reads in position : white
medium reads in position : yellow
many reads in position : dark blue
a ggplot object of the coverage plot, NULL if output is set, then the plot will only be saved to location.
Other heatmaps:
heatMapL(),
heatMapRegion(),
heatMap_single()
Other coveragePlot:
pSitePlot(),
savePlot(),
windowCoveragePlot()
# An ORF grl <- GRangesList(tx1 = GRanges("1", IRanges(1, 6), "+")) # Ribo-seq reads range <- IRanges(c(rep(1, 3), 2, 3, rep(4, 2), 5, 6), width = 1 ) reads <- GRanges("1", range, "+") reads$size <- c(rep(28, 5), rep(29, 4)) # read size coverage <- windowPerReadLength(grl, reads = reads, upstream = 0, downstream = 5) coverageHeatMap(coverage) # With top sum bar coverageHeatMap(coverage, addFracPlot = TRUE) # See vignette for more examples# An ORF grl <- GRangesList(tx1 = GRanges("1", IRanges(1, 6), "+")) # Ribo-seq reads range <- IRanges(c(rep(1, 3), 2, 3, rep(4, 2), 5, 6), width = 1 ) reads <- GRanges("1", range, "+") reads$size <- c(rep(28, 5), rep(29, 4)) # read size coverage <- windowPerReadLength(grl, reads = reads, upstream = 0, downstream = 5) coverageHeatMap(coverage) # With top sum bar coverageHeatMap(coverage, addFracPlot = TRUE) # See vignette for more examples
It tiles each GRangesList group to width 1, and finds hits per position.
A range from 1:5 will split into c(1,2,3,4,5) and count hits on each.
This is a safer speedup of coverageByTranscript from GenomicFeatures.
It also gives the possibility to return as data.table, for faster
computations.
coveragePerTiling( grl, reads, is.sorted = FALSE, keep.names = TRUE, as.data.table = FALSE, withFrames = FALSE, weight = "score", drop.zero.dt = FALSE, fraction = NULL )coveragePerTiling( grl, reads, is.sorted = FALSE, keep.names = TRUE, as.data.table = FALSE, withFrames = FALSE, weight = "score", drop.zero.dt = FALSE, fraction = NULL )
grl |
a |
reads |
a |
is.sorted |
logical (FALSE), is grl sorted. That is + strand groups in increasing ranges (1,2,3), and - strand groups in decreasing ranges (3,2,1) |
keep.names |
logical (TRUE), keep names or not. If as.data.table is TRUE, names (genes column) will be a factor column, if FALSE it will be an integer column (index of gene), so first input grl element is 1. Dropping names gives ~ 20 % speedup. If drop.zero.dt is FALSE, data.table will not return names, will use index (to avoid memory explosion). |
as.data.table |
a logical (FALSE), return as data.table with 2 columns, position and count. |
withFrames |
a logical (FALSE), only available if as.data.table is TRUE, return the ORF frame, 1,2,3, where position 1 is 1, 2 is 2 and 4 is 1 etc. |
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
drop.zero.dt |
logical FALSE, if TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 positions are used in some sense. (mean, median, zscore coverage will only scale differently) |
fraction |
integer or character, a description column. Useful for grouping multiple outputs together. If returned as Rle, this is added as: metadata(coverage) <- list(fraction = fraction). If as.data.table it will be added as an additional column. |
NOTE: If reads contains a $score column, it will presume that this is the number of replicates per reads, weights for the coverage() function. So delete the score column or set weight to something else if this is not wanted.
a numeric RleList, one numeric-Rle per group with # of hits per position. Or data.table if as.data.table is TRUE, with column names c("count" [numeric or integer], "genes" [integer], "position" [integer])
Other ExtendGenomicRanges:
asTX(),
extendLeaders(),
extendTrailers(),
reduceKeepAttr(),
tile1(),
txSeqsFromFa(),
windowPerGroup()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+", seqlengths = c("1" = 25)) coveragePerTiling(grl, RFP, is.sorted = TRUE) # now as data.table with frames coveragePerTiling(grl, RFP, is.sorted = TRUE, as.data.table = TRUE, withFrames = TRUE) # With score column (usually replicated reads on that position) RFP <- GRanges("1", IRanges(25, 25), "+", score = 5) dt <- coveragePerTiling(grl, RFP, is.sorted = TRUE, as.data.table = TRUE, withFrames = TRUE) class(dt$count) # numeric # With integer score column (faster and less space usage) RFP <- GRanges("1", IRanges(25, 25), "+", score = 5L, seqlengths = c("1" = 50)) # We need to know size of the chromosome here dt <- coveragePerTiling(grl, RFP, is.sorted = TRUE, as.data.table = TRUE, withFrames = TRUE) class(dt$count) # integer # Much faster coverage format for genomes (ORFik often stores these on disc # with .qs format) cov <- covRleFromGR(RFP) dt <- coveragePerTiling(grl, cov, is.sorted = TRUE)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+", seqlengths = c("1" = 25)) coveragePerTiling(grl, RFP, is.sorted = TRUE) # now as data.table with frames coveragePerTiling(grl, RFP, is.sorted = TRUE, as.data.table = TRUE, withFrames = TRUE) # With score column (usually replicated reads on that position) RFP <- GRanges("1", IRanges(25, 25), "+", score = 5) dt <- coveragePerTiling(grl, RFP, is.sorted = TRUE, as.data.table = TRUE, withFrames = TRUE) class(dt$count) # numeric # With integer score column (faster and less space usage) RFP <- GRanges("1", IRanges(25, 25), "+", score = 5L, seqlengths = c("1" = 50)) # We need to know size of the chromosome here dt <- coveragePerTiling(grl, RFP, is.sorted = TRUE, as.data.table = TRUE, withFrames = TRUE) class(dt$count) # integer # Much faster coverage format for genomes (ORFik often stores these on disc # with .qs format) cov <- covRleFromGR(RFP) dt <- coveragePerTiling(grl, cov, is.sorted = TRUE)
Different scorings and groupings of a coverage representation.
coverageScorings(coverage, scoring = "zscore", copy.dt = TRUE)coverageScorings(coverage, scoring = "zscore", copy.dt = TRUE)
coverage |
a data.table containing at least columns (count, position), it is possible to have additionals: (genes, fraction, feature) |
scoring |
a character, one of (zscore, transcriptNormalized, mean, median, sum, log2sum, log10sum, sumLength, meanPos and frameSum, periodic, NULL). More info in details |
copy.dt |
logical TRUE, copy object, to avoid overwriting original object. Set to false to run function using reference to object, a speed up if original object is not needed. |
Usually output of metaWindow or scaledWindowPositions is input in this function.
Content of coverage data.table: It must contain the count and position columns.
genes column: If you have multiple windows, the genes column must define which gene/transcript grouping the different counts belong to. If there is only a meta window or only 1 gene/transcript, then this column is not needed.
fraction column: If you have coverage of i.e RNA-seq and Ribo-seq, or TCP -seq of large and small subunite, divide into fractions. Like factor(RNA, RFP)
feature column: If gene group is subdivided into parts, like gene is transcripts, and feature column can be c(leader, cds, trailer) etc.
Given a data.table coverage of counts, add a scoring scheme.
per: the grouping given, if genes is defined,
group by per gene in default scoring.
Scorings:
zscore (count-mean(window))/sd(window) per) # Outlier detection
modzscore (count-median(window))/mad(window) per) # Outlier detection for signal with extreme values
transcriptNormalized (sum(count / sum of counts per)) this is scaled per group
mean (mean(count per))
median (median(count per))
sum (count per)
log2sum (count per)
log10sum (count per)
sumLength (count per) / number of windows
meanPos (mean per position per gene) used in scaledWindowPositions
sumPos (sum per position per gene) used in scaledWindowPositions
frameSum (sum per frame per gene) used in ORFScore
frameSumPerL (sum per frame per read length)
frameSumPerLG (sum per frame per read length per gene)
fracPos (fraction of counts per position per gene) non scaled version of transcriptNormalized
periodic (Fourier transform periodicity of meta coverage per fraction)
NULL (no grouping, return input directly)
a data.table with new scores (size dependent on score used)
Other coverage:
metaWindow(),
regionPerReadLength(),
scaledWindowPositions(),
windowPerReadLength()
dt <- data.table::data.table(count = c(4, 1, 1, 4, 2, 3), position = c(1, 2, 3, 4, 5, 6)) coverageScorings(dt, scoring = "zscore") # with grouping gene dt$genes <- c(rep("tx1", 3), rep("tx2", 3)) coverageScorings(dt, scoring = "zscore")dt <- data.table::data.table(count = c(4, 1, 1, 4, 2, 3), position = c(1, 2, 3, 4, 5, 6)) coverageScorings(dt, scoring = "zscore") # with grouping gene dt$genes <- c(rep("tx1", 3), rep("tx2", 3)) coverageScorings(dt, scoring = "zscore")
Coverage Rlelist for both strands
covRle(forward = RleList(), reverse = RleList())covRle(forward = RleList(), reverse = RleList())
forward |
a RleList with defined seqinfo for forward strand counts |
reverse |
a RleList with defined seqinfo for reverse strand counts |
a covRle object
Other covRLE:
covRle-class,
covRleFromGR(),
covRleList,
covRleList-class
covRle() covRle(RleList(), RleList()) chr_rle <- RleList(chr1 = Rle(c(1,2,3), c(1,2,3))) covRle(chr_rle, chr_rle)covRle() covRle(RleList(), RleList()) chr_rle <- RleList(chr1 = Rle(c(1,2,3), c(1,2,3))) covRle(chr_rle, chr_rle)
Given a run of coverage(x) where x are reads, this class combines the 2 strands into 1 object
a covRLE object
Other covRLE:
covRle,
covRleFromGR(),
covRleList,
covRleList-class
Convert GRanges to covRle
covRleFromGR(x, weight = "AUTO", ignore.strand = FALSE)covRleFromGR(x, weight = "AUTO", ignore.strand = FALSE)
x |
a GRanges, GAlignment or GAlignmentPairs object. Note that coverage calculation for GAlignment is slower, so usually best to call convertToOneBasedRanges on GAlignment object to speed it up. |
weight |
default "AUTO", pick 'score' column if exist, else all are 1L. Can also be a manually assigned meta column like 'score2' etc. |
ignore.strand |
logical, default FALSE. |
covRle object
Other covRLE:
covRle,
covRle-class,
covRleList,
covRleList-class
seqlengths <- as.integer(c(200, 300)) names(seqlengths) <- c("chr1", "chr2") gr <- GRanges(seqnames = c("chr1", "chr1", "chr2", "chr2"), ranges = IRanges(start = c(10, 50, 100, 150), end = c(40, 80, 129, 179)), strand = c("+", "+", "-", "-"), seqlengths = seqlengths) cov_both_strands <- covRleFromGR(gr) cov_both_strands cov_ignore_strand <- covRleFromGR(gr, ignore.strand = TRUE) cov_ignore_strand strandMode(cov_both_strands) strandMode(cov_ignore_strand)seqlengths <- as.integer(c(200, 300)) names(seqlengths) <- c("chr1", "chr2") gr <- GRanges(seqnames = c("chr1", "chr1", "chr2", "chr2"), ranges = IRanges(start = c(10, 50, 100, 150), end = c(40, 80, 129, 179)), strand = c("+", "+", "-", "-"), seqlengths = seqlengths) cov_both_strands <- covRleFromGR(gr) cov_both_strands cov_ignore_strand <- covRleFromGR(gr, ignore.strand = TRUE) cov_ignore_strand strandMode(cov_both_strands) strandMode(cov_ignore_strand)
Coverage Rlelist for both strands
covRleList(list, fraction = names(list))covRleList(list, fraction = names(list))
list |
a list or List of covRle objects of equal length and lengths |
fraction |
character, default |
a covRleList object
Other covRLE:
covRle,
covRle-class,
covRleFromGR(),
covRleList-class
covRleList(List(covRle()))covRleList(List(covRle()))
Given a run of coverage(x) where x are reads, this covRle combines the 2 strands into 1 object This list can again combine these into 1 object, with accession functions and generalizations.
a covRleList object
Other covRLE:
covRle,
covRle-class,
covRleFromGR(),
covRleList
experiment
Create a single R object that stores and controls all results relevant to
a specific Next generation sequencing experiment.
Click the experiment link above in the title if you are not sure what an
ORFik experiment is.
By using files in a folder / folders. It will make an experiment table
with information per sample, this object allows you to use the extensive API in
ORFik that works on experiments.
Information Auto-detection:
There will be several columns you can fill in, when creating the object,
if the files have logical names like (RNA-seq_WT_rep1.bam) it will try to auto-detect
the most likely values for the columns. Like if it is RNA-seq or Ribo-seq,
Wild type or mutant, is this replicate 1 or 2 etc.
You will have to fill in the details that were not auto detected.
Easiest way to fill in the blanks are in a csv editor like libre Office
or excel. You can also remake the experiment and specify the
specific column manually.
Remember that each row (sample) must have a unique combination
of values.
An extra column called "reverse" is made if there are paired data,
like +/- strand wig files.
create.experiment( dir, exper, saveDir = ORFik::config()["exp"], txdb = "", fa = "", organism = "", assembly = "", pairedEndBam = FALSE, viewTemplate = FALSE, types = c("bam", "bed", "wig", "bigWig", "ofst"), libtype = "auto", stage = "auto", rep = "auto", condition = "auto", fraction = "auto", author = "", files = findLibrariesInFolder(dir, types, pairedEndBam), result_folder = NULL, runIDs = extract_run_id(files) )create.experiment( dir, exper, saveDir = ORFik::config()["exp"], txdb = "", fa = "", organism = "", assembly = "", pairedEndBam = FALSE, viewTemplate = FALSE, types = c("bam", "bed", "wig", "bigWig", "ofst"), libtype = "auto", stage = "auto", rep = "auto", condition = "auto", fraction = "auto", author = "", files = findLibrariesInFolder(dir, types, pairedEndBam), result_folder = NULL, runIDs = extract_run_id(files) )
dir |
Which directory / directories to create experiment from, must be a directory with NGS data from your experiment. Will include all files of file type specified by "types" argument. So do not mix files from other experiments in the same folder! |
exper |
Short name of experiment. Will be name used to load
experiment, and name shown when running |
saveDir |
Directory to save experiment csv file, default:
|
txdb |
A path to TxDb (prefered) or gff/gtf (not adviced, slower) file with transcriptome annotation for the organism. |
fa |
A path to fasta genome/sequences used for libraries, remember the file must have a fasta index too. |
organism |
character, default: "" (no organism set), scientific name of organism. Homo sapiens, Danio rerio, Rattus norvegicus etc. If you have a SRA metadata csv file, you can set this argument to study$ScientificName[1], where study is the SRA metadata for all files that was aligned. |
assembly |
character, default: "" (no assembly set). The genome assembly name, like GRCh38 etc. Useful to add if you want detailed metadata of experiment analysis. |
pairedEndBam |
logical FALSE, else TRUE, or a logical list of TRUE/FALSE per library you see will be included (run first without and check what order the files will come in) 1 paired end file, then two single will be c(T, F, F). If you have a SRA metadata csv file, you can set this argument to study$LibraryLayout == "PAIRED", where study is the SRA metadata for all files that was aligned. |
viewTemplate |
run View() on template when finished, default (FALSE). Usually gives you a better view of result than using print(). |
types |
Default |
libtype |
character, default "auto". Library types, must be length 1 or equal length of number of libraries. "auto" means ORFik will try to guess from file names. Example: RFP (Ribo-seq), RNA (RNA-seq), CAGE, SSU (TCP-seq 40S), LSU (TCP-seq 80S). |
stage |
character, default "auto". Developmental stage, tissue or cell line, must be length 1 or equal length of number of libraries. "auto" means ORFik will try to guess from file names. Example: HEK293 (Cell line), Sphere (zebrafish stage), ovary (Tissue). |
rep |
character, default "auto". Replicate numbering, must be length 1 or equal length of number of libraries. "auto" means ORFik will try to guess from file names. Example: 1 (rep 1), 2 rep(2). Insert only numbers here! |
condition |
character, default "auto". Library conditions, must be length 1 or equal length of number of libraries. "auto" means ORFik will try to guess from file names. Example: WT (wild type), mutant, etc. |
fraction |
character, default "auto". Fractionation of library, must be length 1 or equal length of number of libraries. "auto" means ORFik will try to guess from file names. This columns is used to make experiment unique, if the other columns are not sufficient. Example: cyto (cytosolic fraction), dmso (dmso treated fraction), etc. |
author |
character, default "". Main author of experiment, usually last name is enough. When printing will state "author et al" in info. |
files |
character vector or data.table of library paths in dir.
Default: |
result_folder |
character, default NULL. The folder to output analysis results like QC, count tables etc. By default the libFolder(df) folder is used, the folder of first library in experiment. If you are making a new experiment which is a collection of other experiments, set this to a new folder, to not contaminate your other experiment directories. |
runIDs |
character ids, usually SRR, ERR, or DRR identifiers, default is to search for any of these 3 in the filename by:
|
a data.frame, NOTE: this is not a ORFik experiment, only a template for it!
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
# 1. Pick directory dir <- system.file("extdata/Homo_sapiens_sample", "", package = "ORFik") # 2. Pick an experiment name exper <- "ORFik" # 3. Pick .gff/.gtf location txdb <- system.file("extdata/references/homo_sapiens", "Homo_sapiens_dummy.gtf.db", package = "ORFik") # 4. Pick fasta genome of organism fa <- system.file("extdata/references/homo_sapiens", "Homo_sapiens_dummy.fasta", package = "ORFik") # 5. Set organism (optional) org <- "Homo sapiens" # Create temple not saved on disc yet: template <- create.experiment(dir = dir, exper, txdb = txdb, saveDir = NULL, fa = fa, organism = org, viewTemplate = FALSE) ## Now fix non-unique rows: either is libre office, microsoft excel, or in R template$X5[6] <- "heart" # here a dummy example, even though data is correct # read experiment (if you set correctly) df <- read.experiment(template) ## Default location of experiments is ORFik::config()["exp"] # default_experiments_path <- ORFik::config()["exp"] # exp_path <- file.path(default_experiments_path, paste0("exper", ".csv")) # Save with: save.experiment(df, file = exp_path) # Then you can simply load with read.experiment(exper), # since you saved in the default directory ## Custom location (If you work in a team, use a shared folder) # Remember to update ORFik::config() to ripple the effect through whole # of ORFik if you want to use this as default new_dir <- tempdir() # Here we just use tempdir create.experiment(dir = dir, exper, txdb = txdb, saveDir = new_dir, fa = fa, organism = org) template_loaded <- read.experiment(exper, new_dir) # The csv template paths (from index 5) is equal to file paths of loaded exp identical(template$X6[-seq(4)], filepath(template_loaded, "default"))# 1. Pick directory dir <- system.file("extdata/Homo_sapiens_sample", "", package = "ORFik") # 2. Pick an experiment name exper <- "ORFik" # 3. Pick .gff/.gtf location txdb <- system.file("extdata/references/homo_sapiens", "Homo_sapiens_dummy.gtf.db", package = "ORFik") # 4. Pick fasta genome of organism fa <- system.file("extdata/references/homo_sapiens", "Homo_sapiens_dummy.fasta", package = "ORFik") # 5. Set organism (optional) org <- "Homo sapiens" # Create temple not saved on disc yet: template <- create.experiment(dir = dir, exper, txdb = txdb, saveDir = NULL, fa = fa, organism = org, viewTemplate = FALSE) ## Now fix non-unique rows: either is libre office, microsoft excel, or in R template$X5[6] <- "heart" # here a dummy example, even though data is correct # read experiment (if you set correctly) df <- read.experiment(template) ## Default location of experiments is ORFik::config()["exp"] # default_experiments_path <- ORFik::config()["exp"] # exp_path <- file.path(default_experiments_path, paste0("exper", ".csv")) # Save with: save.experiment(df, file = exp_path) # Then you can simply load with read.experiment(exper), # since you saved in the default directory ## Custom location (If you work in a team, use a shared folder) # Remember to update ORFik::config() to ripple the effect through whole # of ORFik if you want to use this as default new_dir <- tempdir() # Here we just use tempdir create.experiment(dir = dir, exper, txdb = txdb, saveDir = new_dir, fa = fa, organism = org) template_loaded <- read.experiment(exper, new_dir) # The csv template paths (from index 5) is equal to file paths of loaded exp identical(template$X6[-seq(4)], filepath(template_loaded, "default"))
Creates GRanges object as a trailer for ORFranges representing ORF, maintaining restrictions of transcriptRanges. Assumes that ORFranges is on the transcriptRanges, strands and seqlevels are in agreement. When lengthOFtrailer is smaller than space left on the transcript than all available space is returned as trailer.
defineTrailer(ORFranges, transcriptRanges, lengthOftrailer = 200)defineTrailer(ORFranges, transcriptRanges, lengthOftrailer = 200)
ORFranges |
GRanges object of your Open Reading Frame. |
transcriptRanges |
GRanges object of transtript. |
lengthOftrailer |
Numeric. Default is 10. |
It assumes that ORFranges and transcriptRanges are not sorted when on minus strand. Should be like: (200, 600) (50, 100)
A GRanges object of trailer.
Other ORFHelpers:
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopCodons(),
stopSites(),
txNames(),
uniqueGroups(),
uniqueOrder()
ORFranges <- GRanges(seqnames = Rle(rep("1", 3)), ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") transcriptRanges <- GRanges(seqnames = Rle(rep("1", 5)), ranges = IRanges(start = c(1, 10, 20, 30, 40), end = c(5, 15, 25, 35, 45)), strand = "+") defineTrailer(ORFranges, transcriptRanges)ORFranges <- GRanges(seqnames = Rle(rep("1", 3)), ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") transcriptRanges <- GRanges(seqnames = Rle(rep("1", 5)), ranges = IRanges(start = c(1, 10, 20, 30, 40), end = c(5, 15, 25, 35, 45)), strand = "+") defineTrailer(ORFranges, transcriptRanges)
Per contrast, split list into regulation groups and run GOrilla go analysis. If you want to change LFC threshold or p-value cutoff, you reassign Regulation column by LFC and/or p-value.
DEG_gorilla(dt, output_dir, organism)DEG_gorilla(dt, output_dir, organism)
dt |
a data.table of DEG or DTEG results, must also have appended gene symbols column called "external_gene_name" |
output_dir |
path to save results |
organism |
organism(df), example "Homo sapiens" |
a data.table with 2 columns (id: name of contrast), urls: url to html online, this table is also saved in output_dir.
Other GOrilla:
DEG_gorilla_copy_to_local()
Will retrieve full html, png and xls structure so analysis can be used even
when results are deleted online (1 month after creation).
Files are saved to disc in directory "./GOrilla_local_html_outputs/", relative
to input directory 'gorilla_output_dir'. There is 1 subfolder per
analysis url. Open the GOResults.html to view.
DEG_gorilla_copy_to_local( gorilla_output_dir, local_html_dir = file.path(gorilla_output_dir, "GOrilla_local_html_outputs") )DEG_gorilla_copy_to_local( gorilla_output_dir, local_html_dir = file.path(gorilla_output_dir, "GOrilla_local_html_outputs") )
gorilla_output_dir |
character, directory path to existing results of a DEG_gorilla call. Must contain a file with relative path "./All_contrasts_GOrilla_urls.csv" |
local_html_dir |
character, output directory,
default: |
invisible(NULL), files are saved to disc.
Other GOrilla:
DEG_gorilla()
Output as data.table with column 'analysis' describing DEG contrast and column 'go_category' describing COMPONENT, FUNCTION or PROCESS.
DEG_gorilla_local_load_data(gorilla_local_dir)DEG_gorilla_local_load_data(gorilla_local_dir)
gorilla_local_dir |
path to directory of local GORilla html and xls data |
a data.table
Inspired by the enrichment plot from the package clusterProfiler.
DEG_gorilla_plot(dt, top_n = 20L, enrich_cutoff = 8)DEG_gorilla_plot(dt, top_n = 20L, enrich_cutoff = 8)
dt |
a data.table with results loaded using
|
top_n |
maximum number of GO terms per analysis / component split. The sorting is done as -GeneRatio, -p.adjust, so it extracts the top 20 highest GeneRatio terms by p.adjust values (decreasing sort). |
enrich_cutoff |
numeric, default 8. Minimum enrichment, set it lower to get more generic groups, higher to get more specific groups. |
a ggplot, it uses facet_wrap to split analysis / components.
This is the preparation step of DESeq2 analysis using ORFik::DEG.analysis. It is exported so that you can do this step in standalone, usually you want to use DEG.analysis directly.
DEG_model( df, target.contrast = design[1], design = ORFik::design(df), p.value = 0.05, counts = countTable(df, "mrna", type = "summarized"), batch.effect = TRUE, fitType = c("parametric", "local", "mean", "glmGamPoi") )DEG_model( df, target.contrast = design[1], design = ORFik::design(df), p.value = 0.05, counts = countTable(df, "mrna", type = "summarized"), batch.effect = TRUE, fitType = c("parametric", "local", "mean", "glmGamPoi") )
df |
an |
target.contrast |
a character vector, default |
design |
a character vector, default |
p.value |
a numeric, default 0.05 in interval (0,1). Defines adjusted p-value to be used as significance threshold for the result groups. I.e. for exclusive translation group significant subset for p.value = 0.05 means: TE$padj < 0.05 & Ribo$padj < 0.05 & RNA$padj > 0.05. |
counts |
a SummarizedExperiment, default: countTable(df, "mrna", type = "summarized"), all transcripts. Assign a subset if you don't want to analyze all genes. It is recommended to not subset, to give DESeq2 data for variance analysis. |
batch.effect |
logical, default TRUE. Makes replicate column of the experiment
part of the design. |
fitType |
either "parametric", "local", "mean", or "glmGamPoi"
for the type of fitting of dispersions to the mean intensity.
See |
a DESeqDataSet object with results stored as metadata columns.
Other DifferentialExpression:
DEG.plot.static(),
DTEG.analysis(),
DTEG.plot(),
te.table(),
te_rna.plot()
## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] design(df.rna) # The full experimental design target.contrast <- design(df.rna)[1] # Default target contrast #ddsMat_rna <- DEG_model(df.rna, target.contrast)## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] design(df.rna) # The full experimental design target.contrast <- design(df.rna)[1] # Default target contrast #ddsMat_rna <- DEG_model(df.rna, target.contrast)
Get DESeq2 model results from DESeqDataSet
DEG_model_results( ddsMat_rna, target.contrast, pairs, p.value = 0.05, lfcShrinkType = "normal", as.data.table = TRUE )DEG_model_results( ddsMat_rna, target.contrast, pairs, p.value = 0.05, lfcShrinkType = "normal", as.data.table = TRUE )
ddsMat_rna |
a DESeqDataSet object with results stored as metadata columns. |
target.contrast |
a character vector, default |
pairs |
list of character pairs, the experiment contrasts. Default:
|
p.value |
a numeric, default 0.05 in interval (0,1). Defines adjusted p-value to be used as significance threshold for the result groups. I.e. for exclusive translation group significant subset for p.value = 0.05 means: TE$padj < 0.05 & Ribo$padj < 0.05 & RNA$padj > 0.05. |
lfcShrinkType |
character or NULL. Default "normal", which shrinkage to apply to results for low count gene subset. This avoids the problem of extreme fold changes, when counts are low. See lfcShrink. A note for DTEG.analysis function: The interaction term (TE), is not shrunked as this is not counts, but a ratio. |
as.data.table |
logical, default TRUE. Return as data.table or list of DESeq result objects (FALSE). |
a data.table or list
## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] design(df.rna) # The full experimental design target.contrast <- design(df.rna)[1] # Default target contrast #ddsMat_rna <- DEG_model(df.rna, target.contrast) #pairs <- combn.pairs(unlist(df[, target.contrast])) #dt <- DEG_model_results(ddsMat_rna, target.contrast, pairs)## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] design(df.rna) # The full experimental design target.contrast <- design(df.rna)[1] # Default target contrast #ddsMat_rna <- DEG_model(df.rna, target.contrast) #pairs <- combn.pairs(unlist(df[, target.contrast])) #dt <- DEG_model_results(ddsMat_rna, target.contrast, pairs)
If you do not have a valid DESEQ2 experimental setup (contrast), you can use this simplified test
DEG_model_simple( df, target.contrast = design[1], design = ORFik::design(df), p.value = 0.05, counts = countTable(df, "mrna", type = "summarized"), design_ids = as.character(df[, target.contrast]), batch.effect = FALSE )DEG_model_simple( df, target.contrast = design[1], design = ORFik::design(df), p.value = 0.05, counts = countTable(df, "mrna", type = "summarized"), design_ids = as.character(df[, target.contrast]), batch.effect = FALSE )
df |
an |
target.contrast |
a character vector, default |
design |
a character vector, default |
p.value |
a numeric, default 0.05 in interval (0,1). Defines adjusted p-value to be used as significance threshold for the result groups. I.e. for exclusive translation group significant subset for p.value = 0.05 means: TE$padj < 0.05 & Ribo$padj < 0.05 & RNA$padj > 0.05. |
counts |
a SummarizedExperiment, default: countTable(df, "mrna", type = "summarized"), all transcripts. Assign a subset if you don't want to analyze all genes. It is recommended to not subset, to give DESeq2 data for variance analysis. |
design_ids |
character vector of contrast group ids, e.g. c("WT", "WT", "Mutant", "Mutant") |
batch.effect |
logical, default TRUE. Makes replicate column of the experiment
part of the design. |
a data.table of fpkm ratios
## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df <- df[df$libtype == "RNA",] #dt <- DEG_model_simple(df)## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df <- df[df$libtype == "RNA",] #dt <- DEG_model_simple(df)
Expression analysis of 1 dimension, usually between conditions of RNA-seq.
Using the standardized DESeq2 pipeline flow.
Creates a DESeq model (given x is the target.contrast argument)
(usually 'condition' column)
1. RNA-seq model: design = ~ x (differences between the x groups in RNA-seq)
DEG.analysis( df, target.contrast = design[1], design = ORFik::design(df), p.value = 0.05, counts = countTable(df, "mrna", type = "summarized"), batch.effect = TRUE, pairs = combn.pairs(unlist(df[, target.contrast])), as.data.table = TRUE, fitType = c("parametric", "local", "mean", "glmGamPoi"), lfcShrinkType = "normal" )DEG.analysis( df, target.contrast = design[1], design = ORFik::design(df), p.value = 0.05, counts = countTable(df, "mrna", type = "summarized"), batch.effect = TRUE, pairs = combn.pairs(unlist(df[, target.contrast])), as.data.table = TRUE, fitType = c("parametric", "local", "mean", "glmGamPoi"), lfcShrinkType = "normal" )
df |
an |
target.contrast |
a character vector, default |
design |
a character vector, default |
p.value |
a numeric, default 0.05 in interval (0,1). Defines adjusted p-value to be used as significance threshold for the result groups. I.e. for exclusive translation group significant subset for p.value = 0.05 means: TE$padj < 0.05 & Ribo$padj < 0.05 & RNA$padj > 0.05. |
counts |
a SummarizedExperiment, default: countTable(df, "mrna", type = "summarized"), all transcripts. Assign a subset if you don't want to analyze all genes. It is recommended to not subset, to give DESeq2 data for variance analysis. |
batch.effect |
logical, default TRUE. Makes replicate column of the experiment
part of the design. |
pairs |
list of character pairs, the experiment contrasts. Default:
|
as.data.table |
logical, default TRUE. Return as data.table or list of DESeq result objects (FALSE). |
fitType |
either "parametric", "local", "mean", or "glmGamPoi"
for the type of fitting of dispersions to the mean intensity.
See |
lfcShrinkType |
character or NULL. Default "normal", which shrinkage to apply to results for low count gene subset. This avoids the problem of extreme fold changes, when counts are low. See lfcShrink. A note for DTEG.analysis function: The interaction term (TE), is not shrunked as this is not counts, but a ratio. |
#' Analysis is done between each possible
combination of levels in the target contrast If target contrast is the condition column,
with factor levels: WT, mut1 and mut2 with 3 replicates each. You get comparison
of WT vs mut1, WT vs mut2 and mut1 vs mut2.
The respective result categories are defined as:
(given a user defined p value, shown here as 0.05):
Significant - p-value adjusted < 0.05 (p-value cutoff decided by 'p.value argument)
The LFC values are shrunken by lfcShrink(type = "normal").
Remember that DESeq by default can not
do global change analysis, it can only find subsets with changes in LFC!
a data.table with columns: (contrast variable, gene id, regulation status, log fold changes, p.adjust values, mean counts)
https://doi.org/10.1002/cpmb.108
Other DifferentialExpression:
DEG.plot.static(),
DEG_model(),
DTEG.plot(),
te.table(),
te_rna.plot()
## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] design(df.rna) # The full experimental design design(df.rna)[1] # Default target contrast dt <- DEG.analysis(df.rna)## Simple example (use ORFik template, then use only RNA-seq) df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] design(df.rna) # The full experimental design design(df.rna)[1] # Default target contrast dt <- DEG.analysis(df.rna)
Plot setup:
X-axis: mean counts
Y-axis: Log2 fold changes
For explanation of plot, see DEG.analysis
DEG.plot.static( dt, output.dir = NULL, p.value.label = 0.05, plot.title = "", plot.ext = ".pdf", width = 6, height = 6, dpi = 300, dot.size = 0.4, xlim = "auto", ylim = "bidir.max", relative.name = paste0("DEG_plot", plot.ext) )DEG.plot.static( dt, output.dir = NULL, p.value.label = 0.05, plot.title = "", plot.ext = ".pdf", width = 6, height = 6, dpi = 300, dot.size = 0.4, xlim = "auto", ylim = "bidir.max", relative.name = paste0("DEG_plot", plot.ext) )
dt |
a data.table with the results from |
output.dir |
a character path, default NULL(no save), or a directory to save to a file. Relative name of file, specified by 'relative.name' argument. |
p.value.label |
a numeric, default ifelse(!is.null(attr(dt, "p.value")), attr(dt, "p.value"), 0.05) Interval (0,1), use"" to not show. What p-value used for the analysis? Will be shown as a caption. |
plot.title |
title for plots, usually name of experiment etc |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". Multiple values allowed, if so will save file in each format specified. |
width |
numeric, default 6 (in inches) |
height |
numeric, default 6 (in inches) |
dpi |
numeric, default 300. |
dot.size |
numeric, default 0.4, size of point dots in plot. |
xlim |
numeric vector or character preset, default: "bidir.max" (Equal in both + / - direction, using max value + 0.5 of meanCounts column in dt). If you want ggplot to decide limit, set to "auto". For numeric vector, specify min and max x limit: like c(-5, 5) |
ylim |
numeric vector or character preset, default: "bidir.max" (Equal in both + / - direction, using max value + 0.5 of LFC column in dt). If you want ggplot to decide limit, set to "auto". For numeric vector, specify min and max y limit: like c(-10, 10) |
relative.name |
character, Default: |
a ggplot object, will facet_wrap if length(unique(dt$contrasts)) > 1
Other DifferentialExpression:
DEG_model(),
DTEG.analysis(),
DTEG.plot(),
te.table(),
te_rna.plot()
df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] #dt <- DEG.analysis(df.rna) #Default scaling #DEG.plot.static(dt) #Manual scaling #DEG.plot.static(dt, xlim = c(-2, 2), ylim = c(-2, 2))df <- ORFik.template.experiment() df.rna <- df[df$libtype == "RNA",] #dt <- DEG.analysis(df.rna) #Default scaling #DEG.plot.static(dt) #Manual scaling #DEG.plot.static(dt, xlim = c(-2, 2), ylim = c(-2, 2))
Get experimental design Find the column/columns that create a separation between samples, by default skips replicate and choose first that is from either: libtype, condition, stage and fraction.
## S4 method for signature 'experiment' design( object, batch.correction.design = FALSE, as.formula = FALSE, multi.factor = TRUE )## S4 method for signature 'experiment' design( object, batch.correction.design = FALSE, as.formula = FALSE, multi.factor = TRUE )
object |
an ORFik |
batch.correction.design |
logical, default FALSE. If true, add replicate as a trailing design factor (only if >= 2 replicates exists). |
as.formula |
logical, default FALSE. If TRUE, return as formula |
multi.factor |
logical, default TRUE If FALSE, return first factor only (+ rep, if batch.correction.design is true). Order of picking for single.factor is: does libtype have > 1 level, if not then: stage, if not then: condition, if not then: fraction. |
a character (name of column) or a formula
df <- ORFik.template.experiment() design(df) # The 2 columns that decides the design here # If we subset it changes design(df[df$libtype == "RFP",]) # Only single factor design, it picks first design(df, multi.factor = FALSE)df <- ORFik.template.experiment() design(df) # The 2 columns that decides the design here # If we subset it changes design(df[df$libtype == "RFP",]) # Only single factor design, it picks first design(df, multi.factor = FALSE)
Detects the mounted drive based on a mounted path
detect_drive(ref_path = path.expand(config()["ref"]))detect_drive(ref_path = path.expand(config()["ref"]))
ref_path |
= path.expand(config()["ref"]) |
character, name of FileSystem drive of mounted path, NA_character_ if not found
detect_drive(tempdir())detect_drive(tempdir())
Finding all ORFs:
1. Find all ORFs in mRNA using ORFik findORFs, with defined parameters.
To create the candidate ORFs (all ORFs returned):
Steps (candidate set):
Define a candidate search set by these 3 rules:
1.a Allowed ORF type: uORF, NTE, etc (only keep these in candidate list)
1.b Must have at least x reads over whole orf (default 10 reads)
1.c Must have at least x reads over start site (default 3 reads)
The total list is defined by these names, and saved according to allowed ORF type/types.
To create the prediction status (TRUE/FALSE) per candidate
Steps (prediction status)
(UP_NT is a 20nt window upstream of ORF, that stops 2NT before ORF starts) :
1. ORF mean reads per NT > (UP_NT mean reads per NT * 1.3)
2. ORFScore > 2.5
3. TIS total reads + 3 > ORF median reads per NT
4. Given expression above, a TRUE prediction is defined with the AND operatior: 1. & 2. & 3.
In code that is:predicted <- (orfs_cov_stats$mean > upstream_cov_stats$mean*1.3) & orfs_cov_stats$ORFScores > 2.5 &
((reads_start[candidates] + 3) > orfs_cov_stats$median)
detect_ribo_orfs( df, out_folder, ORF_categories_to_keep, prefix_result = paste(c(ORF_categories_to_keep, gsub(" ", "_", organism(df))), collapse = "_"), mrna = loadRegion(df, "mrna"), cds = loadRegion(df, "cds"), libraries = outputLibs(df, type = "pshifted", output.mode = "envirlist"), orf_candidate_ranges = findORFs(seqs = txSeqsFromFa(mrna, df, TRUE), longestORF = longestORF, startCodon = startCodon, stopCodon = stopCodon, minimumLength = minimumLength), orfs_gr = categorize_and_filter_ORFs(orf_candidate_ranges, ORF_categories_to_keep, cds, mrna), export_metrics_table = TRUE, longestORF = FALSE, startCodon = startDefinition(1), stopCodon = stopDefinition(1), minimumLength = 0, minimum_reads_ORF = 10, minimum_reads_start = 3 )detect_ribo_orfs( df, out_folder, ORF_categories_to_keep, prefix_result = paste(c(ORF_categories_to_keep, gsub(" ", "_", organism(df))), collapse = "_"), mrna = loadRegion(df, "mrna"), cds = loadRegion(df, "cds"), libraries = outputLibs(df, type = "pshifted", output.mode = "envirlist"), orf_candidate_ranges = findORFs(seqs = txSeqsFromFa(mrna, df, TRUE), longestORF = longestORF, startCodon = startCodon, stopCodon = stopCodon, minimumLength = minimumLength), orfs_gr = categorize_and_filter_ORFs(orf_candidate_ranges, ORF_categories_to_keep, cds, mrna), export_metrics_table = TRUE, longestORF = FALSE, startCodon = startDefinition(1), stopCodon = stopDefinition(1), minimumLength = 0, minimum_reads_ORF = 10, minimum_reads_start = 3 )
df |
an ORFik |
out_folder |
Directory to save files |
ORF_categories_to_keep |
options, any subset of:
|
prefix_result |
the prefix name of output files to out_folder. Default:
|
mrna |
= |
cds |
= |
libraries |
the ribo-seq libraries loaded into R as list, default:
|
orf_candidate_ranges |
IRangesList, =
|
orfs_gr |
= categorize_and_filter_ORFs(orf_candidate_ranges, ORF_categories_to_keep, cds, mrna). The GRangesList set of ORFs to actually search. |
export_metrics_table |
logical, default TRUE. Export table of statistics to file with suffix: "_prediction_table.rds" |
longestORF |
(logical) Default TRUE. Keep only the longest ORF per
unique stopcodon: (seqname, strand, stopcodon) combination, Note: Not longest
per transcript! You can also use function
|
startCodon |
(character vector) Possible START codons to search for.
Check |
stopCodon |
(character vector) Possible STOP codons to search for.
Check |
minimumLength |
(integer) Default is 0. Which is START + STOP = 6 bp. Minimum length of ORF, without counting 3bps for START and STOP codons. For example minimumLength = 8 will result in size of ORFs to be at least START + 8*3 (bp) + STOP = 30 bases. Use this param to restrict search. |
minimum_reads_ORF |
numeric, default 10, orf removed if less reads overlap whole orf |
minimum_reads_start |
numeric, default 3, orf removed if less reads overlap start |
invisible(NULL), all ORF results saved to disc
# Pre requisites # 1. Create ORFik experiment # ORFik::create.experiment(...) # 2. Create ORFik optimized annotation: # makeTxdbFromGenome(gtf = ORFik:::getGtfPathFromTxdb(df), genome = df@fafile, # organism = organism(df), optimize = TRUE) # 3. There must exist pshifted reads, either as default files, or in a relative folder called # "./pshifted/". See ?shiftFootprintsByExperiment # EXAMPLE: df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][c(1,2),] result_folder <- riboORFsFolder(df, tempdir()) results <- detect_ribo_orfs(df, result_folder, c("uORF", "uoORF", "annotated", "NTE")) # Load results of annotated ORFs table <- riboORFs(df[1,], type = "table", result_folder) table # See all statistics sum(table$predicted) # How many were predicted as Ribo-seq ORFs # Load 2 results table <- riboORFs(df[1:2,], type = "table", result_folder) table # See all statistics sum(table$predicted) # How many were predicted as Ribo-seq ORFs # Load GRangesList candidates_gr <- riboORFs(df[1,], type = "ranges_candidates", result_folder) prediction <- riboORFs(df[1,], type = "predictions", result_folder) predicted_gr <- riboORFs(df[1:2,], type = "ranges_predictions", result_folder) identical(predicted_gr[[1]], candidates_gr[[1]][prediction[[1]]]) ## Inspect predictions in RiboCrypt # library(RiboCrypt) # Inspect Predicted view <- predicted_gr[[1]][1] #multiOmicsPlot_ORFikExp(view, df, view, leader_extension = 100, trailer_extension = 100) # Inspect not predicted view <- candidates_gr[[1]][!prediction[[1]]][1] #multiOmicsPlot_ORFikExp(view, df, view, leader_extension = 100, trailer_extension = 100)# Pre requisites # 1. Create ORFik experiment # ORFik::create.experiment(...) # 2. Create ORFik optimized annotation: # makeTxdbFromGenome(gtf = ORFik:::getGtfPathFromTxdb(df), genome = df@fafile, # organism = organism(df), optimize = TRUE) # 3. There must exist pshifted reads, either as default files, or in a relative folder called # "./pshifted/". See ?shiftFootprintsByExperiment # EXAMPLE: df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][c(1,2),] result_folder <- riboORFsFolder(df, tempdir()) results <- detect_ribo_orfs(df, result_folder, c("uORF", "uoORF", "annotated", "NTE")) # Load results of annotated ORFs table <- riboORFs(df[1,], type = "table", result_folder) table # See all statistics sum(table$predicted) # How many were predicted as Ribo-seq ORFs # Load 2 results table <- riboORFs(df[1:2,], type = "table", result_folder) table # See all statistics sum(table$predicted) # How many were predicted as Ribo-seq ORFs # Load GRangesList candidates_gr <- riboORFs(df[1,], type = "ranges_candidates", result_folder) prediction <- riboORFs(df[1,], type = "predictions", result_folder) predicted_gr <- riboORFs(df[1:2,], type = "ranges_predictions", result_folder) identical(predicted_gr[[1]], candidates_gr[[1]][prediction[[1]]]) ## Inspect predictions in RiboCrypt # library(RiboCrypt) # Inspect Predicted view <- predicted_gr[[1]][1] #multiOmicsPlot_ORFikExp(view, df, view, leader_extension = 100, trailer_extension = 100) # Inspect not predicted view <- candidates_gr[[1]][!prediction[[1]]][1] #multiOmicsPlot_ORFikExp(view, df, view, leader_extension = 100, trailer_extension = 100)
Utilizes periodicity measurement (Fourier transform), and change point analysis to detect ribosomal footprint shifts for each of the ribosomal read lengths. Returns subset of read lengths and their shifts for which top covered transcripts follow periodicity measure. Each shift value assumes 5' anchoring of the reads, so that output offsets values will shift 5' anchored footprints to be on the p-site of the ribosome. The E-site will be shift + 3 and A site will be shift - 3. So update to these, if you rather want those.
detectRibosomeShifts( footprints, txdb, start = TRUE, stop = FALSE, top_tx = 10L, minFiveUTR = 30L, minCDS = 150L, minThreeUTR = if (stop) { 30 } else NULL, txNames = filterTranscripts(txdb, minFiveUTR, minCDS, minThreeUTR), firstN = 150L, tx = NULL, min_reads = 1000, min_reads_TIS = 50, accepted.lengths = 26:34, heatmap = FALSE, must.be.periodic = TRUE, strict.fft = TRUE, verbose = FALSE )detectRibosomeShifts( footprints, txdb, start = TRUE, stop = FALSE, top_tx = 10L, minFiveUTR = 30L, minCDS = 150L, minThreeUTR = if (stop) { 30 } else NULL, txNames = filterTranscripts(txdb, minFiveUTR, minCDS, minThreeUTR), firstN = 150L, tx = NULL, min_reads = 1000, min_reads_TIS = 50, accepted.lengths = 26:34, heatmap = FALSE, must.be.periodic = TRUE, strict.fft = TRUE, verbose = FALSE )
footprints |
|
txdb |
a TxDb file, a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite) or an ORFik experiment |
start |
(logical) Whether to include predictions based on the start codons. Default TRUE. |
stop |
(logical) Whether to include predictions based on the stop codons. Default FASLE. Only use if there exists 3' UTRs for the annotation. If peridicity around stop codon is stronger than at the start codon, use stop instead of start region for p-shifting. |
top_tx |
(integer), default 10. Specify which % of the top TIS coverage transcripts to use for estimation of the shifts. By default we take top 10 top covered transcripts as they represent less noisy data-set. This is only applicable when there are more than 1000 transcripts. |
minFiveUTR |
(integer) minimum bp for 5' UTR during filtering for the transcripts. Set to NULL if no 5' UTRs exists for annotation. |
minCDS |
(integer) minimum bp for CDS during filtering for the transcripts |
minThreeUTR |
(integer) minimum bp for 3' UTR during filtering for the transcripts. Set to NULL if no 3' UTRs exists for annotation. |
txNames |
a character vector of subset of CDS to use. Default:
txNames = filterTranscripts(txdb, minFiveUTR, minCDS, minThreeUTR) |
firstN |
(integer) Represents how many bases of the transcripts downstream of start codons to use for initial estimation of the periodicity. |
tx |
a GRangesList, if you do not have 5' UTRs in annotation, send your own version. Example: extendLeaders(tx, 30) Where 30 bases will be new "leaders". Since each original transcript was either only CDS or non-coding (filtered out). |
min_reads |
default (1000), how many reads must a read-length have in total to be considered for periodicity. |
min_reads_TIS |
default (50), how many reads must a read-length have in the TIS region to be considered for periodicity. |
accepted.lengths |
accepted read lengths, default 26:34, usually ribo-seq is strongest between 27:32. |
heatmap |
a logical or character string, default FALSE. If TRUE, will plot heatmap of raw reads before p-shifting to console, to see if shifts given make sense. You can also set a filepath to save the file there. |
must.be.periodic |
logical TRUE, if FALSE will not filter on periodic read lengths. (The Fourier transform filter will be skipped). This is useful if you are not going to do periodicity analysis, that is: for you more coverage depth (more read lengths) is more important than only keeping the high quality periodic read lengths. |
strict.fft |
logical, TRUE. Use a FFT without noise filter. This means keep only reads lengths that are "periodic for the human eye". If you want more coverage, set to FALSE, to also get read lengths that are "messy", but the noise filter detects the periodicity of 3. This should only be done when you do not need high quality periodic reads! Example would be differential translation analysis by counts over each ORF. |
verbose |
logical, default FALSE. Report details of analysis/periodogram. Good if you are not sure if the analysis was correct. |
Check out vignette for the examples of plotting RiboSeq metaplots over start and stop codons, so that you can verify visually whether this function detects correct shifts.
For how the Fourier transform works, see: isPeriodic
For how the changepoint analysis works, see: changePointAnalysis
NOTE: It will remove softclips from valid width, the CIGAR 3S30M is qwidth 33, but will remove 3S so final read width is 30 in ORFik. This is standard for ribo-seq.
a data.table with lengths of footprints and their predicted coresponding offsets
https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4912-6
Other pshifting:
changePointAnalysis(),
shiftFootprints(),
shiftFootprintsByExperiment(),
shiftPlots(),
shifts_load(),
shifts_save()
## Basic run # Transcriptome annotation -> gtf_file <- system.file("extdata/references/danio_rerio", "annotations.gtf", package = "ORFik") # Ribo seq data -> riboSeq_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") ## Not run: footprints <- readBam(riboSeq_file) ## Using CDS start site as reference point: detectRibosomeShifts(footprints, gtf_file) ## Using CDS start site and stop site as 2 reference points: #detectRibosomeShifts(footprints, gtf_file, stop = TRUE) ## Debug and detailed information for accepted reads lengths and p-site: detectRibosomeShifts(footprints, gtf_file, heatmap = TRUE, verbose = TRUE) ## Debug why read length 31 was not accepted or wrong p-site: #detectRibosomeShifts(footprints, gtf_file, must.be.periodic = FALSE, # accepted.lengths = 31, heatmap = TRUE, verbose = TRUE) ## Subset bam file param = ScanBamParam(flag = scanBamFlag( isDuplicate = FALSE, isSecondaryAlignment = FALSE)) footprints <- readBam(riboSeq_file, param = param) detectRibosomeShifts(footprints, gtf_file, stop = TRUE) ## Without 5' Annotation library(GenomicFeatures) txdb <- loadTxdb(gtf_file) tx <- exonsBy(txdb, by = "tx", use.names = TRUE) tx <- extendLeaders(tx, 30) ## Now run function, without 5' and 3' UTRs detectRibosomeShifts(footprints, txdb, start = TRUE, minFiveUTR = NULL, minCDS = 150L, minThreeUTR = NULL, firstN = 150L, tx = tx) ## End(Not run)## Basic run # Transcriptome annotation -> gtf_file <- system.file("extdata/references/danio_rerio", "annotations.gtf", package = "ORFik") # Ribo seq data -> riboSeq_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") ## Not run: footprints <- readBam(riboSeq_file) ## Using CDS start site as reference point: detectRibosomeShifts(footprints, gtf_file) ## Using CDS start site and stop site as 2 reference points: #detectRibosomeShifts(footprints, gtf_file, stop = TRUE) ## Debug and detailed information for accepted reads lengths and p-site: detectRibosomeShifts(footprints, gtf_file, heatmap = TRUE, verbose = TRUE) ## Debug why read length 31 was not accepted or wrong p-site: #detectRibosomeShifts(footprints, gtf_file, must.be.periodic = FALSE, # accepted.lengths = 31, heatmap = TRUE, verbose = TRUE) ## Subset bam file param = ScanBamParam(flag = scanBamFlag( isDuplicate = FALSE, isSecondaryAlignment = FALSE)) footprints <- readBam(riboSeq_file, param = param) detectRibosomeShifts(footprints, gtf_file, stop = TRUE) ## Without 5' Annotation library(GenomicFeatures) txdb <- loadTxdb(gtf_file) tx <- exonsBy(txdb, by = "tx", use.names = TRUE) tx <- extendLeaders(tx, 30) ## Now run function, without 5' and 3' UTRs detectRibosomeShifts(footprints, txdb, start = TRUE, minFiveUTR = NULL, minCDS = 150L, minThreeUTR = NULL, firstN = 150L, tx = tx) ## End(Not run)
Disengagement score is defined as
(RPFs over ORF)/(RPFs downstream to transcript end)
A pseudo-count of one is added to both the ORF and downstream sums.
disengagementScore( grl, RFP, GtfOrTx, RFP.sorted = FALSE, weight = 1L, overlapGrl = NULL )disengagementScore( grl, RFP, GtfOrTx, RFP.sorted = FALSE, weight = 1L, overlapGrl = NULL )
grl |
a |
RFP |
RiboSeq reads as GAlignments, GRanges or GRangesList object |
GtfOrTx |
If it is |
RFP.sorted |
logical (FALSE), an optimizer, have you ran this line:
|
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
overlapGrl |
an integer, (default: NULL), if defined must be countOverlaps(grl, RFP), added for speed if you already have it |
a named vector of numeric values of scores
doi: 10.1242/dev.098344
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) tx <- GRangesList(tx1 = GRanges("1", IRanges(1, 50), "+")) RFP <- GRanges("1", IRanges(c(1,10,20,30,40), width = 3), "+") disengagementScore(grl, RFP, tx)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) tx <- GRangesList(tx1 = GRanges("1", IRanges(1, 50), "+")) RFP <- GRanges("1", IRanges(c(1,10,20,30,40), width = 3), "+") disengagementScore(grl, RFP, tx)
Follow means downstream GRangesList element, not including itself.
distanceToFollowing(grl, grl2 = grl, ignore.strand = FALSE)distanceToFollowing(grl, grl2 = grl, ignore.strand = FALSE)
grl |
a GRangesList |
grl2 |
a GRangesList, default 'grl'. The list that defines restrictions on extension. Can also be another set, which is used as 'roadblocks' for extension. |
ignore.strand |
logical, default FALSE |
numeric vector of distance
Preceding means upstream GRangesList element, not including itself.
distanceToPreceding(grl, grl2 = grl, ignore.strand = FALSE)distanceToPreceding(grl, grl2 = grl, ignore.strand = FALSE)
grl |
a GRangesList |
grl2 |
a GRangesList, default 'grl'. The list that defines restrictions on extension. Can also be another set, which is used as 'roadblocks' for extension. |
ignore.strand |
logical, default FALSE |
numeric vector of distance
Will calculate distance between each ORF end and begining of the corresponding cds (main ORF). Matching is done by transcript names. This is applicable practically to the upstream (fiveUTRs) ORFs only. The cds start site, will be presumed to be on + 1 of end of fiveUTRs.
distToCds(ORFs, fiveUTRs, cds = NULL)distToCds(ORFs, fiveUTRs, cds = NULL)
ORFs |
orfs as |
fiveUTRs |
fiveUTRs as |
cds |
cds' as |
an integer vector, +1 means one base upstream of cds, -1 means 2nd base in cds, 0 means orf stops at cds start.
doi: 10.1074/jbc.R116.733899
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
grl <- GRangesList(tx1_1 = GRanges("1", IRanges(1, 10), "+")) fiveUTRs <- GRangesList(tx1 = GRanges("1", IRanges(1, 20), "+")) distToCds(grl, fiveUTRs)grl <- GRangesList(tx1_1 = GRanges("1", IRanges(1, 10), "+")) fiveUTRs <- GRangesList(tx1 = GRanges("1", IRanges(1, 20), "+")) distToCds(grl, fiveUTRs)
Matching is done by transcript names. This is applicable practically to any region in Transcript If ORF is not within specified search space in tx, this function will crash.
distToTSS(ORFs, tx)distToTSS(ORFs, tx)
ORFs |
orfs as |
tx |
transcripts as |
an integer vector, 1 means on TSS, 2 means second base of Tx.
doi: 10.1074/jbc.R116.733899
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
grl <- GRangesList(tx1_1 = GRanges("1", IRanges(5, 10), "+")) tx <- GRangesList(tx1 = GRanges("1", IRanges(2, 20), "+")) distToTSS(grl, tx)grl <- GRangesList(tx1_1 = GRanges("1", IRanges(5, 10), "+")) tx <- GRangesList(tx1 = GRanges("1", IRanges(2, 20), "+")) distToTSS(grl, tx)
Uses ncbi gene database for vertebrates
download_gene_homologues( gene_id = "ENSG00000110092", organism = "Homo sapiens" )download_gene_homologues( gene_id = "ENSG00000110092", organism = "Homo sapiens" )
gene_id |
character, gene name (ensembl gene id, not symbol!) |
organism |
default NULL. Scientific name (e.g. Homo sapiens) |
character, summary text for gene from the database.
Uses ncbi gene database summary from RefSeq
download_gene_info(gene = "CCND1", organism = "Homo sapiens", by = "symbol")download_gene_info(gene = "CCND1", organism = "Homo sapiens", by = "symbol")
gene |
character, gene name (symbol) |
organism |
default NULL. Scientific name (e.g. Homo sapiens) |
by |
character, default symbol (search by gene symbol name). If "ensembl id", it seraches as it is ensembl gene id ENSG.. etc. |
character, summary text for gene from the database.
# Wrap in 'try' to avoid wrong bioc test error try(download_gene_info(gene = "CCND1")) try(download_gene_info("ENSG00000110092", by = "ensembl_id")) # By ensembl id try(download_gene_info(gene = "CCND1", organism = "Mus musculus"))# Wrap in 'try' to avoid wrong bioc test error try(download_gene_info(gene = "CCND1")) try(download_gene_info("ENSG00000110092", by = "ensembl_id")) # By ensembl id try(download_gene_info(gene = "CCND1", organism = "Mus musculus"))
Multicore version download, see documentation for SRA toolkit for more information.
download.SRA( info, outdir, rename = TRUE, fastq.dump.path = install.sratoolkit(), settings = paste("--skip-technical", "--split-files"), subset = NULL, compress = TRUE, use.ebi.ftp = is.null(subset), ebiDLMethod = "auto", timeout = 5000, BPPARAM = bpparam() )download.SRA( info, outdir, rename = TRUE, fastq.dump.path = install.sratoolkit(), settings = paste("--skip-technical", "--split-files"), subset = NULL, compress = TRUE, use.ebi.ftp = is.null(subset), ebiDLMethod = "auto", timeout = 5000, BPPARAM = bpparam() )
info |
character vector of only SRR numbers or a data.frame with SRA metadata information including the SRR numbers in a column called "Run" or "SRR". Can be SRR, ERR or DRR numbers. If only SRR numbers can not rename, since no additional information is given. |
outdir |
directory to store runs, files are named by default (rename = TRUE) by information from SRA metadata table, if (rename = FALSE) named according to SRR numbers. |
rename |
logical or character, default TRUE (Auto guess new names). False: Skip renaming. A character vector of equal size as files wanted can also be given. Priority of renaming from the metadata is to check for unique names in the LibraryName column, then the sample_title column if no valid names in LibraryName. If new names found and still duplicates, will add "_rep1", "_rep2" to make them unique. If no valid names, will not rename, that is keep the SRR numbers, you then can manually rename files to something more meaningful. |
fastq.dump.path |
path to fastq-dump binary, default: path returned from install.sratoolkit() |
settings |
a string of arguments for fastq-dump, default: paste("–gzip", "–skip-technical", "–split-files") |
subset |
an integer or NULL, default NULL (no subset). If defined as a integer will download only the first n reads specified by subset. If subset is defined, will force to use fastq-dump which is slower than ebi download. |
compress |
logical, default TRUE. Download compressed files ".gz". |
use.ebi.ftp |
logical, default: is.null(subset). Use ORFiks much faster download function that only works when subset is null, if subset is defined, it uses fastqdump, it is slower but supports subsetting. Force it to use fastqdump by setting this to FALSE. |
ebiDLMethod |
character, default "auto". Which download protocol to use in download.file when using ebi ftp download. Sometimes "curl" is might not work (the default auto usually), in those cases use wget. See "method" argument of ?download.file, for more info. |
timeout |
5000, how many seconds before killing download if still active? Will overwrite global option until R session is closed. Increase value if you are on a very slow connection or downloading a large dataset. |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
a character vector of download files filepaths
https://ncbi.github.io/sra-tools/fastq-dump.html
Other sra:
browseSRA(),
download.SRA.metadata(),
download.ebi(),
get_bioproject_candidates(),
install.sratoolkit(),
rename.SRA.files()
SRR <- c("SRR453566") # Can be more than one ## Simple single SRR run of YEAST outdir <- tempdir() # Specify output directory # Download, get 5 first reads #download.SRA(SRR, outdir, rename = FALSE, subset = 5) ## Using metadata column to get SRR numbers and to be able to rename samples outdir <- tempdir() # Specify output directory info <- download.SRA.metadata("SRP226389", outdir) # By study id ## Download, 5 first reads of each library and rename #files <- download.SRA(info, outdir, subset = 5) #Biostrings::readDNAStringSet(files[1], format = "fastq") ## Download full libraries of experiment ## (note, this will take some time to download!) #download.SRA(info, outdir)SRR <- c("SRR453566") # Can be more than one ## Simple single SRR run of YEAST outdir <- tempdir() # Specify output directory # Download, get 5 first reads #download.SRA(SRR, outdir, rename = FALSE, subset = 5) ## Using metadata column to get SRR numbers and to be able to rename samples outdir <- tempdir() # Specify output directory info <- download.SRA.metadata("SRP226389", outdir) # By study id ## Download, 5 first reads of each library and rename #files <- download.SRA(info, outdir, subset = 5) #Biostrings::readDNAStringSet(files[1], format = "fastq") ## Download full libraries of experiment ## (note, this will take some time to download!) #download.SRA(info, outdir)
Given a experiment identifier, query information from different locations of SRA to get a complete metadata table of the experiment. It first finds Runinfo for each library, then sample info, if pubmed id is not found searches for that and searches for author through pubmed.
download.SRA.metadata( SRP, outdir = tempdir(), remove.invalid = TRUE, auto.detect = FALSE, abstract = "printsave", force = FALSE, rich.format = FALSE, fetch_GSE = FALSE )download.SRA.metadata( SRP, outdir = tempdir(), remove.invalid = TRUE, auto.detect = FALSE, abstract = "printsave", force = FALSE, rich.format = FALSE, fetch_GSE = FALSE )
SRP |
character string, a study ID as either the PRJ, SRP, ERP, DRP, GSE or SRA of the study, examples would be "SRP226389" or "ERP116106". If GSE it will try to convert to the SRP to find the files. The call works as long the runs are registered on the efetch server, as their is a linked SRP link from bioproject or GSE. Example which fails is "PRJNA449388", which does not have a linking like this. |
outdir |
character string, directory to save file, default: tempdir(). The file will be called "SraRunInfo_SRP.csv", where SRP is the SRP argument. We advice to use bioproject IDs "PRJNA...". The directory will be created if not existing. |
remove.invalid |
logical, default TRUE. Remove Runs with 0 reads (spots) |
auto.detect |
logical, default FALSE. If TRUE, ORFik will add additional columns: |
abstract |
character, default "printsave". If abstract for project exists,
print and save it (save the file to same directory as runinfo).
Alternatives: "print", Only print first time downloaded,
will not be able to print later. |
force |
logical, default FALSE. If TRUE, will redownload all files needed even though they exists. Useuful if you wanted auto.detection, but already downloaded without it. |
rich.format |
logical, default FALSE. If TRUE, will fetch all Experiment and Sample attributes. It means, that different studies can have different set of columns if set to TRUE. |
fetch_GSE |
logical, default FALSE. Search for GSE, if exists, appends a column called GEO. Will be included even though this study is not from GEO, then it sets all to NA. |
A common problem is that the project is not linked to an article, you will then not get a pubmed id.
The algorithm works like this:
If GEO identifier, find the SRP.
Then search Entrez for project and get sample identifier.
From that extract the run information and collect into a final table.
a data.table of the metadata, 1 row per sample, SRR run number defined in 'Run' column.
doi: 10.1093/nar/gkq1019
Other sra:
browseSRA(),
download.SRA(),
download.ebi(),
get_bioproject_candidates(),
install.sratoolkit(),
rename.SRA.files()
## Originally on SRA download.SRA.metadata("SRP226389") ## Now try with auto detection (guessing additional library info) ## Need to specify output dir as tempfile() to re-download #download.SRA.metadata("SRP226389", tempfile(), auto.detect = TRUE) ## Originally on ENA (RCP-seq data) # download.SRA.metadata("ERP116106") ## Originally on GEO (GSE) (save to directory to keep info with fastq files) # download.SRA.metadata("GSE61011") ## Bioproject ID # download.SRA.metadata("PRJNA231536")## Originally on SRA download.SRA.metadata("SRP226389") ## Now try with auto detection (guessing additional library info) ## Need to specify output dir as tempfile() to re-download #download.SRA.metadata("SRP226389", tempfile(), auto.detect = TRUE) ## Originally on ENA (RCP-seq data) # download.SRA.metadata("ERP116106") ## Originally on GEO (GSE) (save to directory to keep info with fastq files) # download.SRA.metadata("GSE61011") ## Bioproject ID # download.SRA.metadata("PRJNA231536")
Expression analysis of 2 dimensions, usually Ribo-seq vs RNA-seq.
Using an equal reimplementation of the deltaTE algorithm (see reference).
Creates a total of 3 DESeq models (given x is the target.contrast argument)
(usually 'condition' column) and libraryType is RNA-seq and Ribo-seq):
** The 3 differential sub models **
1. Ribo-seq model : design = ~ x (differences between the x groups in Ribo-seq)
2. RNA-seq model: design = ~ x (differences between the x groups in RNA-seq)
3. TE model: design = ~ x + libraryType + libraryType:x (differences between the x and libraryType groups and the interaction between them)
You need at least 2 groups and 2 replicates per group. By default, the Ribo-seq counts will
be over CDS and RNA-seq counts over whole mRNAs, per transcript. See notes section below
for more details.
DTEG.analysis( df.rfp, df.rna, output.dir = QCfolder(df.rfp), target.contrast = design[1], design = ORFik::design(df.rfp), p.value = 0.05, RFP_counts = countTable(df.rfp, "cds", type = "summarized"), RNA_counts = countTable(df.rna, "mrna", type = "summarized"), batch.effect = FALSE, pairs = combn.pairs(unlist(df.rfp[, design])), plot.title = "", plot.ext = ".pdf", width = 6, height = 6, dot.size = 0.4, relative.name = paste0("DTEG_plot", plot.ext), complex.categories = FALSE, plot_to_console = TRUE, fitType = c("parametric", "local", "mean", "glmGamPoi"), lfcShrinkType = "normal" )DTEG.analysis( df.rfp, df.rna, output.dir = QCfolder(df.rfp), target.contrast = design[1], design = ORFik::design(df.rfp), p.value = 0.05, RFP_counts = countTable(df.rfp, "cds", type = "summarized"), RNA_counts = countTable(df.rna, "mrna", type = "summarized"), batch.effect = FALSE, pairs = combn.pairs(unlist(df.rfp[, design])), plot.title = "", plot.ext = ".pdf", width = 6, height = 6, dot.size = 0.4, relative.name = paste0("DTEG_plot", plot.ext), complex.categories = FALSE, plot_to_console = TRUE, fitType = c("parametric", "local", "mean", "glmGamPoi"), lfcShrinkType = "normal" )
df.rfp |
a |
df.rna |
a |
output.dir |
character, default |
target.contrast |
a character vector, default |
design |
a character vector, default |
p.value |
a numeric, default 0.05 in interval (0,1). Defines adjusted p-value to be used as significance threshold for the result groups. I.e. for exclusive translation group significant subset for p.value = 0.05 means: TE$padj < 0.05 & Ribo$padj < 0.05 & RNA$padj > 0.05. |
RFP_counts |
a |
RNA_counts |
a SummarizedExperiment, default: countTable(df.rna, "mrna", type = "summarized"), all transcripts. Assign a subset if you don't want to analyze all genes. It is recommended to not subset, to give DESeq2 data for variance analysis. |
batch.effect |
logical, default TRUE. Makes replicate column of the experiment
part of the design. |
pairs |
list of character pairs, the experiment contrasts. Default:
|
plot.title |
title for plots, usually name of experiment etc |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". Multiple values allowed, if so will save file in each format specified. |
width |
numeric, default 6 (in inches) |
height |
numeric, default 6 (in inches) |
dot.size |
numeric, default 0.4, size of point dots in plot. |
relative.name |
character, Default: |
complex.categories |
logical, default FALSE. Separate into more groups, see above for details. |
plot_to_console |
logical, default TRUE. Plot to console before returning, set to FALSE to save some run time. |
fitType |
either "parametric", "local", "mean", or "glmGamPoi"
for the type of fitting of dispersions to the mean intensity.
See |
lfcShrinkType |
character or NULL. Default "normal", which shrinkage to apply to results for low count gene subset. This avoids the problem of extreme fold changes, when counts are low. See lfcShrink. A note for DTEG.analysis function: The interaction term (TE), is not shrunked as this is not counts, but a ratio. |
Log fold changes and p-values are created from a Walds test on the comparison contrast described bellow.
The RNA-seq and Ribo-seq LFC values are shrunken using DESeq2::lfcShrink(type = "normal"). Note
that the TE LFC values are not shrunken, since these are ratios and not counts
(as following specifications from deltaTE paper).
The adjusted p-values are created using DESEQ pAdjustMethod = "BH" (Benjamini-Hochberg correction).
All other DESEQ2 arguments are default.
Analysis is done between each possible
combination of levels in the target contrast If target contrast is condition column,
with factor levels: WT, mut1 and mut2 with 3 replicates each. You get comparison
of WT vs mut1, WT vs mut2 and mut1 vs mut2.
The respective result categories are defined through 4 main categories, first some intuition. The number of ribosomes (Ribo-seq) is significantly different between 2 contrast elements in the model if the relative counts is statistically higher/lower, for mRNA levels (RNA-seq) it is the same. So TE is then RFP / RNA which is basically how many ribosomes translated per mRNA in the sample, if contrast group 1 has TE of 2, it means 2 ribosomes per mrna fragment, while TE of 4 would be a doubling of 4 ribosomes per mRNA.
Mathematically the groups are defined by the p adjusted values as the
following (te.sign means na_safe(te.padj < p.value),
na_safe is a function where NA values are FALSE for '<=' test
and TRUE for '>' test),
we also use a helper function:
te.sign & rfp.sign & rna.sign, all_models_sign := TRUE.
** Signicant DTEG Classifications **
No change : None of the below categories
Translation (only RFP) : te.sign & rfp.sign & !rna.sign
Expression (only RNA) : !te.sign & !rfp.sign & rna.sign
mRNA abundance : all_models_sign & na_safe(te.lfc * rna.lfc, ">", 0)
Inverse (inverse mRNA abundance) : all_models_sign & te.lfc * rna.lfc, "<", 0)
Buffering (Stable protein output) : te.sign & !rfp.sign & rna.sign
Forwarded (diagonal bottom left to top right) : !te.sign & rfp.sign & rna.sign
If complex.categories is FALSE, then Expression, Inverse and forwarded are defined 'Buffering'. mRNA abundance is called"Intensified" in original article For code, of classification, run: View(ORFik:::DTEG_add_regulation_categories). Feel free to redefine the categories as you want them.
See Figure 1 in the reference article for a clear definition of the groups!
If you do not need isoform variants, subset to longest isoform per gene
either before or in the returned object (See examples).
If you do not have RNA-seq controls, you can still use DESeq on Ribo-seq alone.
The LFC values are shrunken by lfcShrink(type = "normal").
Remember that DESeq by default can not
do global change analysis, it can only find subsets with changes in LFC!
a data.table with columns: (contrast variable, gene id, regulation status, log fold changes, p.adjust values, mean counts, significant (as logical))
https://doi.org/10.1002/cpmb.108
Other DifferentialExpression:
DEG.plot.static(),
DEG_model(),
DTEG.plot(),
te.table(),
te_rna.plot()
## Simple example (use ORFik template, then split on Ribo and RNA) df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] design(df.rfp) # The experimental design, per libtype design(df.rfp)[1] # Default target contrast #dt <- DTEG.analysis(df.rfp, df.rna) #dt_with_gene_ids <- append_gene_symbols(dt, symbols(df)) ## If you want to use the pshifted libs for analysis: #dt <- DTEG.analysis(df.rfp, df.rna, # RFP_counts = countTable(df.rfp, region = "cds", # type = "summarized", count.folder = "pshifted")) ## Restrict DTEGs by log fold change (LFC): ## subset to abs(LFC) < 1.5 for both rfp and rna #dt[abs(rfp) < 1.5 & abs(rna) < 1.5, Regulation := "No change"] ## Only longest isoform per gene: #tx_longest <- filterTranscripts(df.rfp, 0, 1, 0) #dt <- dt[id %in% tx_longest,] ## Convert to gene id #dt[, id := txNamesToGeneNames(id, df.rfp)] ## To get by gene symbol, use biomaRt conversion ## To flip directionality of contrast pair nr 2: #design <- "condition" #pairs <- combn.pairs(unlist(df.rfp[, design]) #pairs[[2]] <- rev(pars[[2]]) #dt <- DTEG.analysis(df.rfp, df.rna, # RFP_counts = countTable(df.rfp, region = "cds", # type = "summarized", count.folder = "pshifted"), # pairs = pairs)## Simple example (use ORFik template, then split on Ribo and RNA) df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] design(df.rfp) # The experimental design, per libtype design(df.rfp)[1] # Default target contrast #dt <- DTEG.analysis(df.rfp, df.rna) #dt_with_gene_ids <- append_gene_symbols(dt, symbols(df)) ## If you want to use the pshifted libs for analysis: #dt <- DTEG.analysis(df.rfp, df.rna, # RFP_counts = countTable(df.rfp, region = "cds", # type = "summarized", count.folder = "pshifted")) ## Restrict DTEGs by log fold change (LFC): ## subset to abs(LFC) < 1.5 for both rfp and rna #dt[abs(rfp) < 1.5 & abs(rna) < 1.5, Regulation := "No change"] ## Only longest isoform per gene: #tx_longest <- filterTranscripts(df.rfp, 0, 1, 0) #dt <- dt[id %in% tx_longest,] ## Convert to gene id #dt[, id := txNamesToGeneNames(id, df.rfp)] ## To get by gene symbol, use biomaRt conversion ## To flip directionality of contrast pair nr 2: #design <- "condition" #pairs <- combn.pairs(unlist(df.rfp[, design]) #pairs[[2]] <- rev(pars[[2]]) #dt <- DTEG.analysis(df.rfp, df.rna, # RFP_counts = countTable(df.rfp, region = "cds", # type = "summarized", count.folder = "pshifted"), # pairs = pairs)
For explanation of plot catagories, see DTEG.analysis
DTEG.plot( dt, output.dir = NULL, p.value.label = ifelse(!is.null(attr(dt, "p.value")), attr(dt, "p.value"), 0.05), plot.title = "", plot.ext = ".pdf", width = 6, height = 6, dpi = 300, dot.size = 0.4, xlim = "bidir.max", ylim = "bidir.max", relative.name = paste0("DTEG_plot", plot.ext), plot_to_console = TRUE )DTEG.plot( dt, output.dir = NULL, p.value.label = ifelse(!is.null(attr(dt, "p.value")), attr(dt, "p.value"), 0.05), plot.title = "", plot.ext = ".pdf", width = 6, height = 6, dpi = 300, dot.size = 0.4, xlim = "bidir.max", ylim = "bidir.max", relative.name = paste0("DTEG_plot", plot.ext), plot_to_console = TRUE )
dt |
a data.table with the results from |
output.dir |
a character path, default NULL(no save), or a directory to save to a file. Relative name of file, specified by 'relative.name' argument. |
p.value.label |
a numeric, default ifelse(!is.null(attr(dt, "p.value")), attr(dt, "p.value"), 0.05) Interval (0,1), use"" to not show. What p-value used for the analysis? Will be shown as a caption. |
plot.title |
title for plots, usually name of experiment etc |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". Multiple values allowed, if so will save file in each format specified. |
width |
numeric, default 6 (in inches) |
height |
numeric, default 6 (in inches) |
dpi |
numeric, default 300. |
dot.size |
numeric, default 0.4, size of point dots in plot. |
xlim |
numeric vector or character preset, default: "bidir.max" (Equal in both + / - direction, using max value + 0.5 of rna column in dt). If you want ggplot to decide limit, set to "auto". For numeric vector, specify min and max x limit: like c(-5, 5) |
ylim |
numeric vector or character preset, default: "bidir.max" (Equal in both + / - direction, using max value + 0.5 of rfp column in dt). If you want ggplot to decide limit, set to "auto". For numeric vector, specify min and max y limit: like c(-10, 10) |
relative.name |
character, Default: |
plot_to_console |
logical, default TRUE. Plot to console before returning, set to FALSE to save some run time. |
a ggplot object, will facet_wrap if length(unique(dt$contrasts)) > 1
Other DifferentialExpression:
DEG.plot.static(),
DEG_model(),
DTEG.analysis(),
te.table(),
te_rna.plot()
df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] #dt <- DTEG.analysis(df.rfp, df.rna) #Default scaling #DTEG.plot(dt) #Manual scaling #DTEG.plot(dt, xlim = c(-2, 2), ylim = c(-2, 2))df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] #dt <- DTEG.analysis(df.rfp, df.rna) #Default scaling #DTEG.plot(dt) #Manual scaling #DTEG.plot(dt, xlim = c(-2, 2), ylim = c(-2, 2))
Faster version than S4Vector generic caller
## S4 method for signature 'GRanges' end(x)## S4 method for signature 'GRanges' end(x)
x |
a GRanges |
an integer (length equal to x)
Calculates percentage of maximum entropy of the 'reads'
coverage over each ORF in 'grl' group.
The entropy value per group is a real number in the interval (0:1),
where 0 indicates no variance in reads over all codons of group
For example c(0,0,0,0) has 0 entropy, since no reads overlap.
Interval: [0]: No reads or all reads in 1 place
Interval: [0.01-0.99]: >= 2 positions covered
Interval: [1]: all positions covered perfectly in frame
entropy(grl, reads, weight = 1L, is.sorted = FALSE, overlapGrl = NULL)entropy(grl, reads, weight = 1L, is.sorted = FALSE, overlapGrl = NULL)
grl |
a |
reads |
a |
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
is.sorted |
logical (FALSE), is grl sorted. That is + strand groups in increasing ranges (1,2,3), and - strand groups in decreasing ranges (3,2,1) |
overlapGrl |
an integer, (default: NULL), if defined must be countOverlaps(grl, RFP), added for speed if you already have it. |
A numeric vector containing one entropy value per element in 'grl'
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# a toy example with ribo-seq p-shifted reads ORF <- GRangesList(tx1 = GRanges("1", IRanges(1, width = 9), "+")) entropy(ORF, GRanges()) # 0 entropy(ORF, GRanges("1", IRanges(c(1)), "+")) # 0 entropy(ORF, GRanges("1", IRanges(c(1,4,6,7)), "+")) # 0.94 entropy(ORF, GRanges("1", IRanges(c(1,4,7)), "+", score = c(1,2,1)), weight = "score") # 0.94 entropy(ORF, GRanges("1", IRanges(c(1,4,7)), "+")) # Perfect = 1# a toy example with ribo-seq p-shifted reads ORF <- GRangesList(tx1 = GRanges("1", IRanges(1, width = 9), "+")) entropy(ORF, GRanges()) # 0 entropy(ORF, GRanges("1", IRanges(c(1)), "+")) # 0 entropy(ORF, GRanges("1", IRanges(c(1,4,6,7)), "+")) # 0.94 entropy(ORF, GRanges("1", IRanges(c(1,4,7)), "+", score = c(1,2,1)), weight = "score") # 0.94 entropy(ORF, GRanges("1", IRanges(c(1,4,7)), "+")) # Perfect = 1
More correctly, get the pointer reference, default is .GlobalEnv
envExp(x)envExp(x)
x |
an ORFik |
environment pointer, name of environment: pointer
More correctly, get the pointer reference, default is .GlobalEnv
## S4 method for signature 'experiment' envExp(x)## S4 method for signature 'experiment' envExp(x)
x |
an ORFik |
environment pointer, name of environment: pointer
More correctly, set the pointer reference, default is .GlobalEnv
envExp(x) <- valueenvExp(x) <- value
x |
an ORFik |
value |
environment pointer to assign to experiment |
an ORFik experiment with updated environment
More correctly, set the pointer reference, default is .GlobalEnv
## S4 replacement method for signature 'experiment' envExp(x) <- value## S4 replacement method for signature 'experiment' envExp(x) <- value
x |
an ORFik |
value |
environment pointer to assign to experiment |
an ORFik experiment with updated environment
If an intron is of length < 'width' * 2, it will not be split into pseudo.
exonsWithPseudoIntronsPerGroup(grl, width = 100)exonsWithPseudoIntronsPerGroup(grl, width = 100)
grl |
a GrangesList of length 1 |
width |
numeric, default 100. The size of pseudo flanks. |
a GRangesList
tx <- GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")) exonsWithPseudoIntronsPerGroup(tx) # See intron 1 is not split tx_2 <- rep(GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")), 2) exonsWithPseudoIntronsPerGroup(tx_2) tx_3 <- tx_2 names(tx_3) <- c("tx1", "tx2") exonsWithPseudoIntronsPerGroup(tx_3, 1e6)tx <- GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")) exonsWithPseudoIntronsPerGroup(tx) # See intron 1 is not split tx_2 <- rep(GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")), 2) exonsWithPseudoIntronsPerGroup(tx_2) tx_3 <- tx_2 names(tx_3) <- c("tx1", "tx2") exonsWithPseudoIntronsPerGroup(tx_3, 1e6)
It is an object that simplify and error correct your NGS workflow,
creating a single R object that stores and controls all results relevant
to a specific experiment.
It contains following important parts:
filepaths: Information for each library in the experiment (for multiple file formats: bam, bed, wig, ofst, etc.)
genome: Annotation files for the experiment (fasta genome, index, gtf, txdb)
organism: Name (for automatic GO, sequence analysis, etc.)
description: Author information and experiment details (use 'list.experiments()' to show all experiments made with ORFik; this makes it easy to find and load them later)
API: ORFik supports a rich API for using the experiment, e.g., 'outputLibs(experiment, type = "wig")' to load all libraries in the wig format into R, 'loadTxdb(experiment)' to load the txdb (gtf) of the experiment, 'transcriptWindow()' to plot metacoverage for all libraries, and 'countTable(experiment)' to load count tables, etc.
Safety: Verifies that experiments contain no duplicate, empty, or non-accessible files.
Act as a way of extension of SummarizedExperiment by allowing
more ease to find not only counts, but rather
information about libraries, and annotation, so that more tasks are
possible. Like coverage per position in some transcript etc.
## Constructor:
Simplest way to make is to call:
create.experiment(dir)
On some folder with NGS libraries (usually bam files) and see what you get.
Some of the fields
might be needed to fill in manually. Each resulting row must be unique
(not including filepath, they are always unique), that means
if it has replicates then that must be said explicit. And all
filepaths must be unique and have files with size > 0.
Here all the columns in the experiment will be described:
name (column info): examples
filepaths: Information for each library in the experiment (for multiple file formats: bam, bed, wig, ofst, etc.)
genome: Annotation files for the experiment (fasta genome, index, gtf, txdb)
organism: Name (for automatic GO, sequence analysis, etc.)
description: Author information and experiment details (use 'list.experiments()' to show all experiments made with ORFik; this makes it easy to find and load them later)
API: ORFik supports a rich API for using the experiment, e.g., 'outputLibs(experiment, type = "wig")' to load all libraries in the wig format into R, 'loadTxdb(experiment)' to load the txdb (gtf) of the experiment, 'transcriptWindow()' to plot metacoverage for all libraries, and 'countTable(experiment)' to load count tables, etc.
Safety: Verifies that experiments contain no duplicate, empty, or non-accessible files.
Special rules:
Supported:
Single/paired end bam, bed, wig, ofst + compressions of these
The reverse column of the experiments says "paired-end" if bam file.
If a pair of wig files, forward and reverse strand, reverse is filepath
to '-' strand wig file.
Paired forward / reverse wig files, must have same name except
_forward / _reverse in name
Paired end bam, when creating experiment, set pairedEndBam = c(T, T, T, F).
For 3 paired end libraries, then one single end.
Naming:
Will try to guess naming for tissues / stages, replicates etc.
If it finds more than one hit for one file, it will not guess.
Always check that it guessed correctly.
a ORFik experiment
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
## To see an internal ORFik example df <- ORFik.template.experiment() ## See libraries in experiment df ## See organism of experiment organism(df) ## See file paths in experiment filepath(df, "default") ## Output NGS libraries in R, to .GlobalEnv #outputLibs(df) ## Output cds of experiment annotation #loadRegion(df, "cds") ## This is how to make it: ## Not run: library(ORFik) # 1. Update path to experiment data directory (bam, bed, wig files etc) exp_dir = "/data/processed_data/RNA-seq/Lee_zebrafish_2013/aligned/" # 2. Set a short character name for experiment, (Lee et al 2013 -> Lee13, etc) exper_name = "Lee13" # 3. Create a template experiment (gtf and fasta genome) temp <- create.experiment(exp_dir, exper_name, saveDir = NULL, txdb = "/data/references/Zv9_zebrafish/Danio_rerio.Zv9.79.gtf", fa = "/data/references/Zv9_zebrafish/Danio_rerio.Zv9.fa", organism = "Homo sapiens") # 4. Make sure each row(sample) is unique and correct # You will get a view open now, check the data.frame that it is correct: # library type (RNA-seq, Ribo-seq), stage, rep, condition, fraction. # Let say it did not figure out it is RNA-seq, then we do:" temp[5:6, 1] <- "RNA" # [row 5 and 6, col 1] are library types # You can also do this in your spread sheet program (excel, libre office) # Now save new version, if you did not use spread sheet. saveName <- paste0("/data/processed_data/experiment_tables_for_R/", exper_name,".csv") save.experiment(temp, saveName) # 5. Load experiment, this will validate that you actually made it correct df <- read.experiment(saveName) # Set experiment name not to be assigned in R variable names df@expInVarName <- FALSE df ## End(Not run)## To see an internal ORFik example df <- ORFik.template.experiment() ## See libraries in experiment df ## See organism of experiment organism(df) ## See file paths in experiment filepath(df, "default") ## Output NGS libraries in R, to .GlobalEnv #outputLibs(df) ## Output cds of experiment annotation #loadRegion(df, "cds") ## This is how to make it: ## Not run: library(ORFik) # 1. Update path to experiment data directory (bam, bed, wig files etc) exp_dir = "/data/processed_data/RNA-seq/Lee_zebrafish_2013/aligned/" # 2. Set a short character name for experiment, (Lee et al 2013 -> Lee13, etc) exper_name = "Lee13" # 3. Create a template experiment (gtf and fasta genome) temp <- create.experiment(exp_dir, exper_name, saveDir = NULL, txdb = "/data/references/Zv9_zebrafish/Danio_rerio.Zv9.79.gtf", fa = "/data/references/Zv9_zebrafish/Danio_rerio.Zv9.fa", organism = "Homo sapiens") # 4. Make sure each row(sample) is unique and correct # You will get a view open now, check the data.frame that it is correct: # library type (RNA-seq, Ribo-seq), stage, rep, condition, fraction. # Let say it did not figure out it is RNA-seq, then we do:" temp[5:6, 1] <- "RNA" # [row 5 and 6, col 1] are library types # You can also do this in your spread sheet program (excel, libre office) # Now save new version, if you did not use spread sheet. saveName <- paste0("/data/processed_data/experiment_tables_for_R/", exper_name,".csv") save.experiment(temp, saveName) # 5. Load experiment, this will validate that you actually made it correct df <- read.experiment(saveName) # Set experiment name not to be assigned in R variable names df@expInVarName <- FALSE df ## End(Not run)
Pick the grouping wanted for colors, by default only group by libtype. Like RNA-seq(skyblue4) and Ribo-seq(orange).
experiment.colors( df, color_list = "default", skip.libtype = FALSE, skip.stage = TRUE, skip.replicate = TRUE, skip.fraction = TRUE, skip.condition = TRUE )experiment.colors( df, color_list = "default", skip.libtype = FALSE, skip.stage = TRUE, skip.replicate = TRUE, skip.fraction = TRUE, skip.condition = TRUE )
df |
an ORFik |
color_list |
a character vector of colors, default "default". That is the vector c("skyblue4", 'orange', "green", "red", "gray", "yellow", "blue", "red2", "orange3"). Picks number of colors needed to make groupings have unique color |
skip.libtype |
a logical (FALSE), don't include libtype |
skip.stage |
a logical (FALSE), don't include stage in variable name. |
skip.replicate |
a logical (FALSE), don't include replicate in variable name. |
skip.fraction |
a logical (FALSE), don't include fraction |
skip.condition |
a logical (FALSE), don't include condition in variable name. |
a character vector of colors
bed format for multiple exons per group, as transcripts. Can be use as alternative as a sparse .gff format for ORFs. Can be direct input for ucsc browser or IGV
export.bed12(grl, file, rgb = 0)export.bed12(grl, file, rgb = 0)
grl |
A GRangesList |
file |
a character path to valid output file name |
rgb |
integer vector, default (0), maximum (255), either single integer or vector of same size as grl to specify groups. It is adviced to not use more than 8 different groups. (In IGV / UCSC 0 is black and 255 is blue) |
If grl has no names, groups will be named 1,2,3,4..
invisible(NULL) (File is saved only)
https://bedtools.readthedocs.io/en/latest/content/general-usage.html#bed-format
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
grl <- GRangesList(GRanges("1", c(1,3,5), "+"))grl <- GRangesList(GRanges("1", c(1,3,5), "+"))
.bedo is .bed ORFik, an optimized bed format for coverage reads with
read lengths .bedo is a text based format with columns (6 maximum):
1. chromosome
2. start
3. end
4. strand
5. ref width (cigar # M's, match/mismatch total)
6. duplicates of that read
export.bedo(object, out)export.bedo(object, out)
object |
a GRanges object |
out |
a character, location on disc (full path) |
Positions are 1-based, not 0-based as .bed. End will be removed if all ends equals all starts. Import with import.bedo
NULL, object saved to disc
A fast way to store, load and use bam files.
(we now recommend using link{export.ofst} instead!)
.bedoc is .bed ORFik, an optimized bed format for coverage reads with
cigar and replicate number.
.bedoc is a text based format with columns (5 maximum):
1. chromosome
2. cigar: (cigar # M's, match/mismatch total)
3. start (left most position)
4. strand (+, -, *)
5. score: duplicates of that read
export.bedoc(object, out)export.bedoc(object, out)
object |
a GAlignments object |
out |
a character, location on disc (full path) |
Positions are 1-based, not 0-based as .bed. Import with import.bedoc
NULL, object saved to disc
Will create 2 files, 1 for + strand (*_forward.bigWig) and 1 for - strand (*_reverse.bigWig). If all ranges are * stranded, will output 1 file. Can be direct input for ucsc browser or IGV
export.bigWig( x, file, split.by.strand = TRUE, is_pre_collapsed = FALSE, seq_info = seqinfo(x) )export.bigWig( x, file, split.by.strand = TRUE, is_pre_collapsed = FALSE, seq_info = seqinfo(x) )
x |
A GRangesList, GAlignment GAlignmentPairs with score column. Will be converted to 5' end position of original range. If score column does not exist, will group ranges and give replicates as score column. Since bigWig needs a score column to represent counts! |
file |
a character path to valid output file name |
split.by.strand |
logical, default TRUE. Split bigWig into 2 files, one for each strand. |
is_pre_collapsed |
logical, default FALSE. Have you already collapsed reads with collapse.by.scores, so each positions is only in 1 GRanges object with a score column per readlength? Set to TRUE, only if you are sure, will give a speedup. |
seq_info |
a Seqinfo object, default seqinfo(x). Must have non NA seqlengths defined! |
invisible(NULL) (File is saved as 2 .bigWig files)
https://genome.ucsc.edu/goldenPath/help/bigWig.html
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
x <- c(GRanges("1", c(1,3,5), "-"), GRanges("1", c(1,3,5), "+")) seqlengths(x) <- 10 file <- file.path(tempdir(), "rna.bigWig") # export.bigWig(x, file) # export.bigWig(covRleFromGR(x), file)x <- c(GRanges("1", c(1,3,5), "-"), GRanges("1", c(1,3,5), "+")) seqlengths(x) <- 10 file <- file.path(tempdir(), "rna.bigWig") # export.bigWig(x, file) # export.bigWig(covRleFromGR(x), file)
Will create 2 files, 1 for + strand (*_forward.fstwig) and 1 for - strand (*_reverse.fstwig). If all ranges are * stranded, will output 1 file.
export.fstwig( x, file, by.readlength = TRUE, by.chromosome = TRUE, compress = 50 )export.fstwig( x, file, by.readlength = TRUE, by.chromosome = TRUE, compress = 50 )
x |
A GRangesList, GAlignment GAlignmentPairs with score column or coverage RLElist Will be converted to 5' end position of original range. If score column does not exist, will group ranges and give replicates as score column. |
file |
a character path to valid output file name |
by.readlength |
logical, default TRUE |
by.chromosome |
logical, default TRUE |
compress |
value in the range 0 to 100, indicating the amount of compression to use. Lower values mean larger file sizes. The default compression is set to 50. |
invisible(NULL) (File is saved as 2 .fstwig files)
"TODO"
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
x <- c(GRanges("1", c(1,3,5), "-"), GRanges("1", c(1,3,5), "+")) x$size <- rep(c(28, 29), length.out = length(x)) x$score <- c(5,1,2,5,1,6) seqlengths(x) <- 5 # export.fstwig(x, "~/Desktop/ribo")x <- c(GRanges("1", c(1,3,5), "-"), GRanges("1", c(1,3,5), "+")) x$size <- rep(c(28, 29), length.out = length(x)) x$score <- c(5,1,2,5,1,6) seqlengths(x) <- 5 # export.fstwig(x, "~/Desktop/ribo")
A much faster way to store, load and use bam files.
.ofst is ORFik fast serialized object,
an optimized format for coverage reads with
cigar and replicate number. It uses the fst format as back-end:
fst-package.
A .ofst ribo seq file can compress the
information in a bam file from 5GB down to a few MB. This new files has
super fast reading time, only a few seconds, instead of minutes. It also has
random index access possibility of the file.
.ofst is represented as a data.frane format with minimum 4 columns:
1. chromosome
2. start (left most position)
3. strand (+, -, *)
4. width (not added if cigar exists)
5. cigar (not needed if width exists):
(cigar # M's, match/mismatch total)
5. score: duplicates of that read
6. size: qwidth according to reference of read
If file is from GAlignmentPairs, it will contain a cigar1, cigar2 instead
of cigar and start1 and start2 instead of start
export.ofst(x, file, ...)export.ofst(x, file, ...)
x |
a GRanges, GAlignments or GAlignmentPairs object |
file |
a character, location on disc (full path) |
... |
additional arguments for write_fst |
Other columns can be named whatever you want and added to meta columns. Positions are 1-based, not 0-based as .bed. Import with import.ofst
NULL, object saved to disc
tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)
A much faster way to store, load and use bam files.
.ofst is ORFik fast serialized object,
an optimized format for coverage reads with
cigar and replicate number. It uses the fst format as back-end:
fst-package.
A .ofst ribo seq file can compress the
information in a bam file from 5GB down to a few MB. This new files has
super fast reading time, only a few seconds, instead of minutes. It also has
random index access possibility of the file.
.ofst is represented as a data.frane format with minimum 4 columns:
1. chromosome
2. start (left most position)
3. strand (+, -, *)
4. width (not added if cigar exists)
5. cigar (not needed if width exists):
(cigar # M's, match/mismatch total)
5. score: duplicates of that read
6. size: qwidth according to reference of read
If file is from GAlignmentPairs, it will contain a cigar1, cigar2 instead
of cigar and start1 and start2 instead of start
## S4 method for signature 'data.frame' export.ofst(x, file, NAMES = NULL, elementMetadata = DataFrame(), ...)## S4 method for signature 'data.frame' export.ofst(x, file, NAMES = NULL, elementMetadata = DataFrame(), ...)
x |
a GRanges, GAlignments or GAlignmentPairs object |
file |
a character, location on disc (full path) |
NAMES |
character, default NULL. Names of ranges. |
elementMetadata |
DataFrame, default DataFrame(). Metadata of ranges. |
... |
additional arguments for write_fst |
Other columns can be named whatever you want and added to meta columns. Positions are 1-based, not 0-based as .bed. Import with import.ofst
NULL, object saved to disc
tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)
A much faster way to store, load and use bam files.
.ofst is ORFik fast serialized object,
an optimized format for coverage reads with
cigar and replicate number. It uses the fst format as back-end:
fst-package.
A .ofst ribo seq file can compress the
information in a bam file from 5GB down to a few MB. This new files has
super fast reading time, only a few seconds, instead of minutes. It also has
random index access possibility of the file.
.ofst is represented as a data.frane format with minimum 4 columns:
1. chromosome
2. start (left most position)
3. strand (+, -, *)
4. width (not added if cigar exists)
5. cigar (not needed if width exists):
(cigar # M's, match/mismatch total)
5. score: duplicates of that read
6. size: qwidth according to reference of read
If file is from GAlignmentPairs, it will contain a cigar1, cigar2 instead
of cigar and start1 and start2 instead of start
## S4 method for signature 'GAlignmentPairs' export.ofst(x, file, ...)## S4 method for signature 'GAlignmentPairs' export.ofst(x, file, ...)
x |
a GRanges, GAlignments or GAlignmentPairs object |
file |
a character, location on disc (full path) |
... |
additional arguments for write_fst |
Other columns can be named whatever you want and added to meta columns. Positions are 1-based, not 0-based as .bed. Import with import.ofst
NULL, object saved to disc
tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)
A much faster way to store, load and use bam files.
.ofst is ORFik fast serialized object,
an optimized format for coverage reads with
cigar and replicate number. It uses the fst format as back-end:
fst-package.
A .ofst ribo seq file can compress the
information in a bam file from 5GB down to a few MB. This new files has
super fast reading time, only a few seconds, instead of minutes. It also has
random index access possibility of the file.
.ofst is represented as a data.frane format with minimum 4 columns:
1. chromosome
2. start (left most position)
3. strand (+, -, *)
4. width (not added if cigar exists)
5. cigar (not needed if width exists):
(cigar # M's, match/mismatch total)
5. score: duplicates of that read
6. size: qwidth according to reference of read
If file is from GAlignmentPairs, it will contain a cigar1, cigar2 instead
of cigar and start1 and start2 instead of start
## S4 method for signature 'GAlignments' export.ofst(x, file, ...)## S4 method for signature 'GAlignments' export.ofst(x, file, ...)
x |
a GRanges, GAlignments or GAlignmentPairs object |
file |
a character, location on disc (full path) |
... |
additional arguments for write_fst |
Other columns can be named whatever you want and added to meta columns. Positions are 1-based, not 0-based as .bed. Import with import.ofst
NULL, object saved to disc
tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)
A much faster way to store, load and use bam files.
.ofst is ORFik fast serialized object,
an optimized format for coverage reads with
cigar and replicate number. It uses the fst format as back-end:
fst-package.
A .ofst ribo seq file can compress the
information in a bam file from 5GB down to a few MB. This new files has
super fast reading time, only a few seconds, instead of minutes. It also has
random index access possibility of the file.
.ofst is represented as a data.frane format with minimum 4 columns:
1. chromosome
2. start (left most position)
3. strand (+, -, *)
4. width (not added if cigar exists)
5. cigar (not needed if width exists):
(cigar # M's, match/mismatch total)
5. score: duplicates of that read
6. size: qwidth according to reference of read
If file is from GAlignmentPairs, it will contain a cigar1, cigar2 instead
of cigar and start1 and start2 instead of start
## S4 method for signature 'GRanges' export.ofst(x, file, ...)## S4 method for signature 'GRanges' export.ofst(x, file, ...)
x |
a GRanges, GAlignments or GAlignmentPairs object |
file |
a character, location on disc (full path) |
... |
additional arguments for write_fst |
Other columns can be named whatever you want and added to meta columns. Positions are 1-based, not 0-based as .bed. Import with import.ofst
NULL, object saved to disc
tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)tempfile <- tempfile(fileext = ".ofst") ## GRanges gr <- GRanges("1:1-3:-") export.ofst(gr, file = tempfile) identical(gr, fimport(tempfile)) # Save from data.frame of GAlignment columns df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") export.ofst(df, tempfile) res <- fimport(tempfile) # Imports as GAlignments because you have cigar res # Save from GAlignments ga <- ORFik:::getGAlignments(df) export.ofst(ga, tempfile) res2 <- fimport(tempfile) identical(res, res2) # Save from GAlignmentsPair ga_rev <- ga strand(ga_rev) <- "-" ga2 <- GAlignmentPairs(ga, ga_rev) export.ofst(ga2, tempfile) res3 <- fimport(tempfile) identical(ga2, res3)
Will create 2 files, 1 for + strand (*_forward.wig) and 1 for - strand (*_reverse.wig). If all ranges are * stranded, will output 1 file. Can be direct input for ucsc browser or IGV
export.wiggle(x, file)export.wiggle(x, file)
x |
A GRangesList, GAlignment GAlignmentPairs with score column. Will be converted to 5' end position of original range. If score column does not exist, will group ranges and give replicates as score column. |
file |
a character path to valid output file name |
invisible(NULL) (File is saved as 2 .wig files)
https://genome.ucsc.edu/goldenPath/help/wiggle.html
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
x <- c(GRanges("1", c(1,3,5), "-"), GRanges("1", c(1,3,5), "+")) # export.wiggle(x, "output/path/rna.wig")x <- c(GRanges("1", c(1,3,5), "-"), GRanges("1", c(1,3,5), "+")) # export.wiggle(x, "output/path/rna.wig")
Will extend the leaders or transcripts upstream (5' end) by extension.
The extension is general not relative, that means splicing
will not be taken into account.
Requires the grl to be sorted beforehand,
use sortPerGroup to get sorted grl.
extendLeaders( grl, extension = 1000L, cds = NULL, is.circular = all(isCircular(grl) %in% TRUE) )extendLeaders( grl, extension = 1000L, cds = NULL, is.circular = all(isCircular(grl) %in% TRUE) )
grl |
usually a |
extension |
an integer, how much to max extend upstream (5' end). Either single value that will apply for all, or same as length of grl which will give 1 update value per grl object. Or a GRangesList where start / stops by strand are the positions to use as new starts. Will not cross the chromosome boundary for non circular chromosomes. |
cds |
a |
is.circular |
logical, default FALSE if not any is: all(isCircular(grl) Where grl is the ranges checked. If TRUE, allow ranges to extend below position 1 on chromosome. Since circular genomes can have negative coordinates. |
an extended GRangeslist
Other ExtendGenomicRanges:
asTX(),
coveragePerTiling(),
extendTrailers(),
reduceKeepAttr(),
tile1(),
txSeqsFromFa(),
windowPerGroup()
library(GenomicFeatures) samplefile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadDb(samplefile) fiveUTRs <- fiveUTRsByTranscript(txdb, use.names = TRUE) # <- extract only 5' leaders tx <- exonsBy(txdb, by = "tx", use.names = TRUE) cds <- cdsBy(txdb,"tx",use.names = TRUE) ## extend leaders upstream 1000 extendLeaders(fiveUTRs, extension = 1000) ## now try(extend upstream 1000, add all cds exons): extendLeaders(fiveUTRs, extension = 1000, cds) ## when extending transcripts, don't include cds' of course, ## since they are already there extendLeaders(tx, extension = 1000) ## Circular genome (allow negative coordinates) circular_fives <- fiveUTRs isCircular(circular_fives) <- rep(TRUE, length(isCircular(circular_fives))) extendLeaders(circular_fives, extension = 32672841L)library(GenomicFeatures) samplefile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadDb(samplefile) fiveUTRs <- fiveUTRsByTranscript(txdb, use.names = TRUE) # <- extract only 5' leaders tx <- exonsBy(txdb, by = "tx", use.names = TRUE) cds <- cdsBy(txdb,"tx",use.names = TRUE) ## extend leaders upstream 1000 extendLeaders(fiveUTRs, extension = 1000) ## now try(extend upstream 1000, add all cds exons): extendLeaders(fiveUTRs, extension = 1000, cds) ## when extending transcripts, don't include cds' of course, ## since they are already there extendLeaders(tx, extension = 1000) ## Circular genome (allow negative coordinates) circular_fives <- fiveUTRs isCircular(circular_fives) <- rep(TRUE, length(isCircular(circular_fives))) extendLeaders(circular_fives, extension = 32672841L)
Extend leaders until a restriction group / position. This makes you extend until you hit another gene boundary etc.
extendLeadersUntil( grl, grl2 = grl, extension = 500, until = 200, min_ext = 25, is.circular = all(isCircular(grl) %in% TRUE), ... )extendLeadersUntil( grl, grl2 = grl, extension = 500, until = 200, min_ext = 25, is.circular = all(isCircular(grl) %in% TRUE), ... )
grl |
a GRangesList |
grl2 |
a GRangesList, default 'grl'. The list that defines restrictions on extension. Can also be another set, which is used as 'roadblocks' for extension. |
extension |
an integer, how much to max extend upstream (5' end). Either single value that will apply for all, or same as length of grl which will give 1 update value per grl object. Or a GRangesList where start / stops by strand are the positions to use as new starts. Will not cross the chromosome boundary for non circular chromosomes. |
until |
numeric, default 200. The nearest you can go to the neighbour boundaries of grl2 (the "other" genes). Defined as boundary hit + 1, so if hit other gene with distance 22, and 'until' argument is 2, will set final extension to 22-2-1 = 19. Usually if Leaders/trailers are not defined, this makes a good pseudo leader boundary around your other genes. |
min_ext |
numeric, default 25. What is the minimum extension, even though it crosses a boundary. Will not cross the chromosome boundary for non circular chromosomes. |
is.circular |
logical, default FALSE if not any is: all(isCircular(grl) Where grl is the ranges checked. If TRUE, allow ranges to extend below position 1 on chromosome. Since circular genomes can have negative coordinates. |
... |
Arguments sent to distanceToPreceding |
a GRangesList of extended grl input
grl <- GRangesList(tx1 = GRanges("1", IRanges(c(10, 15), c(13, 20)), "+"), tx2 = GRanges("1", IRanges(30, 50), "+")) extendLeadersUntil(grl, min_ext = 5) extendLeadersUntil(grl, min_ext = 5, until = 1) extendLeadersUntil(grl, min_ext = 5, until = 1) extendLeadersUntil(grl, min_ext = 5, until = 1, extension = 4)grl <- GRangesList(tx1 = GRanges("1", IRanges(c(10, 15), c(13, 20)), "+"), tx2 = GRanges("1", IRanges(30, 50), "+")) extendLeadersUntil(grl, min_ext = 5) extendLeadersUntil(grl, min_ext = 5, until = 1) extendLeadersUntil(grl, min_ext = 5, until = 1) extendLeadersUntil(grl, min_ext = 5, until = 1, extension = 4)
Will extend the trailers or transcripts downstream (3' end) by extension.
The extension is general not relative, that means splicing
will not be taken into account.
Requires the grl to be sorted beforehand,
use sortPerGroup to get sorted grl.
extendTrailers( grl, extension = 1000L, is.circular = all(isCircular(grl) %in% TRUE) )extendTrailers( grl, extension = 1000L, is.circular = all(isCircular(grl) %in% TRUE) )
grl |
usually a |
extension |
an integer, how much to max extend downstream (3' end). Either single value that will apply for all, or same as length of grl which will give 1 update value per grl object. Or a GRangesList where start / stops sites by strand are the positions to use as new starts. Will not cross the chromosome boundary for non circular chromosomes. |
is.circular |
logical, default FALSE if not any is: all(isCircular(grl) Where grl is the ranges checked. If TRUE, allow ranges to extend below position 1 on chromosome. Since circular genomes can have negative coordinates. |
an extended GRangeslist
Other ExtendGenomicRanges:
asTX(),
coveragePerTiling(),
extendLeaders(),
reduceKeepAttr(),
tile1(),
txSeqsFromFa(),
windowPerGroup()
library(GenomicFeatures) samplefile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadDb(samplefile) threeUTRs <- threeUTRsByTranscript(txdb) # <- extract only 5' leaders tx <- exonsBy(txdb, by = "tx", use.names = TRUE) ## now try(extend downstream 1000): extendTrailers(threeUTRs, extension = 1000) ## Or on transcripts extendTrailers(tx, extension = 1000) ## Circular genome (allow negative coordinates) circular_three <- threeUTRs isCircular(circular_three) <- rep(TRUE, length(isCircular(circular_three))) extendTrailers(circular_three, extension = 126200008L)[41] # <- negative stop coordinatelibrary(GenomicFeatures) samplefile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadDb(samplefile) threeUTRs <- threeUTRsByTranscript(txdb) # <- extract only 5' leaders tx <- exonsBy(txdb, by = "tx", use.names = TRUE) ## now try(extend downstream 1000): extendTrailers(threeUTRs, extension = 1000) ## Or on transcripts extendTrailers(tx, extension = 1000) ## Circular genome (allow negative coordinates) circular_three <- threeUTRs isCircular(circular_three) <- rep(TRUE, length(isCircular(circular_three))) extendTrailers(circular_three, extension = 126200008L)[41] # <- negative stop coordinate
Extend trailers until a restriction group / position. This makes you extend until you hit another gene boundary etc.
extendTrailersUntil( grl, grl2 = grl, extension = 500, until = 200, min_ext = 25, is.circular = all(isCircular(grl) %in% TRUE), ... )extendTrailersUntil( grl, grl2 = grl, extension = 500, until = 200, min_ext = 25, is.circular = all(isCircular(grl) %in% TRUE), ... )
grl |
a GRangesList |
grl2 |
a GRangesList, default 'grl'. The list that defines restrictions on extension. Can also be another set, which is used as 'roadblocks' for extension. |
extension |
an integer, how much to max extend downstream (3' end). Either single value that will apply for all, or same as length of grl which will give 1 update value per grl object. Or a GRangesList where start / stops sites by strand are the positions to use as new starts. Will not cross the chromosome boundary for non circular chromosomes. |
until |
numeric, default 200. The nearest you can go to the boundary. #' Defined as boundary hit + 1, so if hit on 22, and until is 2, will set to 22+2+1 = 25. Usually if Leaders/trailers are not defined, this makes a good pseudo leader boundary around your other genes. |
min_ext |
numeric, default 25. What is the minimum extension, even though it crosses a boundary. Will not cross the chromosome boundary for non circular chromosomes. |
is.circular |
logical, default FALSE if not any is: all(isCircular(grl) Where grl is the ranges checked. If TRUE, allow ranges to extend below position 1 on chromosome. Since circular genomes can have negative coordinates. |
... |
Arguments sent to distanceToFollowing |
a GRangesList of extended grl input
grl <- GRangesList(tx1 = GRanges("1", IRanges(c(10, 15), c(13, 20)), "+"), tx2 = GRanges("1", IRanges(30, 50), "+")) extendTrailersUntil(grl, min_ext = 5) extendTrailersUntil(grl, min_ext = 5, until = 1) extendTrailersUntil(grl, min_ext = 5, until = 1) extendTrailersUntil(grl, min_ext = 5, until = 1, extension = 4)grl <- GRangesList(tx1 = GRanges("1", IRanges(c(10, 15), c(13, 20)), "+"), tx2 = GRanges("1", IRanges(30, 50), "+")) extendTrailersUntil(grl, min_ext = 5) extendTrailersUntil(grl, min_ext = 5, until = 1) extendTrailersUntil(grl, min_ext = 5, until = 1) extendTrailersUntil(grl, min_ext = 5, until = 1, extension = 4)
Extract SRR/ERR/DRR run IDs from string
extract_run_id( x, search = "(SRR[0-9]+|DRR[0-9]+|ERR[0-9]+)", only_valid = FALSE )extract_run_id( x, search = "(SRR[0-9]+|DRR[0-9]+|ERR[0-9]+)", only_valid = FALSE )
x |
character vector to search through. |
search |
the regex search, default: |
only_valid |
logical, default FALSE. If TRUE, return only the hits. |
a character vector of run accepted run ids according to search, if only_valid named character vector for which indices are returned
search <- c("SRR1230123_absdb", "SRR1241204124_asdasd", "asd_ERR1231230213", "DRR12412412_asdqwe", "ASDASD_ASDASD", "SRRASDASD") ORFik:::extract_run_id(search) ORFik:::extract_run_id(search, only_valid = TRUE)search <- c("SRR1230123_absdb", "SRR1241204124_asdasd", "asd_ERR1231230213", "DRR12412412_asdqwe", "ASDASD_ASDASD", "SRRASDASD") ORFik:::extract_run_id(search) ORFik:::extract_run_id(search, only_valid = TRUE)
strandMode covRle
f(x)f(x)
x |
a covRle object |
the forward RleList
strandMode covRle
## S4 method for signature 'covRle' f(x)## S4 method for signature 'covRle' f(x)
x |
a covRle object |
the forward RleList
Get file extension of files without compressions
file_ext_without_compression(x, compressions = c("gzip", "gz", "bgz", "zip"))file_ext_without_compression(x, compressions = c("gzip", "gz", "bgz", "zip"))
x |
character paths |
compressions |
character vector, default: c("gzip", "gz", "bgz", "zip"). Expand if you have other formats |
character vector of file extensions of paths excluding suffix vector defined in compression.
file_ext_without_compression(c("abc.bam.gz", "def.bam.zip"))file_ext_without_compression(c("abc.bam.gz", "def.bam.zip"))
If other type than "default" is given and that type is not found
(and 'fallback' is TRUE), it will return you ofst files, if they do not exist,
then default filepaths without warning.
filepath( df, type, basename = FALSE, fallback = type %in% c("pshifted", "bed", "ofst", "bedoc", "bedo"), suffix_stem = "AUTO", base_folders = libFolder(df, unique_mappers = only_unique_mappers), only_unique_mappers = uniqueMappers(df) & type != "default" )filepath( df, type, basename = FALSE, fallback = type %in% c("pshifted", "bed", "ofst", "bedoc", "bedo"), suffix_stem = "AUTO", base_folders = libFolder(df, unique_mappers = only_unique_mappers), only_unique_mappers = uniqueMappers(df) & type != "default" )
df |
an ORFik |
type |
a character(default: "default"), load files in experiment
or some precomputed variant, like "ofst" or "pshifted".
These are made with ORFik:::convertLibs(),
shiftFootprintsByExperiment(), etc.
Can also be custom user made folders inside the experiments bam folder.
It acts in a recursive manner with priority: If you state "pshifted",
but it does not exist, it checks "ofst". If no .ofst files, it uses
"default", which always must exists. |
basename |
logical, default (FALSE). Get relative paths instead of full. Only use for inspection! |
fallback |
logical, default: type If TRUE, will use type fallback, see above for info. |
suffix_stem |
character, default "AUTO". Which is "" for all except type = "pshifted". Then it is "_pshifted" appended to end of names before format. Can be vector, then it searches suffixes in priority: so if you insert c("_pshifted", ""), it will look for suffix _pshifted, then the empty suffix. |
base_folders |
character vector, default libFolder(df), path to base folder to search for library variant directories. If single path (length == 1), it will apply to all libraries in df. If df is a collection, an experiment where libraries are put in different folders and library variants like pshifted are put inside those respective folders, set base_folders = libFolder(df, mode = "all") |
only_unique_mappers |
logical, default |
For pshifted libraries, if "pshifted" is specified as type: if
if multiple formats exist it will use a priority:
ofst -> bigwig -> wig -> bed. For formats outside default, all files
must be stored in the directory of the first file:
base_folder <- libFolder(df)
a character vector of paths, or a list of character with 2 paths per, if paired libraries exists
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
df <- ORFik.template.experiment() filepath(df, "default") # Subset filepath(df[9,], "default") # Other format path filepath(df[9,], "ofst") ## If you have pshifted files, see shiftFootprintsByExperiment() filepath(df[9,], "pshifted") # <- falls back to ofstdf <- ORFik.template.experiment() filepath(df, "default") # Subset filepath(df[9,], "default") # Other format path filepath(df[9,], "ofst") ## If you have pshifted files, see shiftFootprintsByExperiment() filepath(df[9,], "pshifted") # <- falls back to ofst
For removing very extreme peaks in coverage plots, use high quantiles, like 99. Used to make your plots look better, by removing extreme peaks.
filterExtremePeakGenes( tx, reads, upstream = NULL, downstream = NULL, multiplier = "0.99", min_cutoff = "0.999", pre_filter_minimum = 0, average = "median" )filterExtremePeakGenes( tx, reads, upstream = NULL, downstream = NULL, multiplier = "0.99", min_cutoff = "0.999", pre_filter_minimum = 0, average = "median" )
tx |
a GRangesList |
reads |
a |
upstream |
numeric or NULL, default NULL. if you want window of tx, instead of whole, specify how much upstream from start of tx, 10 is include 10 bases before start |
downstream |
numeric or NULL, default NULL. if you want window of tx, instead of whole, specify how much downstream from start of tx, 10 is go 10 bases into tx from start. |
multiplier |
a character or numeric, default "0.99", either a quantile if input is string[0-1], like "0.99", or numeric value if input is numeric. How much bigger than median / mean counts per gene, must a value be to be defined as extreme ? |
min_cutoff |
a character or numeric, default "0.999", either a quantile if input is string[0-1], like "0.999", or numeric value if input is numeric. Lowest allowed value |
pre_filter_minimum |
numeric, default 0. If value is x, will remove all positions in all genes with coverage < x, before median filter is applied. Set to 1 to remove all 0 positions. |
average |
character, default "median". Alternative: "mean". How to scale the multiplier argument, from median or mean of gene coverage. |
GRangesList (filtered)
Filter transcripts to those who have leaders, CDS, trailers of some lengths, you can also pick the longest per gene.
filterTranscripts( txdb, minFiveUTR = 30L, minCDS = 150L, minThreeUTR = 30L, longestPerGene = TRUE, stopOnEmpty = TRUE, by = "tx", create.fst.version = FALSE )filterTranscripts( txdb, minFiveUTR = 30L, minCDS = 150L, minThreeUTR = 30L, longestPerGene = TRUE, stopOnEmpty = TRUE, by = "tx", create.fst.version = FALSE )
txdb |
a TxDb object, ORFik experiment object or a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite), Only in the loadRegion function: if it is a GRangesList, it will return it self. |
minFiveUTR |
(integer) minimum bp for 5' UTR during filtering for the transcripts. Set to NULL if no 5' UTRs exists for annotation. |
minCDS |
(integer) minimum bp for CDS during filtering for the transcripts |
minThreeUTR |
(integer) minimum bp for 3' UTR during filtering for the transcripts. Set to NULL if no 3' UTRs exists for annotation. |
longestPerGene |
logical (TRUE), return only longest valid transcript per gene. NOTE: This is by priority longest cds isoform, if equal then pick longest total transcript. So if transcript is shorter but cds is longer, it will still be the one returned. |
stopOnEmpty |
logical TRUE, stop if no valid transcripts are found ? |
by |
a character, default "tx" Either "tx" or "gene". What names to output region by, the transcript name "tx" or gene names "gene". NOTE: this is not the same as cdsBy(txdb, by = "gene"), cdsBy would then only give 1 cds per Gene, loadRegion gives all isoforms, but with gene names. |
create.fst.version |
logical, FALSE. If TRUE, creates a .fst version
of the transcript length table (if it not already exists),
reducing load time from ~ 15 seconds to
~ 0.01 second next time you run filterTranscripts with this txdb object.
The file is stored in the
same folder as the genome this txdb is created from, with the name: |
If a transcript does not have a trailer, then the length is 0, so they will be filtered out if you set minThreeUTR to 1. So only transcripts with leaders, cds and trailers will be returned. You can set the integer to 0, that will return all within that group.
If your annotation does not have leaders or trailers, set them to NULL, since 0 means there must exist a column called utr3_len etc. Genes with gene_id = NA will be be removed.
a character vector of valid transcript names
df <- ORFik.template.experiment.zf() txdb <- loadTxdb(df) txNames <- filterTranscripts(txdb, minFiveUTR = 1, minCDS = 30, minThreeUTR = 1) loadRegion(txdb, "mrna")[txNames] loadRegion(txdb, "5utr")[txNames]df <- ORFik.template.experiment.zf() txdb <- loadTxdb(df) txNames <- filterTranscripts(txdb, minFiveUTR = 1, minCDS = 30, minThreeUTR = 1) loadRegion(txdb, "mrna")[txNames] loadRegion(txdb, "5utr")[txNames]
Wraps around ORFik file format loaders and rtracklayer::import and tries to speed up loading with the use of data.table. Supports gzip, gz, bgz compression formats. Also safer chromosome naming with the argument chrStyle
fimport( path, chrStyle = NULL, param = NULL, strandMode = 0, only_unique_mappers = FALSE )fimport( path, chrStyle = NULL, param = NULL, strandMode = 0, only_unique_mappers = FALSE )
path |
a character path to file (1 or 2 files), or data.table with 2 colums(forward&reverse) or a GRanges/Galignment/GAlignmentPairs object etc. If it is ranged object it will presume to be already loaded, so will return the object as it is, updating the seqlevelsStyle if given. |
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
param |
By default (i.e. |
strandMode |
numeric, default 0. Only used for paired end bam files. One of (0: strand = *, 1: first read of pair is +, 2: first read of pair is -). See ?strandMode. Note: Sets default to 0 instead of 1, as readGAlignmentPairs uses 1. This is to guarantee hits, but will also make mismatches of overlapping transcripts in opposite directions. |
only_unique_mappers |
logical, default FALSE. Only load unique mappers. For bam files it extracts NH flag, for other formats, it presumes the presence of a directory './unique_mappers' relative to bam file directory. |
NOTE: For wig/bigWig files you can send in 2 files, so that it automatically merges forward and reverse stranded objects. You can also just send 1 wig/bigWig file, it will then have "*" as strand.
a GAlignments/GRanges object,
depending on input.
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
bam_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") fimport(bam_file) # Certain chromosome naming fimport(bam_file, "NCBI") # Paired end bam strandMode 1: fimport(bam_file, strandMode = 1) # (will have no effect in this case, since it is not paired end)bam_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") fimport(bam_file) # Certain chromosome naming fimport(bam_file, "NCBI") # Paired end bam strandMode 1: fimport(bam_file, strandMode = 1) # (will have no effect in this case, since it is not paired end)
Look for files in ebi file servers,
Paired end and single end fastq files.
Fastq ftp url: ftp://ftp.sra.ebi.ac.uk/vol1/fastq
SRA ftp url: ftp://ftp.sra.ebi.ac.uk/vol1/srr
Fastq ASCP url: [email protected]:vol1/fastq
SRA ASCP url: [email protected]:vol1/srr
find_url_ebi( SRR, stop.on.error = FALSE, study = NULL, ebi_file_format = c("fastq_ftp", "sra_ftp")[1], convert_to_ascp = FALSE )find_url_ebi( SRR, stop.on.error = FALSE, study = NULL, ebi_file_format = c("fastq_ftp", "sra_ftp")[1], convert_to_ascp = FALSE )
SRR |
character, SRR, ERR or DRR numbers. |
stop.on.error |
logical FALSE, if TRUE will stop if all files are not found. If FALSE returns empty character vector if error is catched. |
study |
default NULL, optional PRJ (study id) to speed up search for URLs. |
ebi_file_format |
character, format of run download, default is fastq (ftp):
|
convert_to_ascp |
logical, default FALSE. If TRUE use server:
|
full url to fastq files, same length as input (2 urls for paired end data). Returns empty character() if all files not found.
# Test the 3 ways to get fastq files from EBI # Both single end and paired end data # Most common: SRR(3 first)/0(2 last)/whole # Single ORFik:::find_url_ebi("SRR10503056") # Paired ORFik:::find_url_ebi("SRR10500056") # less common: SRR(3 first)/00(1 last)/whole # Single #ORFik:::find_url_ebi("SRR1562873") # Paired #ORFik:::find_url_ebi("SRR1560083") # least common SRR(3 first)/whole # Single #ORFik:::find_url_ebi("SRR105687") # Paired #ORFik:::find_url_ebi("SRR105788")# Test the 3 ways to get fastq files from EBI # Both single end and paired end data # Most common: SRR(3 first)/0(2 last)/whole # Single ORFik:::find_url_ebi("SRR10503056") # Paired ORFik:::find_url_ebi("SRR10500056") # less common: SRR(3 first)/00(1 last)/whole # Single #ORFik:::find_url_ebi("SRR1562873") # Paired #ORFik:::find_url_ebi("SRR1560083") # least common SRR(3 first)/whole # Single #ORFik:::find_url_ebi("SRR105687") # Paired #ORFik:::find_url_ebi("SRR105788")
Get fasta file object, to find sequences in file.
Will load and import file if necessarry.
findFa(faFile)findFa(faFile)
faFile |
|
a FaFile or BSgenome
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
# Some fasta genome with existing fasta index in same folder path <- system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik") findFa(path)# Some fasta genome with existing fasta index in same folder path <- system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik") findFa(path)
This function can map spliced ORFs. It finds ORFs on the sequences of interest, but returns relative positions to the positions of 'grl' argument. For example, 'grl' can be exons of known transcripts (with genomic coordinates), and 'seq' sequences of those transcripts, in that case, this function will return genomic coordinates of ORFs found on transcript sequences.
findMapORFs( grl, seqs, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, groupByTx = FALSE, grl_is_sorted = FALSE )findMapORFs( grl, seqs, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, groupByTx = FALSE, grl_is_sorted = FALSE )
grl |
A |
seqs |
(DNAStringSet or character vector) - DNA/RNA sequences to search
for Open Reading Frames. Can be both uppercase or lowercase. Easiest call to
get seqs if you want only regions from a fasta/fasta index pair is:
seqs = ORFik:::txSeqsFromFa(grl, faFile), where grl is a GRanges/List of
search regions and faFile is a |
startCodon |
(character vector) Possible START codons to search for.
Check |
stopCodon |
(character vector) Possible STOP codons to search for.
Check |
longestORF |
(logical) Default TRUE. Keep only the longest ORF per
unique stopcodon: (seqname, strand, stopcodon) combination, Note: Not longest
per transcript! You can also use function
|
minimumLength |
(integer) Default is 0. Which is START + STOP = 6 bp. Minimum length of ORF, without counting 3bps for START and STOP codons. For example minimumLength = 8 will result in size of ORFs to be at least START + 8*3 (bp) + STOP = 30 bases. Use this param to restrict search. |
groupByTx |
logical (default: FALSE), should output GRangesList be grouped by exons per ORF (TRUE) or by orfs per transcript (FALSE)? |
grl_is_sorted |
logical, default FALSE If FALSE will sort negative transcript in descending order for you. If you loaded ranges with default methods this is already the case, so you can set to TRUE to save some time. |
This function assumes that 'seq' is in widths relative to 'grl', and that their orders match. 1st seq is 1st grl object, etc.
See vignette for real life example.
A GRangesList of ORFs.
Other findORFs:
findORFs(),
findORFsFasta(),
findUORFs(),
startDefinition(),
stopDefinition()
# First show simple example using findORFs # This sequence has ORFs at 1-9 and 4-9 seqs <- DNAStringSet("ATGATGTAA") # the dna transcript sequence findORFs(seqs) # lets assume that this sequence comes from two exons as follows # Then we need to use findMapORFs instead of findORFs, # for splicing information gr <- GRanges(seqnames = "1", # chromosome 1 ranges = IRanges(start = c(21, 10), end = c(23, 15)), strand = "-", # names = "tx1") #From transcript 1 on chr 1 grl <- GRangesList(tx1 = gr) # 1 transcript with 2 exons findMapORFs(grl, seqs) # ORFs are properly mapped to its genomic coordinates grl <- c(grl, grl) names(grl) <- c("tx1", "tx2") findMapORFs(grl, c(seqs, seqs)) # More advanced example and how to save sequences found in vignette# First show simple example using findORFs # This sequence has ORFs at 1-9 and 4-9 seqs <- DNAStringSet("ATGATGTAA") # the dna transcript sequence findORFs(seqs) # lets assume that this sequence comes from two exons as follows # Then we need to use findMapORFs instead of findORFs, # for splicing information gr <- GRanges(seqnames = "1", # chromosome 1 ranges = IRanges(start = c(21, 10), end = c(23, 15)), strand = "-", # names = "tx1") #From transcript 1 on chr 1 grl <- GRangesList(tx1 = gr) # 1 transcript with 2 exons findMapORFs(grl, seqs) # ORFs are properly mapped to its genomic coordinates grl <- c(grl, grl) names(grl) <- c("tx1", "tx2") findMapORFs(grl, c(seqs, seqs)) # More advanced example and how to save sequences found in vignette
Find all Open Reading Frames (ORFs) on the simple input sequences
in ONLY 5'- 3' direction (+), but within all three possible reading frames.
Do not use findORFs for mapping to full chromosomes,
then use findMapORFs!
For each sequence of the input vector IRanges with START and
STOP positions (inclusive) will be returned as
IRangesList. Returned coordinates are relative to the
input sequences.
findORFs( seqs, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0 )findORFs( seqs, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0 )
seqs |
(DNAStringSet or character vector) - DNA/RNA sequences to search
for Open Reading Frames. Can be both uppercase or lowercase. Easiest call to
get seqs if you want only regions from a fasta/fasta index pair is:
seqs = ORFik:::txSeqsFromFa(grl, faFile), where grl is a GRanges/List of
search regions and faFile is a |
startCodon |
(character vector) Possible START codons to search for.
Check |
stopCodon |
(character vector) Possible STOP codons to search for.
Check |
longestORF |
(logical) Default TRUE. Keep only the longest ORF per
unique stopcodon: (seqname, strand, stopcodon) combination, Note: Not longest
per transcript! You can also use function
|
minimumLength |
(integer) Default is 0. Which is START + STOP = 6 bp. Minimum length of ORF, without counting 3bps for START and STOP codons. For example minimumLength = 8 will result in size of ORFs to be at least START + 8*3 (bp) + STOP = 30 bases. Use this param to restrict search. |
If you want antisence strand too, do:
#positive strands
pos <- findORFs(seqs)
#negative strands (DNAStringSet only if character)
neg <- findORFs(reverseComplement(DNAStringSet(seqs)))
relist(c(GRanges(pos, strand = "+"), GRanges(neg, strand = "-")),
skeleton = merge(pos, neg))
(IRangesList) of ORFs locations by START and STOP sites grouped by input sequences. In a list of sequences, only the indices of the sequences that had ORFs will be returned, e.g. 3 sequences where only 1 and 3 has ORFs, will return size 2 IRangesList with names c("1", "3"). If there are a total of 0 ORFs, an empty IRangesList will be returned.
Other findORFs:
findMapORFs(),
findORFsFasta(),
findUORFs(),
startDefinition(),
stopDefinition()
## Simple examples findORFs("ATGTAA") findORFs("ATGTTAA") # not in frame anymore findORFs("ATGATGTAA") # only longest of two above findORFs("ATGATGTAA", longestORF = FALSE) # two ORFs findORFs(c("ATGTAA", "ATGATGTAA")) # 1 ORF per transcript ## Get DNA sequences from ORFs seq <- DNAStringSet(c("ATGTAA", "AAA", "ATGATGTAA")) names(seq) <- c("tx1", "tx2", "tx3") orfs <- findORFs(seq, longestORF = FALSE) # you can get sequences like this: gr <- unlist(orfs, use.names = TRUE) gr <- GRanges(seqnames = names(seq)[as.integer(names(gr))], ranges = gr, strand = "+") # Give them some proper names: names(gr) <- paste0("ORF_", seq.int(length(gr)), "_", seqnames(gr)) orf_seqs <- getSeq(seq, gr) orf_seqs # Save as .fasta (orf_seqs must be of type DNAStringSet) # writeXStringSet(orf_seqs, "orfs.fasta") ## Reading from file and find ORFs #findORFs(readDNAStringSet("path/to/transcripts.fasta"))## Simple examples findORFs("ATGTAA") findORFs("ATGTTAA") # not in frame anymore findORFs("ATGATGTAA") # only longest of two above findORFs("ATGATGTAA", longestORF = FALSE) # two ORFs findORFs(c("ATGTAA", "ATGATGTAA")) # 1 ORF per transcript ## Get DNA sequences from ORFs seq <- DNAStringSet(c("ATGTAA", "AAA", "ATGATGTAA")) names(seq) <- c("tx1", "tx2", "tx3") orfs <- findORFs(seq, longestORF = FALSE) # you can get sequences like this: gr <- unlist(orfs, use.names = TRUE) gr <- GRanges(seqnames = names(seq)[as.integer(names(gr))], ranges = gr, strand = "+") # Give them some proper names: names(gr) <- paste0("ORF_", seq.int(length(gr)), "_", seqnames(gr)) orf_seqs <- getSeq(seq, gr) orf_seqs # Save as .fasta (orf_seqs must be of type DNAStringSet) # writeXStringSet(orf_seqs, "orfs.fasta") ## Reading from file and find ORFs #findORFs(readDNAStringSet("path/to/transcripts.fasta"))
Should be used for procaryote genomes or transcript sequences as fasta. Makes no sence for eukaryote whole genomes, since those contains splicing (use findMapORFs for spliced ranges). Searches through each fasta header and reports all ORFs found for BOTH sense (+) and antisense strand (-) in all frames. Name of the header will be used as seqnames of reported ORFs. Each fasta header is treated separately, and name of the sequence will be used as seqname in returned GRanges object. This supports circular genomes.
findORFsFasta( filePath, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, is.circular = FALSE )findORFsFasta( filePath, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, is.circular = FALSE )
filePath |
(character) Path to the fasta file. Can be both uppercase or lowercase. Or a already loaded R object of either types: "BSgenome" or "DNAStringSet" with named sequences |
startCodon |
(character vector) Possible START codons to search for.
Check |
stopCodon |
(character vector) Possible STOP codons to search for.
Check |
longestORF |
(logical) Default TRUE. Keep only the longest ORF per
unique stopcodon: (seqname, strand, stopcodon) combination, Note: Not longest
per transcript! You can also use function
|
minimumLength |
(integer) Default is 0. Which is START + STOP = 6 bp. Minimum length of ORF, without counting 3bps for START and STOP codons. For example minimumLength = 8 will result in size of ORFs to be at least START + 8*3 (bp) + STOP = 30 bases. Use this param to restrict search. |
is.circular |
(logical) Whether the genome in filePath is circular. Prokaryotic genomes are usually circular. Be carefull if you want to extract sequences, remember that seqlengths must be set, else it does not know what last base in sequence is before loop ends! |
Remember if you have a fasta file of transcripts (transcript coordinates), delete all negative stranded ORFs afterwards by: orfs <- orfs[strandBool(orfs)] # negative strand orfs make no sense then. Seqnames are created from header by format: >name info, so name must be first after "biggern than" and space between name and info. Also make sure your fasta file is valid (no hidden spaces etc), as this might break the coordinate system!
(GRanges) object of ORFs mapped from fasta file. Positions are relative to the fasta file.
Other findORFs:
findMapORFs(),
findORFs(),
findUORFs(),
startDefinition(),
stopDefinition()
# location of the example fasta file example_genome <- system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik") orfs <- findORFsFasta(example_genome) # To store ORF sequences (you need indexed genome .fai file): fa <- FaFile(example_genome) names(orfs) <- paste0("ORF_", seq.int(length(orfs)), "_", seqnames(orfs)) orf_seqs <- getSeq(fa, orfs) # You sequences (fa), needs to have isCircular(fa) == TRUE for it to work # on circular wrapping ranges! # writeXStringSet(DNAStringSet(orf_seqs), "orfs.fasta")# location of the example fasta file example_genome <- system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik") orfs <- findORFsFasta(example_genome) # To store ORF sequences (you need indexed genome .fai file): fa <- FaFile(example_genome) names(orfs) <- paste0("ORF_", seq.int(length(orfs)), "_", seqnames(orfs)) orf_seqs <- getSeq(fa, orfs) # You sequences (fa), needs to have isCircular(fa) == TRUE for it to work # on circular wrapping ranges! # writeXStringSet(DNAStringSet(orf_seqs), "orfs.fasta")
For finding the peaks (stall sites) per gene, with some default filters. A peak is basically a position of very high coverage compared to its surrounding area, as measured using zscore.
findPeaksPerGene( tx, reads, top_tx = 0.5, min_reads_per_tx = 20, min_reads_per_peak = 10, type = "max", gene_ids = names(tx), coverage = coveragePerTiling(tx, reads, TRUE, as.data.table = TRUE) )findPeaksPerGene( tx, reads, top_tx = 0.5, min_reads_per_tx = 20, min_reads_per_peak = 10, type = "max", gene_ids = names(tx), coverage = coveragePerTiling(tx, reads, TRUE, as.data.table = TRUE) )
tx |
a GRangesList |
reads |
a |
top_tx |
numeric, default 0.50 (only use 50% top transcripts by read counts). |
min_reads_per_tx |
numeric, default 20. Gene must have at least 20 reads, applied before type filter. |
min_reads_per_peak |
numeric, default 10. Peak must have at least 10 reads. |
type |
character, default "max". Get only max peak per gene. Alternatives: "all", all peaks passing the input filter will be returned. "median", only peaks that is higher than the median of all peaks. "maxmedian": get first "max", then median of those. |
gene_ids |
character vector, names of genes, default names(tx) |
coverage |
a data.table of coverage, with columns position, score and genes |
The 'reads' argument should be 1 width reads like p-shifts, or other reads that is single positioned. It will work with non 1 width bases, but you then get larger areas for peaks.
For more details see reference, which uses a slightly different method by zscore of a sliding window instead of over the whole tx.
a data.table of gene_id, position, counts of the peak, zscore and standard deviation of the peak compared to rest of gene area.
doi: 10.1261/rna.065235.117
df <- ORFik.template.experiment() cds <- loadRegion(df, "cds") # Load ribo seq from ORFik rfp <- fimport(df[3,]$filepath) # All transcripts passing filter findPeaksPerGene(cds, rfp, top_tx = 0) # Top 50% of genes findPeaksPerGene(cds, rfp)df <- ORFik.template.experiment() cds <- loadRegion(df, "cds") # Load ribo seq from ORFik rfp <- fimport(df[3,]$filepath) # All transcripts passing filter findPeaksPerGene(cds, rfp, top_tx = 0) # Top 50% of genes findPeaksPerGene(cds, rfp)
Procedure: 1. Create a new search space starting with the 5' UTRs. 2. Redefine TSS with CAGE if wanted. 3. Add the whole of CDS to search space to allow uORFs going into cds. 4. find ORFs on that search space. 5. Filter out wrongly found uORFs, if CDS is included. The CDS, alternative CDS, uORFs starting within the CDS etc.
findUORFs( fiveUTRs, fa, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, cds = NULL, cage = NULL, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE )findUORFs( fiveUTRs, fa, startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, cds = NULL, cage = NULL, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE )
fiveUTRs |
(GRangesList) The 5' leaders or full transcript sequences |
fa |
a |
startCodon |
(character vector) Possible START codons to search for.
Check |
stopCodon |
(character vector) Possible STOP codons to search for.
Check |
longestORF |
(logical) Default TRUE. Keep only the longest ORF per
unique stopcodon: (seqname, strand, stopcodon) combination, Note: Not longest
per transcript! You can also use function
|
minimumLength |
(integer) Default is 0. Which is START + STOP = 6 bp. Minimum length of ORF, without counting 3bps for START and STOP codons. For example minimumLength = 8 will result in size of ORFs to be at least START + 8*3 (bp) + STOP = 30 bases. Use this param to restrict search. |
cds |
(GRangesList) CDS of relative fiveUTRs, applicable only if you want to extend 5' leaders downstream of CDS's, to allow upstream ORFs that can overlap into CDS's. |
cage |
Either a filePath for the CageSeq file as .bed .bam or .wig, with possible compressions (".gzip", ".gz", ".bgz"), or already loaded CageSeq peak data as GRanges or GAlignment. NOTE: If it is a .bam file, it will add a score column by running: convertToOneBasedRanges(cage, method = "5prime", addScoreColumn = TRUE) The score column is then number of replicates of read, if score column is something else, like read length, set the score column to NULL first. |
extension |
The maximum number of basses upstream of the TSS to search for CageSeq peak. |
filterValue |
The minimum number of reads on cage position, for it to be counted as possible new tss. (represented in score column in CageSeq data) If you already filtered, set it to 0. |
restrictUpstreamToTx |
a logical (FALSE). If TRUE: restrict leaders to not extend closer than 5 bases from closest upstream leader, set this to TRUE. |
removeUnused |
logical (FALSE), if False: (standard is to set them to original annotation), If TRUE: remove leaders that did not have any cage support. |
From default a filtering process is done to remove "fake" uORFs, but only if cds is included, since uORFs that stop on the stop codon on the CDS is not a uORF, but an alternative cds by definition, etc.
A GRangesList of uORFs, 1 granges list element per uORF.
Other findORFs:
findMapORFs(),
findORFs(),
findORFsFasta(),
startDefinition(),
stopDefinition()
# Load annotation txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") ## Not run: txdb <- loadTxdb(txdbFile) fiveUTRs <- loadRegion(txdb, "leaders") cds <- loadRegion(txdb, "cds") if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { # Normally you would not use a BSgenome, but some custom fasta- # annotation you have for your species findUORFs(fiveUTRs, BSgenome.Hsapiens.UCSC.hg19::Hsapiens, "ATG", cds = cds) } ## End(Not run)# Load annotation txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") ## Not run: txdb <- loadTxdb(txdbFile) fiveUTRs <- loadRegion(txdb, "leaders") cds <- loadRegion(txdb, "cds") if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { # Normally you would not use a BSgenome, but some custom fasta- # annotation you have for your species findUORFs(fiveUTRs, BSgenome.Hsapiens.UCSC.hg19::Hsapiens, "ATG", cds = cds) } ## End(Not run)
Procedure: 1. Create a new search space starting with the 5' UTRs. 2. Redefine TSS with CAGE if wanted. 3. Add the whole of CDS to search space to allow uORFs going into cds. 4. find ORFs on that search space. 5. Filter out wrongly found uORFs, if CDS is included. The CDS, alternative CDS, uORFs starting within the CDS etc.
findUORFs_exp( df, faFile = findFa(df), leaders = loadRegion(txdb, "leaders"), startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, overlappingCDS = FALSE, cage = NULL, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, save_optimized = FALSE )findUORFs_exp( df, faFile = findFa(df), leaders = loadRegion(txdb, "leaders"), startCodon = startDefinition(1), stopCodon = stopDefinition(1), longestORF = TRUE, minimumLength = 0, overlappingCDS = FALSE, cage = NULL, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, save_optimized = FALSE )
df |
a txdb or |
faFile |
FaFile of genome, default findFa(df). Default only works for ORFik experiments, if TxDb, input manually like: findFa(genome_path) |
leaders |
GRangesList, default: loadRegion(txdb, "leaders").
If you do not have any good leader annotation, a hack is to use
|
startCodon |
(character vector) Possible START codons to search for.
Check |
stopCodon |
(character vector) Possible STOP codons to search for.
Check |
longestORF |
(logical) Default TRUE. Keep only the longest ORF per
unique stopcodon: (seqname, strand, stopcodon) combination, Note: Not longest
per transcript! You can also use function
|
minimumLength |
(integer) Default is 0. Which is START + STOP = 6 bp. Minimum length of ORF, without counting 3bps for START and STOP codons. For example minimumLength = 8 will result in size of ORFs to be at least START + 8*3 (bp) + STOP = 30 bases. Use this param to restrict search. |
overlappingCDS |
logical, default FALSE. Include uORFs that overlap CDS. |
cage |
Either a filePath for the CageSeq file as .bed .bam or .wig, with possible compressions (".gzip", ".gz", ".bgz"), or already loaded CageSeq peak data as GRanges or GAlignment. NOTE: If it is a .bam file, it will add a score column by running: convertToOneBasedRanges(cage, method = "5prime", addScoreColumn = TRUE) The score column is then number of replicates of read, if score column is something else, like read length, set the score column to NULL first. |
extension |
The maximum number of basses upstream of the TSS to search for CageSeq peak. |
filterValue |
The minimum number of reads on cage position, for it to be counted as possible new tss. (represented in score column in CageSeq data) If you already filtered, set it to 0. |
restrictUpstreamToTx |
a logical (FALSE). If TRUE: restrict leaders to not extend closer than 5 bases from closest upstream leader, set this to TRUE. |
removeUnused |
logical (FALSE), if False: (standard is to set them to original annotation), If TRUE: remove leaders that did not have any cage support. |
save_optimized |
logical, default FALSE. If TRUE, save in the optimized folder for the experiment. You must have made this directory before running this function (call makeTxdbFromGenome first if not). |
From default a filtering process is done to remove "fake" uORFs, but only if cds is included, since uORFs that stop on the stop codon on the CDS is not a uORF, but an alternative cds by definition, etc.
A GRangesList of uORFs, 1 granges list element per uORF.
Other findORFs:
findMapORFs(),
findORFs(),
findORFsFasta(),
startDefinition(),
stopDefinition()
df <- ORFik.template.experiment() # Without cds overlapping, no 5' leader extension findUORFs_exp(df, extension = 0) # Without cds overlapping, extends 5' leaders by 1000 (good for yeast etc) findUORFs_exp(df) # Include cds overlapping uorfs findUORFs_exp(df, overlappingCDS = TRUE)df <- ORFik.template.experiment() # Without cds overlapping, no 5' leader extension findUORFs_exp(df, extension = 0) # Without cds overlapping, extends 5' leaders by 1000 (good for yeast etc) findUORFs_exp(df) # Include cds overlapping uorfs findUORFs_exp(df, overlappingCDS = TRUE)
grl must be sorted, call ORFik:::sortPerGroup if needed
firstEndPerGroup(grl, keep.names = TRUE)firstEndPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
a Rle(keep.names = T), or integer vector(F)
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) firstEndPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) firstEndPerGroup(grl)
grl must be sorted, call ORFik:::sortPerGroup if needed
firstExonPerGroup(grl)firstExonPerGroup(grl)
grl |
a GRangesList of the first exon per group
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) firstExonPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) firstExonPerGroup(grl)
grl must be sorted, call ORFik:::sortPerGroup if needed
firstStartPerGroup(grl, keep.names = TRUE)firstStartPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
a Rle(keep.names = TRUE), or integer vector(FALSE)
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) firstStartPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) firstStartPerGroup(grl)
Basically removes all info lines with character length > 32768 and save that new file.
fix_malformed_gff(gff)fix_malformed_gff(gff)
gff |
character, path to gtf, can not be gzipped! |
path of fixed gtf
# fix_malformed_gff("my_bad_gff.gff")# fix_malformed_gff("my_bad_gff.gff")
For a GRangesList, get start and end site, return back as GRangesList.
flankPerGroup(grl)flankPerGroup(grl)
grl |
a GRangesList, 1 GRanges per group with: start as minimum start of group and end as maximum per group.
grl <- GRangesList(tx1 = GRanges("1", IRanges(c(1,5), width = 2), "+"), tx2 = GRanges("2", IRanges(c(10,15), width = 2), "+")) flankPerGroup(grl)grl <- GRangesList(tx1 = GRanges("1", IRanges(c(1,5), width = 2), "+"), tx2 = GRanges("2", IRanges(c(10,15), width = 2), "+")) flankPerGroup(grl)
This feature is usually calcualted only for RiboSeq reads. For reads of width between 'start' and 'end', sum the fraction of RiboSeq reads (per read widths) that overlap ORFs and normalize by CDS read width fractions. So if all read length are width 34 in ORFs and CDS, value is 1. If width is 33 in ORFs and 34 in CDS, value is 0. If width is 33 in ORFs and 50/50 (33 and 34) in CDS, values will be 0.5 (for 33).
floss(grl, RFP, cds, start = 26, end = 34, weight = 1L)floss(grl, RFP, cds, start = 26, end = 34, weight = 1L)
grl |
a |
RFP |
ribosomal footprints, given as |
cds |
a |
start |
usually 26, the start of the floss interval (inclusive) |
end |
usually 34, the end of the floss interval (inclusive) |
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
Pseudo explanation of the function:
SUM[start to stop]((grl[start:end][name]/grl) / (cds[start:end][name]/cds))
Where 'name' is transcript names.
Please read more in the article.
a vector of FLOSS of length same as grl, 0 means no RFP reads in range, 1 is perfect match.
doi: 10.1016/j.celrep.2014.07.045
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF1 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 12, 22), end = c(10, 20, 32)), strand = "+") grl <- GRangesList(tx1_1 = ORF1) # RFP is 1 width position based GRanges RFP <- GRanges("1", IRanges(c(1, 25, 35, 38), width = 1), "+") RFP$size <- c(28, 28, 28, 29) # original width in size col cds <- GRangesList(tx1 = GRanges("1", IRanges(35, 44), "+")) # grl must have same names as cds + _1 etc, so that they can be matched. floss(grl, RFP, cds) # or change ribosome start/stop, more strict floss(grl, RFP, cds, 28, 28) # With repeated alignments in score column ORF2 <- GRanges(seqnames = "1", ranges = IRanges(start = c(12, 22, 36), end = c(20, 32, 38)), strand = "+") grl <- GRangesList(tx1_1 = ORF1, tx1_2 = ORF2) score(RFP) <- c(5, 10, 5, 10) floss(grl, RFP, cds, weight = "score")ORF1 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 12, 22), end = c(10, 20, 32)), strand = "+") grl <- GRangesList(tx1_1 = ORF1) # RFP is 1 width position based GRanges RFP <- GRanges("1", IRanges(c(1, 25, 35, 38), width = 1), "+") RFP$size <- c(28, 28, 28, 29) # original width in size col cds <- GRangesList(tx1 = GRanges("1", IRanges(35, 44), "+")) # grl must have same names as cds + _1 etc, so that they can be matched. floss(grl, RFP, cds) # or change ribosome start/stop, more strict floss(grl, RFP, cds, 28, 28) # With repeated alignments in score column ORF2 <- GRanges(seqnames = "1", ranges = IRanges(start = c(12, 22, 36), end = c(20, 32, 38)), strand = "+") grl <- GRangesList(tx1_1 = ORF1, tx1_2 = ORF2) score(RFP) <- c(5, 10, 5, 10) floss(grl, RFP, cds, weight = "score")
FPKM is short for "Fragments Per Kilobase of transcript per Million fragments in library". When calculating RiboSeq data FPKM over ORFs, use ORFs as 'grl'. When calculating RNASeq data FPKM, use full transcripts as 'grl'. It is equal to RPKM given that you do not have paired end reads.
fpkm(grl, reads, pseudoCount = 0, librarySize = "full", weight = 1L)fpkm(grl, reads, pseudoCount = 0, librarySize = "full", weight = 1L)
grl |
a |
reads |
a |
pseudoCount |
a numeric, default 0, set it to 1 if you want to avoid NA and inf values. |
librarySize |
either numeric value or character vector. Default ("full"), number of alignments in library (reads). If you just have a subset, you can give the value by librarySize = length(wholeLib) or sum(wholeLib$score), if you want lib size to be only number of reads overlapping grl, do: librarySize = "overlapping" sum(countOverlaps(reads, grl) > 0), if reads[1] has 3 hits in grl, and reads[2] has 2 hits, librarySize will be 2, not 5. You can also get the inverse overlap, if you want lib size to be total number of overlaps, do: librarySize = "DESeq" This is standard fpkm way of DESeq2::fpkm(robust = FALSE) sum(countOverlaps(grl, reads)) if grl[1] has 3 reads and grl[2] has 2 reads, librarySize is 5, not 2. |
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
Note also that you must consider if you will use the whole read library or just the reads overlapping 'grl' for library size. A normal question here is, does it make sense to include rRNA in library size ? If you only want overlapping grl, do: librarySize = "overlapping"
a numeric vector with the fpkm values
doi: 10.1038/nbt.1621
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25),"+") fpkm(grl, RFP) # With weights (10 reads at position 25) RFP <- GRanges("1", IRanges(25, 25),"+", score = 10) fpkm(grl, RFP, weight = "score")ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25),"+") fpkm(grl, RFP) # With weights (10 reads at position 25) RFP <- GRanges("1", IRanges(25, 25),"+", score = 10) fpkm(grl, RFP, weight = "score")
Fraction Length is defined as
(widths of grl)/tx_len
so that each group in the grl is divided by the corresponding transcript.
fractionLength(grl, tx_len = widthPerGroup(tx, TRUE), tx = NULL)fractionLength(grl, tx_len = widthPerGroup(tx, TRUE), tx = NULL)
grl |
a |
tx_len |
the transcript lengths of the transcripts, a named (tx names) vector of integers. If you have the transcripts as GRangesList, call 'ORFik:::widthPerGroup(tx, TRUE)'. If you used CageSeq to reannotate leaders, then the tss for the the leaders have changed, therefore the tx lengths have changed. To account for that call: 'tx_len <- widthPerGroup(extendLeaders(tx, cageFiveUTRs))' and calculate fraction length using 'fractionLength(grl, tx_len)'. |
tx |
default NULL, a |
a numeric vector of ratios
doi: 10.1242/dev.098343
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) # grl must have same names as cds + _1 etc, so that they can be matched. tx <- GRangesList(tx1 = GRanges("1", IRanges(1, 50), "+")) fractionLength(grl, tx = tx)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) # grl must have same names as cds + _1 etc, so that they can be matched. tx <- GRangesList(tx1 = GRanges("1", IRanges(1, 50), "+")) fractionLength(grl, tx = tx)
Wraps around import.bed and
tries to speed up loading with the
use of data.table. Supports gzip, gz, bgz and bed formats.
Also safer chromosome naming with the argument chrStyle
fread.bed(filePath, chrStyle = NULL)fread.bed(filePath, chrStyle = NULL)
filePath |
The location of the bed file |
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
a GRanges object
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
optimizeReads(),
readBam(),
readBigWig(),
readWig()
# path to example CageSeq data from hg19 heart sample cageData <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") fread.bed(cageData)# path to example CageSeq data from hg19 heart sample cageData <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") fread.bed(cageData)
0.5 means 50
gcContent(seqs, fa = NULL)gcContent(seqs, fa = NULL)
seqs |
a character vector of sequences, or ranges as GRangesList |
fa |
fasta index file .fai file, either path to it, or the loaded FaFile, default (NULL), only set if you give ranges as GRangesList |
a numeric vector of gc content scores
# Here we make an example from scratch seqName <- "Chromosome" ORF1 <- GRanges(seqnames = seqName, ranges = IRanges(c(1007, 1096), width = 60), strand = c("+", "+")) ORF2 <- GRanges(seqnames = seqName, ranges = IRanges(c(400, 100), width = 30), strand = c("-", "-")) ORFs <- GRangesList(tx1 = ORF1, tx2 = ORF2) # get path to FaFile for sequences faFile <- system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik") gcContent(ORFs, faFile)# Here we make an example from scratch seqName <- "Chromosome" ORF1 <- GRanges(seqnames = seqName, ranges = IRanges(c(1007, 1096), width = 60), strand = c("+", "+")) ORF2 <- GRanges(seqnames = seqName, ranges = IRanges(c(400, 100), width = 30), strand = c("-", "-")) ORFs <- GRangesList(tx1 = ORF1, tx2 = ORF2) # get path to FaFile for sequences faFile <- system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik") gcContent(ORFs, faFile)
If your organism is not in this list of supported
organisms, manually assign the input arguments.
There are 2 main fetch modes:
By gene ids (Single accession per gene)
By tx ids (Multiple accessions per gene)
Run the mode you need depending on your required attributes.
Will check for already existing table of all genes, and use that instead
of re-downloading every time (If you input valid experiment or txdb
and have run makeTxdbFromGenome
with symbols = TRUE, you have a file called gene_symbol_tx_table.fst) will
load instantly. If df = NULL, it can still search cache to load a bit slower.
geneToSymbol( df, organism_name = organism(df), gene_ids = filterTranscripts(df, by = "gene", 0, 0, 0), org.dataset = paste0(tolower(substr(organism_name, 1, 1)), gsub(".* ", replacement = "", organism_name), "_gene_ensembl"), ensembl = biomaRt::useEnsembl("ensembl", dataset = org.dataset), attribute = "external_gene_name", include_tx_ids = FALSE, uniprot_id = FALSE, force = FALSE, verbose = TRUE )geneToSymbol( df, organism_name = organism(df), gene_ids = filterTranscripts(df, by = "gene", 0, 0, 0), org.dataset = paste0(tolower(substr(organism_name, 1, 1)), gsub(".* ", replacement = "", organism_name), "_gene_ensembl"), ensembl = biomaRt::useEnsembl("ensembl", dataset = org.dataset), attribute = "external_gene_name", include_tx_ids = FALSE, uniprot_id = FALSE, force = FALSE, verbose = TRUE )
df |
an ORFik |
organism_name |
default, |
gene_ids |
default, |
org.dataset |
default, |
ensembl |
default, |
attribute |
default, "external_gene_name", the biomaRt column / columns default(primary gene symbol names). These are always from specific database, like hgnc symbol for human, and mgi symbol for mouse and rat, sgd for yeast etc. |
include_tx_ids |
logical, default FALSE, also match tx ids, which then returns as the 3rd column. Only allowed when 'df' is defined. If |
uniprot_id |
logical, default FALSE. Include uniprotsptrembl and/or uniprotswissprot. If include_tx_ids you will get per isoform if available, else you get canonical uniprot id per gene. If both uniprotsptrembl and uniprotswissprot exists, it will make a merged uniprot id column with rule: if id exists in uniprotswissprot, keep. If not, use uniprotsptrembl column id. |
force |
logical FALSE, if TRUE will not look for existing file made through |
verbose |
logical TRUE, if FALSE, do not output messages. |
data.table with 2, 3 or 4 columns: gene_id, gene_symbol, tx_id and uniprot_id named after attribute, sorted in order of gene_ids input. (example: returns 3 columns if include_tx_ids is TRUE), and more if additional columns are specified in 'attribute' argument.
## Without ORFik experiment input gene_id_ATF4 <- "ENSG00000128272" #geneToSymbol(NULL, organism_name = "Homo sapiens", gene_ids = gene_id_ATF4) # With uniprot canonical isoform id: #geneToSymbol(NULL, organism_name = "Homo sapiens", gene_ids = gene_id_ATF4, uniprot_id = TRUE) ## All genes from Organism using ORFik experiment # df <- read.experiment("some_experiment) # geneToSymbol(df) ## Non vertebrate species (the ones not in ensembl, but in ensemblGenomes mart) #txdb_ylipolytica <- loadTxdb("txdb_path") #dt2 <- geneToSymbol(txdb_ylipolytica, include_tx_ids = TRUE, # ensembl = useEnsemblGenomes(biomart = "fungi_mart", dataset = "ylipolytica_eg_gene"))## Without ORFik experiment input gene_id_ATF4 <- "ENSG00000128272" #geneToSymbol(NULL, organism_name = "Homo sapiens", gene_ids = gene_id_ATF4) # With uniprot canonical isoform id: #geneToSymbol(NULL, organism_name = "Homo sapiens", gene_ids = gene_id_ATF4, uniprot_id = TRUE) ## All genes from Organism using ORFik experiment # df <- read.experiment("some_experiment) # geneToSymbol(df) ## Non vertebrate species (the ones not in ensembl, but in ensemblGenomes mart) #txdb_ylipolytica <- loadTxdb("txdb_path") #dt2 <- geneToSymbol(txdb_ylipolytica, include_tx_ids = TRUE, # ensembl = useEnsemblGenomes(biomart = "fungi_mart", dataset = "ylipolytica_eg_gene"))
The default query of Ribosome Profiling human, will result in internal entrez search of: Ribosome[All Fields] AND Profiling[All Fields] AND ("Homo sapiens"[Organism] OR human[All Fields])
get_bioproject_candidates( term = "Ribosome Profiling human", as_accession = TRUE, add_study_title = FALSE, RetMax = 10000 )get_bioproject_candidates( term = "Ribosome Profiling human", as_accession = TRUE, add_study_title = FALSE, RetMax = 10000 )
term |
character, default "Ribosome Profiling human". A space is translated into AND, that means "Ribosome AND Profiling AND human", will give same as above. To do OR operation, do: "Ribosome OR profiling OR human". |
as_accession |
logical, default TRUE. Get bioproject accessions: PRJNA, PRJEB, PRJDB values, or IDs (FALSE), numbers only. Accessions are usually the thing needed for most tools. |
add_study_title |
logical, default FALSE. If TRUE, return as data table with 2 columns: id: ID or accessions. title: The title of the study. |
RetMax |
integer, default 10000. How many IDs to return maximum |
character vector of Accessions or IDs. If add_study_title is TRUE, returns a data.table.
https://www.ncbi.nlm.nih.gov/books/NBK25501/
Other sra:
browseSRA(),
download.SRA(),
download.SRA.metadata(),
download.ebi(),
install.sratoolkit(),
rename.SRA.files()
term <- "Ribosome Profiling Saccharomyces cerevisiae" # get_bioproject_candidates(term)term <- "Ribosome Profiling Saccharomyces cerevisiae" # get_bioproject_candidates(term)
Version downloaded is 138.1. NR99_tax (non redundant)
get_silva_rRNA(output.dir)get_silva_rRNA(output.dir)
output.dir |
directory to save downloaded data |
If it fails from timeout, set higher timeout: options(timeout = 200)
filepath to downloaded file
output.dir <- tempdir() # get_silva_rRNA(output.dir)output.dir <- tempdir() # get_silva_rRNA(output.dir)
System usage for Linux (Auto-detects correct drive if not provided)
get_system_usage(drive = detect_drive(), one_liner = FALSE)get_system_usage(drive = detect_drive(), one_liner = FALSE)
drive |
path, the Filesystem drive !(Not the mounted name), use drive = ORFik:::detect_drive("My_directory_inside this mount_name") to get custom drive |
one_liner |
Logical, default FALSE. Instead return a length 1 character string with all the info. |
A list with system info, if one_liner is TRUE, then a length 1 character string.
get_system_usage()get_system_usage()
This function automatically downloads (if files not already exists)
genomes and contaminants specified for genome alignment.
By default, it will use ensembl reference,
upon completion, the function will store
a file called file.path(output.dir, "outputs.rds") with
the output paths of your completed genome/annotation downloads.
For most non-model nonvertebrate organisms, you need
my fork of biomartr for it to work:
remotes::install_github("Roleren/biomartr)
If you misspelled something or crashed, delete wrong files and
run again.
Do remake = TRUE, to do it all over again.
getGenomeAndAnnotation( organism, output.dir, db = "ensembl", GTF = TRUE, genome = TRUE, merge_contaminants = TRUE, phix = FALSE, ncRNA = FALSE, tRNA = FALSE, rRNA = FALSE, gunzip = TRUE, remake = FALSE, assembly_type = c("primary_assembly", "toplevel"), optimize = FALSE, gene_symbols = FALSE, uniprot_id = FALSE, pseudo_5UTRS_if_needed = NULL, remove_annotation_outliers = TRUE, notify_load_existing = TRUE, assembly = organism, refseq_genbank_format = c("gtf", "gff3")[1] )getGenomeAndAnnotation( organism, output.dir, db = "ensembl", GTF = TRUE, genome = TRUE, merge_contaminants = TRUE, phix = FALSE, ncRNA = FALSE, tRNA = FALSE, rRNA = FALSE, gunzip = TRUE, remake = FALSE, assembly_type = c("primary_assembly", "toplevel"), optimize = FALSE, gene_symbols = FALSE, uniprot_id = FALSE, pseudo_5UTRS_if_needed = NULL, remove_annotation_outliers = TRUE, notify_load_existing = TRUE, assembly = organism, refseq_genbank_format = c("gtf", "gff3")[1] )
organism |
scientific name of organism, Homo sapiens,
Danio rerio, Mus musculus, etc. See |
output.dir |
directory to save downloaded data |
db |
database to use for genome and GTF, default adviced: "ensembl" (remember to set assembly_type to "primary_assembly", else it will contain haplotypes, very large file!). Alternatives: "refseq" (reference assemblies) and "genbank" (all assemblies) |
GTF |
logical, default: TRUE, download gtf of organism specified
in "organism" argument. If FALSE, check if the downloaded
file already exist. If you want to use a custom gtf from you hard drive,
set GTF = FALSE,
and assign: |
genome |
logical, default: TRUE, download genome of organism
specified in "organism" argument. If FALSE, check if the downloaded
file already exist. If you want to use a custom gtf from you hard drive,
set |
merge_contaminants |
logical, default TRUE. Will merge the contaminants specified into one fasta file, this considerably saves space and is much quicker to align with STAR than each contaminant on it's own. If no contaminants are specified, this is ignored. |
phix |
logical, default FALSE, download phiX sequence to filter
out Illumina control reads. ORFik defines Phix as a contaminant genome.
Phix is used in Illumina sequencers for sequencing quality control.
Genome is: refseq, Escherichia phage phiX174.
If sequencing facility created fastq files with the command |
ncRNA |
logical or character, default FALSE (not used, no download),
if TRUE or defned path, ncRNA is used as a contaminant reference.
If TRUE, will try to find ncRNA sequences from the gtf file, usually represented as
lncRNA (long noncoding RNA's). Will let you know if no ncRNA sequences were found in
gtf. |
tRNA |
logical or character, default FALSE (not used, no download),
tRNA is used as a contaminant genome.
If TRUE, will try to find tRNA sequences from the gtf file, usually represented as
Mt_tRNA (mature tRNA's). Will let you know if no tRNA sequences were found in
gtf. If not found try character input: |
rRNA |
logical or character, default FALSE (not used, no download),
rRNA is used as a contaminant reference
If TRUE, will try to find rRNA sequences from the gtf file, usually represented as
rRNA (ribosomal RNA's). Will let you know if no rRNA sequences were found in
gtf. If not found you can try character input: |
gunzip |
logical, default TRUE, uncompress downloaded files that are zipped when downloaded, should be TRUE! |
remake |
logical, default: FALSE, if TRUE remake everything specified |
assembly_type |
character, default c("primary_assembly", "toplevel"). Used for ensembl only, specifies the genome assembly type. Searches for both primary and toplevel, and if both are found, uses the first by order (so primary is prioritized by default). The Primary assembly should usually be used if it exists. The "primary assembly" contains all the top-level sequence regions, excluding alternative haplotypes and patches. If the primary assembly file is not present for a species (only defined for standard model organisms), that indicates that there were no haplotype/patch regions, and in such cases, the 'toplevel file is used. For more details see: ensembl tutorial |
optimize |
logical, default FALSE. Create a folder within the output folder (defined by txdb_file_out_path), that includes optimized objects to speed up loading of annotation regions from up to 15 seconds on human genome down to 0.1 second. ORFik will then load these optimized objects instead. Currently optimizes filterTranscript() function and loadRegion() function for 5' UTRs, 3' UTRs, CDS, mRNA (all transcript with CDS) and tx (all transcripts). |
gene_symbols |
logical default FALSE. If TRUE, will download and store all gene symbols for all transcripts (coding and noncoding)- In a file called: "gene_symbol_tx_table.fst" in same folder as txdb. hgcn for human, mouse symbols for mouse and rat, more to be added. |
uniprot_id |
logical default FALSE. If TRUE, will download and store all uniprot id for all transcripts (coding and noncoding)- In a file called: "gene_symbol_tx_table.fst" in same folder as txdb. |
pseudo_5UTRS_if_needed |
integer, default NULL. If defined > 0, will add pseudo 5' UTRs of maximum this length if 'minimum_5UTR_percentage" (default 30 mRNAs (coding transcripts) do not have a leader. (NULL and 0 are both the ignore command) |
remove_annotation_outliers |
logical, default TRUE. Only for refseq. shall outlier lines be removed from the input annotation_file? If yes, then the initial annotation_file will be overwritten and the removed outlier lines will be stored at tempdir for further exploration. Among others Aridopsis refseq contains malformed lines, where this is needed |
notify_load_existing |
logical, default TRUE. If annotation exists (defined as: locally (a file called outputs.rds) exists in outputdir), print a small message notifying the user it is not redownloading. Set to FALSE, if this is not wanted |
assembly |
character, default is assembly = organism, which means getting the first assembly in list, otherwise the name of the assembly wanted, like "GCA_000005845" will get ecoli substrain k12, which is the most used ones for references. Usually ignore this for non bacterial species. |
refseq_genbank_format |
= c("gtf", "gff3")[1] Gtf format files are usually more secure from bugs downstream, so we highly advice to use them. GFF3 files can sometimes include information you might not find in the gtf, so sometimes it makes sense to use it. |
Some files that are made after download:
- A fasta index for the genome
- A TxDb to speed up GTF/GFF reading
- Seperat of merged contaminant files
Files that can be made:
- Gene symbols (hgnc, etc)
- Uniprot ids (For name of protein structures)
If you want custom genome or gtf from you hard drive, assign existing
paths like this:
annotation <- getGenomeAndAnnotation(GTF = "path/to/gtf.gtf",
genome = "path/to/genome.fasta")
a named character vector of path to genomes and gtf downloaded, and additional contaminants if used. If merge_contaminants is TRUE, will not give individual fasta files to contaminants, but only the merged one.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4919035/
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.install(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
install.fastp()
## Get Saccharomyces cerevisiae genome and gtf (create txdb for R) #getGenomeAndAnnotation("Saccharomyces cerevisiae", tempdir(), assembly_type = "toplevel") ## Download and add pseudo 5' UTRs #getGenomeAndAnnotation("Saccharomyces cerevisiae", tempdir(), assembly_type = "toplevel", # pseudo_5UTRS_if_needed = 100) ## Get Danio rerio genome and gtf (create txdb for R) #getGenomeAndAnnotation("Danio rerio", tempdir()) output.dir <- "/Bio_data/references/zebrafish" ## Get Danio rerio and Phix contamints to deplete during alignment #getGenomeAndAnnotation("Danio rerio", output.dir, phix = TRUE) ## Optimize for ORFik (speed up for large annotations like human or zebrafish) #getGenomeAndAnnotation("Danio rerio", tempdir(), optimize = TRUE) # Drosophila melanogaster (toplevel exists only) #getGenomeAndAnnotation("drosophila melanogaster", output.dir = file.path(config["ref"], # "Drosophila_melanogaster_BDGP6"), assembly_type = "toplevel") ## How to save malformed refseq gffs: ## First run function and let it crash: #annotation <- getGenomeAndAnnotation(organism = "Arabidopsis thaliana", # output.dir = "~/Desktop/test_plant/", # assembly_type = "primary_assembly", db = "refseq") ## Then apply a fix (example for linux, too long rows): # fixed_gff <- fix_malformed_gff("~/Desktop/test_plant/Arabidopsis_thaliana_genomic_refseq.gff") ## Then updated arguments: # annotation <- c(fixed_gff, "~/Desktop/test_plant/Arabidopsis_thaliana_genomic_refseq.fna") # names(annotation) <- c("gtf", "genome") # Then make the txdb (for faster R use) # makeTxdbFromGenome(annotation["gtf"], annotation["genome"], organism = "Arabidopsis thaliana")## Get Saccharomyces cerevisiae genome and gtf (create txdb for R) #getGenomeAndAnnotation("Saccharomyces cerevisiae", tempdir(), assembly_type = "toplevel") ## Download and add pseudo 5' UTRs #getGenomeAndAnnotation("Saccharomyces cerevisiae", tempdir(), assembly_type = "toplevel", # pseudo_5UTRS_if_needed = 100) ## Get Danio rerio genome and gtf (create txdb for R) #getGenomeAndAnnotation("Danio rerio", tempdir()) output.dir <- "/Bio_data/references/zebrafish" ## Get Danio rerio and Phix contamints to deplete during alignment #getGenomeAndAnnotation("Danio rerio", output.dir, phix = TRUE) ## Optimize for ORFik (speed up for large annotations like human or zebrafish) #getGenomeAndAnnotation("Danio rerio", tempdir(), optimize = TRUE) # Drosophila melanogaster (toplevel exists only) #getGenomeAndAnnotation("drosophila melanogaster", output.dir = file.path(config["ref"], # "Drosophila_melanogaster_BDGP6"), assembly_type = "toplevel") ## How to save malformed refseq gffs: ## First run function and let it crash: #annotation <- getGenomeAndAnnotation(organism = "Arabidopsis thaliana", # output.dir = "~/Desktop/test_plant/", # assembly_type = "primary_assembly", db = "refseq") ## Then apply a fix (example for linux, too long rows): # fixed_gff <- fix_malformed_gff("~/Desktop/test_plant/Arabidopsis_thaliana_genomic_refseq.gff") ## Then updated arguments: # annotation <- c(fixed_gff, "~/Desktop/test_plant/Arabidopsis_thaliana_genomic_refseq.fna") # names(annotation) <- c("gtf", "genome") # Then make the txdb (for faster R use) # makeTxdbFromGenome(annotation["gtf"], annotation["genome"], organism = "Arabidopsis thaliana")
Supports Gene symbols as default, and will produce the best results. You can also use ensembl gene ids, refseq gene ids and Entrez gene ids, but this will give weaker results.
go_analaysis_gorilla( target_genes, background_genes, organism, analysis_name = paste0("Go_analysis_", organism), open_browser = TRUE, pvalue_thresh = 0.01, db = "all" )go_analaysis_gorilla( target_genes, background_genes, organism, analysis_name = paste0("Go_analysis_", organism), open_browser = TRUE, pvalue_thresh = 0.01, db = "all" )
target_genes |
a path to a txt file with the target Gene symbols, or presumed to be a character vector of genes (if length > 1). Minimum 10 genes, maximum 1 million. |
background_genes |
a path to a txt file with the background Gene symbols, or presumed to be a character vector of genes (if length > 1). Minimum 10 genes, maximum 2 million. |
organism |
organism(df), example "Homo sapiens" |
analysis_name |
character name, default "test". Used for saved file names and analysis name in GOrilla. |
open_browser |
= TRUE, open the URL |
pvalue_thresh |
fixed set numeric, default 0.001, Alternatives: 10e-3 to 10e-11 |
db |
character, default "all". Which GO onthology categories to use, all means process, function and component. Alternatives: "proc", "func" and "comp", if you only want that single category subset. |
a url path to results, will also open your default web browser if open_browser is TRUE.
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-10-48
target_genes <- system.file("extdata/Homo_sapiens_sample/QC_STATS", "/DTEG_Comparison_Translation.txt", package = "ORFik") background_genes <- system.file("extdata/Homo_sapiens_sample/QC_STATS", "/DTEG_Comparison_Background.txt", package = "ORFik") #go_analaysis_gorilla(target_genes, background_genes, "Homo sapiens", # analysis_name = "Translation vs background")target_genes <- system.file("extdata/Homo_sapiens_sample/QC_STATS", "/DTEG_Comparison_Translation.txt", package = "ORFik") background_genes <- system.file("extdata/Homo_sapiens_sample/QC_STATS", "/DTEG_Comparison_Background.txt", package = "ORFik") #go_analaysis_gorilla(target_genes, background_genes, "Homo sapiens", # analysis_name = "Translation vs background")
It will group / split the GRanges object by the argument 'other'.
For example if you would like to to group GRanges object by gene,
set other to gene names.
If 'other' is not specified function will try to use the names of the
GRanges object. It will then be similar to 'split(gr, names(gr))'.
groupGRangesBy(gr, other = NULL)groupGRangesBy(gr, other = NULL)
gr |
a GRanges object |
other |
a vector of unique names to group by (default: NULL) |
It is important that all intended groups in 'other' are uniquely named, otherwise duplicated group names will be grouped together.
a GRangesList named after names(GRanges) if other is NULL, else names are from unique(other)
ORFranges <- GRanges(seqnames = Rle(rep("1", 3)), ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") ORFranges2 <- GRanges("1", ranges = IRanges(start = c(20, 30, 40), end = c(25, 35, 45)), strand = "+") names(ORFranges) = rep("tx1_1", 3) names(ORFranges2) = rep("tx1_2", 3) grl <- GRangesList(tx1_1 = ORFranges, tx1_2 = ORFranges2) gr <- unlist(grl, use.names = FALSE) ## now recreate the grl ## group by orf grltest <- groupGRangesBy(gr) # using the names to group identical(grl, grltest) ## they are identical ## group by transcript names(gr) <- txNames(gr) grltest <- groupGRangesBy(gr) identical(grl, grltest) ## they are not identicalORFranges <- GRanges(seqnames = Rle(rep("1", 3)), ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") ORFranges2 <- GRanges("1", ranges = IRanges(start = c(20, 30, 40), end = c(25, 35, 45)), strand = "+") names(ORFranges) = rep("tx1_1", 3) names(ORFranges2) = rep("tx1_2", 3) grl <- GRangesList(tx1_1 = ORFranges, tx1_2 = ORFranges2) gr <- unlist(grl, use.names = FALSE) ## now recreate the grl ## group by orf grltest <- groupGRangesBy(gr) # using the names to group identical(grl, grltest) ## they are identical ## group by transcript names(gr) <- txNames(gr) grltest <- groupGRangesBy(gr) identical(grl, grltest) ## they are not identical
Get number of ranges per group as an iteration
groupings(grl)groupings(grl)
grl |
GRangesList |
an integer vector
grl <- GRangesList(GRanges("1", c(1, 3, 5), "+"), GRanges("1", c(19, 21, 23), "+")) ORFik::groupings(grl)grl <- GRangesList(GRanges("1", c(1, 3, 5), "+"), GRanges("1", c(19, 21, 23), "+")) ORFik::groupings(grl)
Coverage heatmap of single libraries
heatMap_single( region, tx, reads, outdir, scores = "sum", upstream, downstream, zeroPosition = upstream, returnCoverage = FALSE, acceptedLengths = NULL, legendPos = "right", colors = "default", addFracPlot = TRUE, location = "start site", shifting = NULL, skip.last = FALSE, title = NULL, gradient.max = "default" )heatMap_single( region, tx, reads, outdir, scores = "sum", upstream, downstream, zeroPosition = upstream, returnCoverage = FALSE, acceptedLengths = NULL, legendPos = "right", colors = "default", addFracPlot = TRUE, location = "start site", shifting = NULL, skip.last = FALSE, title = NULL, gradient.max = "default" )
region |
#' a |
tx |
default NULL, a GRangesList of transcripts or (container region), names of tx must contain all grl names. The names of grl can also be the ORFik orf names. that is "txName_id" |
reads |
a |
outdir |
a character path to save file as: not just directory, but full name. |
scores |
character vector, default "sum", either of zscore, transcriptNormalized, sum, mean, median, .. see ?coverageScorings for info and more alternatives. |
upstream |
an integer, relative region to get upstream from. |
downstream |
an integer, relative region to get downstream from |
zeroPosition |
an integer DEFAULT (upstream), what is the center point? Like leaders and cds combination, then 0 is the TIS and -1 is last base in leader. NOTE!: if windows have different widths, this will be ignored. |
returnCoverage |
logical, default: FALSE, return coverage, if FALSE returns plot instead. |
acceptedLengths |
an integer vector (NULL), the read lengths accepted. Default NULL, means all lengths accepted. |
legendPos |
a character, Default "right". Where should the fill legend be ? ("top", "bottom", "right", "left") |
colors |
character vector, default: "default", this gives you: c("white", "yellow2", "yellow3", "lightblue", "blue", "navy"), do "high" for more high contrasts, or specify your own colors. |
addFracPlot |
Add margin histogram plot on top of heatmap with fractions per positions |
location |
a character, default "start site", will make xlabel of heatmap be Position relative to "start site" or alternative given. |
shifting |
a character, default NULL (no shifting), can also be either of c("5prime", "3prime") |
skip.last |
skip top(highest) read length, default FALSE |
title |
a character, default NULL (no title), what is the top title of plot? |
gradient.max |
numeric or character, default: "default", which is:
|
ggplot2 grob (default), data.table (if returnCoverage is TRUE)
Other heatmaps:
coverageHeatMap(),
heatMapL(),
heatMapRegion()
Simplified input space for easier abstraction of coverage heatmaps
Pick your transcript region and plot directly
Input CAGE file if you use TSS and want improved 5' annotation.
heatMapRegion( df, region = "TIS", outdir = "default", scores = c("transcriptNormalized", "sum"), type = "ofst", cage = NULL, plot.ext = ".pdf", acceptedLengths = 21:75, upstream = c(50, 30), downstream = c(29, 69), shifting = c("5prime", "3prime"), longestPerGene = TRUE, colors = "default", scale_x = 5.5, scale_y = 15.5, gradient.max = "default", BPPARAM = BiocParallel::SerialParam() )heatMapRegion( df, region = "TIS", outdir = "default", scores = c("transcriptNormalized", "sum"), type = "ofst", cage = NULL, plot.ext = ".pdf", acceptedLengths = 21:75, upstream = c(50, 30), downstream = c(29, 69), shifting = c("5prime", "3prime"), longestPerGene = TRUE, colors = "default", scale_x = 5.5, scale_y = 15.5, gradient.max = "default", BPPARAM = BiocParallel::SerialParam() )
df |
an ORFik |
region |
a character, default "TIS". The centering point for the heatmap
(what is position 0, beween -50 and 50 etc), can be any combination of the
set: c("TSS", "TIS", "TTS", "TES"), which are:
- Transcription start site (5' end of mrna) |
outdir |
a character path, default: "default", saves to:
|
scores |
character vector, default |
type |
character, default: "ofst". Type of library: either "default", usually bam format (the one you gave to experiment), "pshifted" pshifted reads, "ofst", "bed", "bedo" optimized bed, or "wig" |
cage |
a character path to library file or a |
plot.ext |
a character, default ".pdf", alternative ".png" |
acceptedLengths |
an integer vector (NULL), the read lengths accepted. Default NULL, means all lengths accepted. |
upstream |
1 or 2 integers, default c(50, 30), how long upstream from 0 should window extend (first index is 5' end extension, second is 3' end extension). If only 1 shifting, only 1 value should be given, if two are given will use first. |
downstream |
1 or 2 integers, default c(29, 69), how long upstream from 0 should window extend (first index is 5' end extension, second is 3' end extension). If only 1 shifting, only 1 value should be given, if two are given will use first. |
shifting |
a character, default c("5prime", "3prime"), can also be NULL (no shifting of reads). If NULL, will use first index of 'upstream' and 'downstream' argument. |
longestPerGene |
logical, default TRUE. Use only longest transcript isoform per gene. This will speed up your computation. |
colors |
character vector, default: "default", this gives you: c("white", "yellow2", "yellow3", "lightblue", "blue", "navy"), do "high" for more high contrasts, or specify your own colors. |
scale_x |
numeric, how should the width of the single plots be scaled, bigger the number, the bigger the plot |
scale_y |
numeric, how should the height of the plots be scaled, bigger the number, the bigger the plot |
gradient.max |
numeric or character, default: "default", which is:
|
BPPARAM |
a core param, default: single thread: |
invisible(NULL), plots are saved
Other heatmaps:
coverageHeatMap(),
heatMapL(),
heatMap_single()
# Toy example, will not give logical output, but shows how it works df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs #heatMapRegion(df, "TIS", outdir = "default") # # Do also TSS, add cage for specific TSS # heatMapRegion(df, c("TSS", "TIS"), cage = "path/to/cage.bed") # Do on pshifted reads instead of original files remove.experiments(df) # Remove loaded experiment first # heatMapRegion(df, "TIS", type = "pshifted")# Toy example, will not give logical output, but shows how it works df <- ORFik.template.experiment()[9:10,] # Subset to 2 Ribo-seq libs #heatMapRegion(df, "TIS", outdir = "default") # # Do also TSS, add cage for specific TSS # heatMapRegion(df, c("TSS", "TIS"), cage = "path/to/cage.bed") # Do on pshifted reads instead of original files remove.experiments(df) # Remove loaded experiment first # heatMapRegion(df, "TIS", type = "pshifted")
.bedo is .bed ORFik, an optimized bed format for coverage reads with read lengths
.bedo is a text based format with columns (6 maximum):
1. chromosome
2. start
3. end
4. strand
5. ref width (cigar # M's, match/mismatch total)
6. duplicates of that read
import.bedo(path)import.bedo(path)
path |
a character, location on disc (full path) |
Positions are 1-based, not 0-based as .bed. export with export.bedo
GRanges object
A much faster way to store, load and use bam files.
.bedoc is .bed ORFik, an optimized bed format for coverage reads with
cigar and replicate number.
.bedoc is a text based format with columns (5 maximum):
1. chromosome
2. cigar: (cigar # M's, match/mismatch total)
3. start (left most position)
4. strand (+, -, *)
5. score: duplicates of that read
import.bedoc(path)import.bedoc(path)
path |
a character, location on disc (full path) |
Positions are 1-based, not 0-based as .bed. export with export.bedo
GAlignments object
Import region from fastwig
import.fstwig(gr, dir, id = "", readlengths = "all")import.fstwig(gr, dir, id = "", readlengths = "all")
gr |
a GRanges object of exons |
dir |
prefix to filepath for file strand and chromosome will be added |
id |
id to column type, not used currently! |
readlengths |
integer / character vector, default "all". Or a subset of readlengths. |
a data.table with columns specified by readlengths
A much faster way to store, load and use bam files.
.ofst is ORFik fast serialized object,
an optimized format for coverage reads with
cigar and replicate number. It uses the fst format as back-end:
fst-package.
A .ofst ribo seq file can compress the
information in a bam file from 5GB down to a few MB. This new files has
super fast reading time, only a few seconds, instead of minutes. It also has
random index access possibility of the file.
.ofst is represented as a data.frane format with minimum 4 columns:
1. chromosome
2. start (left most position)
3. strand (+, -, *)
4. width (not added if cigar exists, see below for more details)
5. cigar (not needed if width exists):
(cigar # M's, match/mismatch total)
5. score: duplicates of that read
6. size: qwidth according to reference of read
If file is from GAlignmentPairs,
it will contain a cigar1, cigar2 instead
of cigar and start1 and start2 instead of start
import.ofst(file, strandMode = 0, seqinfo = NULL)import.ofst(file, strandMode = 0, seqinfo = NULL)
file |
a path to a .ofst file |
strandMode |
numeric, default 0. Only used for paired end bam files. One of (0: strand = *, 1: first read of pair is +, 2: first read of pair is -). See ?strandMode. Note: Sets default to 0 instead of 1, as readGAlignmentPairs uses 1. This is to guarantee hits, but will also make mismatches of overlapping transcripts in opposite directions. |
seqinfo |
Seqinfo object, defaul NULL (created from ranges). Add to avoid warnings later on differences in seqinfo. |
If 'width' is not defined, it checks for column called 'end'. If
If neither width or end is defined, then all widths are presumed to be 1.
I.e. single nucleotide points.
Other columns can be named whatever you want and added to meta columns.
Positions are 1-based, not 0-based as .bed.
Import with import.ofst
a GAlignment, GAlignmentPairs or GRanges object, dependent of if cigar/cigar1 is defined in .ofst file.
## GRanges gr <- GRanges("1:1-3:-") tmp <- file.path(tempdir(), "path.ofst") # export.ofst(gr, file = tmp) # import.ofst(tmp) ## GAlignment # Make input data.frame df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") ga <- ORFik:::getGAlignments(df) # export.ofst(ga, file = tmp) # import.ofst(tmp)## GRanges gr <- GRanges("1:1-3:-") tmp <- file.path(tempdir(), "path.ofst") # export.ofst(gr, file = tmp) # import.ofst(tmp) ## GAlignment # Make input data.frame df <- data.frame(seqnames = "1", cigar = "3M", start = 1L, strand = "+") ga <- ORFik:::getGAlignments(df) # export.ofst(ga, file = tmp) # import.ofst(tmp)
Import the GTF / GFF that made the txdb
importGtfFromTxdb(txdb, stop.error = TRUE)importGtfFromTxdb(txdb, stop.error = TRUE)
txdb |
a TxDb, path to txdb / gff or ORFik experiment object |
stop.error |
logical TRUE, stop if Txdb does not have a gtf. If FALSE, return NULL. |
data.frame, the gtf/gff object imported with rtracklayer::import. Or NULL, if stop.error is FALSE, and no GTF file found.
initiationScore tries to check how much each TIS region resembles, the average of the CDS TIS regions.
initiationScore(grl, cds, tx, reads, pShifted = TRUE, weight = "score")initiationScore(grl, cds, tx, reads, pShifted = TRUE, weight = "score")
grl |
a |
cds |
a |
tx |
a GRangesList of transcripts covering grl. |
reads |
ribo seq reads as |
pShifted |
a logical (TRUE), are riboseq reads p-shifted? |
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
Since this features uses a distance matrix for scoring, values are
distributed like this:
As result there is one value per ORF:
0.000: means that ORF had no reads
-1.000: means that ORF is identical to average of CDS
1.000: means that orf is maximum different than average of CDS
If a score column is defined, it will use it as weights,
see getWeights
an integer vector, 1 score per ORF, with names of grl
doi: 10.1186/s12915-017-0416-0
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# Good hiting ORF ORF <- GRanges(seqnames = "1", ranges = IRanges(21, 40), strand = "+") names(ORF) <- c("tx1") grl <- GRangesList(tx1 = ORF) # 1 width p-shifted reads reads <- GRanges("1", IRanges(c(21, 23, 50, 50, 50, 53, 53, 56, 59), width = 1), "+") score(reads) <- 28 # original width cds <- GRanges(seqnames = "1", ranges = IRanges(50, 80), strand = "+") cds <- GRangesList(tx1 = cds) tx <- GRanges(seqnames = "1", ranges = IRanges(1, 85), strand = "+") tx <- GRangesList(tx1 = tx) initiationScore(grl, cds, tx, reads, pShifted = TRUE)# Good hiting ORF ORF <- GRanges(seqnames = "1", ranges = IRanges(21, 40), strand = "+") names(ORF) <- c("tx1") grl <- GRangesList(tx1 = ORF) # 1 width p-shifted reads reads <- GRanges("1", IRanges(c(21, 23, 50, 50, 50, 53, 53, 56, 59), width = 1), "+") score(reads) <- 28 # original width cds <- GRanges(seqnames = "1", ranges = IRanges(50, 80), strand = "+") cds <- GRangesList(tx1 = cds) tx <- GRanges(seqnames = "1", ranges = IRanges(1, 85), strand = "+") tx <- GRangesList(tx1 = tx) initiationScore(grl, cds, tx, reads, pShifted = TRUE)
Inside/Outside score is defined as
(reads over ORF)/(reads outside ORF and within transcript)
A pseudo-count of one is added to both the ORF and outside sums.
insideOutsideORF( grl, RFP, GtfOrTx, ds = NULL, RFP.sorted = FALSE, weight = 1L, overlapGrl = NULL )insideOutsideORF( grl, RFP, GtfOrTx, ds = NULL, RFP.sorted = FALSE, weight = 1L, overlapGrl = NULL )
grl |
a |
RFP |
RiboSeq reads as GAlignments, GRanges or GRangesList object |
GtfOrTx |
If it is |
ds |
numeric vector (NULL), disengagement score. If you have already
calculated |
RFP.sorted |
logical (FALSE), an optimizer, have you ran this line:
|
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
overlapGrl |
an integer, (default: NULL), if defined must be countOverlaps(grl, RFP), added for speed if you already have it |
a named vector of numeric values of scores
doi: 10.1242/dev.098345
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# Check inside outside score of a ORF within a transcript ORF <- GRanges("1", ranges = IRanges(start = c(20, 30, 40), end = c(25, 35, 45)), strand = "+") grl <- GRangesList(tx1_1 = ORF) tx1 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20, 30, 40, 50), end = c(5, 15, 25, 35, 45, 200)), strand = "+") tx <- GRangesList(tx1 = tx1) RFP <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 4, 30, 60, 80, 90), end = c(30, 33, 63, 90, 110, 120)), strand = "+") insideOutsideORF(grl, RFP, tx)# Check inside outside score of a ORF within a transcript ORF <- GRanges("1", ranges = IRanges(start = c(20, 30, 40), end = c(25, 35, 45)), strand = "+") grl <- GRangesList(tx1_1 = ORF) tx1 <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20, 30, 40, 50), end = c(5, 15, 25, 35, 45, 200)), strand = "+") tx <- GRangesList(tx1 = tx1) RFP <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 4, 30, 60, 80, 90), end = c(30, 33, 63, 90, 110, 120)), strand = "+") insideOutsideORF(grl, RFP, tx)
On Linux, will not run "make", only use precompiled fastp file.
On Mac OS it will use precompiled binaries.
For windows must be installed through WSL (Windows Subsystem Linux)
install.fastp(folder = "~/bin")install.fastp(folder = "~/bin")
folder |
path to folder for download, file will be named "fastp", this should be most recent version. On mac it will search for a folder called fastp-master inside folder given. Since there is no precompiled version of fastp for Mac OS. |
path to runnable fastp
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6129281/
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.install(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation()
## With default folder: #install.fastp() ## Or set manual folder: folder <- "~/I/WANT/IT/HERE/" #install.fastp(folder)## With default folder: #install.fastp() ## Or set manual folder: folder <- "~/I/WANT/IT/HERE/" #install.fastp(folder)
Currently supported for Linux (64 bit centos and ubunutu is tested to work) and Mac-OS(64 bit). If other linux distro, centos binaries will be used.
install.sratoolkit(folder = "~/bin", version = "2.11.3")install.sratoolkit(folder = "~/bin", version = "2.11.3")
folder |
default folder, "~/bin" |
version |
a string, default "2.11.3" |
path to fastq-dump in sratoolkit
https://ncbi.github.io/sra-tools/fastq-dump.html
Other sra:
browseSRA(),
download.SRA(),
download.SRA.metadata(),
download.ebi(),
get_bioproject_candidates(),
rename.SRA.files()
# install.sratoolkit() ## Custom folder and version (not adviced) folder <- "/I/WANT/IT/HERE/" # install.sratoolkit(folder, version = "2.10.9")# install.sratoolkit() ## Custom folder and version (not adviced) folder <- "/I/WANT/IT/HERE/" # install.sratoolkit(folder, version = "2.10.9")
Input of this function, is the output of the function [distToCds()], or any other relative ORF frame.
isInFrame(dists)isInFrame(dists)
dists |
a vector of integer distances between ORF and cds. 0 distance means equal frame |
possible outputs: 0: orf is in frame with cds 1: 1 shifted from cds 2: 2 shifted from cds
a logical vector
doi: 10.1074/jbc.R116.733899
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# simple example isInFrame(c(3,6,8,11,15)) # GRangesList example grl <- GRangesList(tx1_1 = GRanges("1", IRanges(1,10), "+")) fiveUTRs <- GRangesList(tx1 = GRanges("1", IRanges(1,20), "+")) dist <- distToCds(grl, fiveUTRs) isInFrame <- isInFrame(dist)# simple example isInFrame(c(3,6,8,11,15)) # GRangesList example grl <- GRangesList(tx1_1 = GRanges("1", IRanges(1,10), "+")) fiveUTRs <- GRangesList(tx1 = GRanges("1", IRanges(1,20), "+")) dist <- distToCds(grl, fiveUTRs) isInFrame <- isInFrame(dist)
Input of this function, is the output of the function [distToCds()]
isOverlapping(dists)isOverlapping(dists)
dists |
a vector of distances between ORF and cds |
a logical vector
doi: 10.1074/jbc.R116.733899
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# simple example isOverlapping(c(-3,-6,8,11,15)) # GRangesList example grl <- GRangesList(tx1_1 = GRanges("1", IRanges(1,10), "+")) fiveUTRs <- GRangesList(tx1 = GRanges("1", IRanges(1,20), "+")) dist <- distToCds(grl, fiveUTRs) isOverlapping <- isOverlapping(dist)# simple example isOverlapping(c(-3,-6,8,11,15)) # GRangesList example grl <- GRangesList(tx1_1 = GRanges("1", IRanges(1,10), "+")) fiveUTRs <- GRangesList(tx1 = GRanges("1", IRanges(1,20), "+")) dist <- distToCds(grl, fiveUTRs) isOverlapping <- isOverlapping(dist)
Defined as region (-4, -1) relative to TIS
kozak_IR_ranking(cds_k, mrna, dt.ir, faFile, group.min = 10, species = "human")kozak_IR_ranking(cds_k, mrna, dt.ir, faFile, group.min = 10, species = "human")
cds_k |
cds ranges (GRangesList) |
mrna |
mrna ranges (GRangesList) |
dt.ir |
data.table with a column called IR, initiation rate |
faFile |
|
group.min |
numeric, default 10. Minimum transcripts per initation group to be included |
species |
("human"), which species to use, currently supports human (Homo sapiens), zebrafish (Danio rerio) and mouse (Mus musculus). Both scientific or common name for these species will work. You can also specify a pfm for your own species. Syntax of pfm is an rectangular integer matrix, where all columns must sum to the same value, normally 100. See example for more information. Rows are in order: c("A", "C", "G", "T") |
a ggplot grid object
Given sequences, DNA or RNA. And some score, ribo-seq fpkm, TE etc. Create a heatmap divided per letter in seqs, by how strong the score is.
kozakHeatmap( seqs, rate, start = 1, stop = max(nchar(seqs)), center = ceiling((stop - start + 1)/2), min.observations = ">q1", skip.startCodon = FALSE, xlab = "TIS", type = "ribo-seq" )kozakHeatmap( seqs, rate, start = 1, stop = max(nchar(seqs)), center = ceiling((stop - start + 1)/2), min.observations = ">q1", skip.startCodon = FALSE, xlab = "TIS", type = "ribo-seq" )
seqs |
the sequences (character vector, DNAStringSet) |
rate |
a scoring vector (equal size to seqs) |
start |
position in seqs to start at (first is 1), default 1. |
stop |
position in seqs to stop at (first is 1), default max(nchar(seqs)), that is the longest sequence length |
center |
position in seqs to center at (first is 1), center will be +1 in heatmap |
min.observations |
How many observations per position per letter to accept? numeric or quantile, default (">q1", bigger than quartile 1 (25 percentile)). You can do (10), to get all with more than 10 observations. |
skip.startCodon |
startCodon is defined as after centering (position 1, 2 and 3). Should they be skipped ? default (FALSE). Not relevant if you are not doing Translation initiation sites (TIS). |
xlab |
Region you are checking, default (TIS) |
type |
What type is the rate scoring ? default (ribo-seq) |
It will create blocks around the highest rate per position
a ggplot of the heatmap
## Not run: if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") #Extract sequences of Coding sequences. cds <- loadRegion(txdbFile, "cds") tx <- loadRegion(txdbFile, "mrna") # Get region to check kozakRegions <- startRegionString(cds, tx, BSgenome.Hsapiens.UCSC.hg19::Hsapiens , upstream = 4, 5) # Some toy ribo-seq fpkm scores on cds set.seed(3) fpkm <- sample(1:115, length(cds), replace = TRUE) kozakHeatmap(kozakRegions, fpkm, 1, 9, skip.startCodon = F) } ## End(Not run)## Not run: if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") #Extract sequences of Coding sequences. cds <- loadRegion(txdbFile, "cds") tx <- loadRegion(txdbFile, "mrna") # Get region to check kozakRegions <- startRegionString(cds, tx, BSgenome.Hsapiens.UCSC.hg19::Hsapiens , upstream = 4, 5) # Some toy ribo-seq fpkm scores on cds set.seed(3) fpkm <- sample(1:115, length(cds), replace = TRUE) kozakHeatmap(kozakRegions, fpkm, 1, 9, skip.startCodon = F) } ## End(Not run)
The closer the sequence is to the Kozak sequence the higher the score, based on the experimental pwms from article referenced. Minimum score is 0 (worst correlation), max is 1 (the best base per column was chosen).
kozakSequenceScore(grl, tx, faFile, species = "human", include.N = FALSE)kozakSequenceScore(grl, tx, faFile, species = "human", include.N = FALSE)
grl |
a |
tx |
a |
faFile |
|
species |
("human"), which species to use, currently supports human (Homo sapiens), zebrafish (Danio rerio) and mouse (Mus musculus). Both scientific or common name for these species will work. You can also specify a pfm for your own species. Syntax of pfm is an rectangular integer matrix, where all columns must sum to the same value, normally 100. See example for more information. Rows are in order: c("A", "C", "G", "T") |
include.N |
logical (F), if TRUE, allow N bases to be counted as hits, score will be average of the other bases. If True, N bases will be added to pfm, automaticly, so dont include them if you make your own pfm. |
Ranges that does not have minimum 15 length (the kozak requirement as a sliding window of size 15 around grl start), will be set to score 0. Since they should not have the posibility to make an efficient ribosome binding.
a numeric vector with values between 0 and 1
an integer vector, one score per orf
doi: https://doi.org/10.1371/journal.pone.0108475
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
# Usually the ORFs are found in orfik, which makes names for you etc. # Here we make an example from scratch seqName <- "Chromosome" ORF1 <- GRanges(seqnames = seqName, ranges = IRanges(c(1007, 1096), width = 60), strand = c("+", "+")) ORF2 <- GRanges(seqnames = seqName, ranges = IRanges(c(400, 100), width = 30), strand = c("-", "-")) ORFs <- GRangesList(tx1 = ORF1, tx2 = ORF2) ORFs <- makeORFNames(ORFs) # need ORF names tx <- extendLeaders(ORFs, 100) # get faFile for sequences faFile <- FaFile(system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik")) kozakSequenceScore(ORFs, tx, faFile) # For more details see vignettes.# Usually the ORFs are found in orfik, which makes names for you etc. # Here we make an example from scratch seqName <- "Chromosome" ORF1 <- GRanges(seqnames = seqName, ranges = IRanges(c(1007, 1096), width = 60), strand = c("+", "+")) ORF2 <- GRanges(seqnames = seqName, ranges = IRanges(c(400, 100), width = 30), strand = c("-", "-")) ORFs <- GRangesList(tx1 = ORF1, tx2 = ORF2) ORFs <- makeORFNames(ORFs) # need ORF names tx <- extendLeaders(ORFs, 100) # get faFile for sequences faFile <- FaFile(system.file("extdata/references/danio_rerio", "genome_dummy.fasta", package = "ORFik")) kozakSequenceScore(ORFs, tx, faFile) # For more details see vignettes.
Get last end per granges group
lastExonEndPerGroup(grl, keep.names = TRUE)lastExonEndPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
a Rle(keep.names = T), or integer vector(F)
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) lastExonEndPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) lastExonEndPerGroup(grl)
grl must be sorted, call ORFik:::sortPerGroup if needed
lastExonPerGroup(grl)lastExonPerGroup(grl)
grl |
a GRangesList of the last exon per group
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) lastExonPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) lastExonPerGroup(grl)
Get last start per granges group
lastExonStartPerGroup(grl, keep.names = TRUE)lastExonStartPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
a Rle(keep.names = T), or integer vector(F)
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) lastExonStartPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) lastExonStartPerGroup(grl)
Number of chromosomes
## S4 method for signature 'covRle' length(x)## S4 method for signature 'covRle' length(x)
x |
a covRle object |
an integer, number of chromosomes in covRle object
Number of covRle objects
## S4 method for signature 'covRleList' length(x)## S4 method for signature 'covRleList' length(x)
x |
a covRleList object |
an integer, number of covRle objects
Faster version than S4Vector generic caller
## S4 method for signature 'GRangesList' length(x)## S4 method for signature 'GRangesList' length(x)
x |
a GRangesList |
an integer (length 1)
Lengths of each chromosome
## S4 method for signature 'covRle' lengths(x)## S4 method for signature 'covRle' lengths(x)
x |
a covRle object |
a named integer vector of chromosome lengths
Lengths of each chromosome
## S4 method for signature 'covRleList' lengths(x)## S4 method for signature 'covRleList' lengths(x)
x |
a covRle object |
a named integer vector of chromosome lengths
Get path to ORFik experiment library folder
libFolder(x, mode = "first", unique_mappers = uniqueMappers(x))libFolder(x, mode = "first", unique_mappers = uniqueMappers(x))
x |
an ORFik |
mode |
character, default "first". Alternatives: "unique", "all". Unique means the unique directories, not to be confused with unique_mappers argument below. |
unique_mappers |
logical, default uniqueMappers(x) If true appends unique_mappers to path |
a character path
Get path to ORFik experiment library folder
## S4 method for signature 'experiment' libFolder(x, mode = "first", unique_mappers = uniqueMappers(x))## S4 method for signature 'experiment' libFolder(x, mode = "first", unique_mappers = uniqueMappers(x))
x |
an ORFik |
mode |
character, default "first". Alternatives: "unique", "all". Unique means the unique directories, not to be confused with unique_mappers argument below. |
unique_mappers |
logical, default uniqueMappers(x) If true appends unique_mappers to path |
a character path
experiment?Which type of library type in experiment?
libraryTypes(df, uniqueTypes = TRUE)libraryTypes(df, uniqueTypes = TRUE)
df |
an ORFik |
uniqueTypes |
logical, default TRUE. Only return unique lib types. |
library types (character vector)
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
df <- ORFik.template.experiment() libraryTypes(df) libraryTypes(df, uniqueTypes = FALSE)df <- ORFik.template.experiment() libraryTypes(df) libraryTypes(df, uniqueTypes = FALSE)
Will only search .csv extension, also exclude any experiment with the word template.
list.experiments( dir = ORFik::config()["exp"], pattern = "*", libtypeExclusive = NULL, validate = TRUE, BPPARAM = if (!validate) { BiocParallel::SerialParam() } else BiocParallel::bpparam() )list.experiments( dir = ORFik::config()["exp"], pattern = "*", libtypeExclusive = NULL, validate = TRUE, BPPARAM = if (!validate) { BiocParallel::SerialParam() } else BiocParallel::bpparam() )
dir |
directory for ORFik experiments: default: ORFik::config()["exp"], which by default is: "~/Bio_data/ORFik_experiments/" |
pattern |
allowed patterns in experiment file name: default ("*", all experiments) |
libtypeExclusive |
search for experiments with exclusivly this libtype, default (NULL, all) |
validate |
logical, default TRUE. Abort if any library files does not exist. Do not set this to FALSE, unless you know what you are doing! |
BPPARAM |
how many cores/threads to use? Default single thread
if validate is FALSE, else use bpparam.
default: |
a data.table, 1 row per experiment with columns:
- experiment (name),
- organism
- author
- libtypes
- number of samples
## Make your experiments df <- ORFik.template.experiment(TRUE) df2 <- df[1:6,] # Only first 2 libs ## Save them # save.experiment(df, "~/Bio_data/ORFik_experiments/exp1.csv") # save.experiment(df2, "~/Bio_data/ORFik_experiments/exp1_subset.csv") ## List all experiment you have: ## Path above is default path, so no dir argument needed #list.experiments() #list.experiments(pattern = "subset") ## For non default directory experiments #list.experiments(dir = "MY/CUSTOM/PATH)## Make your experiments df <- ORFik.template.experiment(TRUE) df2 <- df[1:6,] # Only first 2 libs ## Save them # save.experiment(df, "~/Bio_data/ORFik_experiments/exp1.csv") # save.experiment(df2, "~/Bio_data/ORFik_experiments/exp1_subset.csv") ## List all experiment you have: ## Path above is default path, so no dir argument needed #list.experiments() #list.experiments(pattern = "subset") ## For non default directory experiments #list.experiments(dir = "MY/CUSTOM/PATH)
Given the reference.folder, list all valid references. An ORFik genome is defined as a folder with a file called output.rds that is a named R vector with names gtf and genome, where the values are character paths to those files inside that folder. This makes sure that this reference was made by ORFik and not some other program.
list.genomes(reference.folder = ORFik::config()["ref"])list.genomes(reference.folder = ORFik::config()["ref"])
reference.folder |
character path, default:
|
a data.table with 5 columns:
- character (name of folder)
- logical (does it have a gtf)
- logical (does it have a fasta genome)
- logical (does it have a STAR index)
- logical (only displayed if some are TRUE, does it have protein structure
predictions of ORFs from alphafold etc, in folder called
'protein_structure_predictions')
- logical (only displayed if some are TRUE, does it have gene symbol fst file
from bioMart etc, in file called 'gene_symbol_tx_table.fst')
## Run with default config path #list.genomes() ## Run with custom config path list.genomes(tempdir()) ## Get the path to fasta genome of first organism in list #readRDS(file.path(config()["ref"], list.genomes()$name, "outputs.rds")[1])["genome"]## Run with default config path #list.genomes() ## Run with custom config path list.genomes(tempdir()) ## Get the path to fasta genome of first organism in list #readRDS(file.path(config()["ref"], list.genomes()$name, "outputs.rds")[1])["genome"]
Usefull to simplify loading of standard regions, like cds' and leaders. Adds another safety in that seqlevels will be set
loadRegion( txdb, part = "tx", names.keep = NULL, by = "tx", skip.optimized = FALSE )loadRegion( txdb, part = "tx", names.keep = NULL, by = "tx", skip.optimized = FALSE )
txdb |
a TxDb object, ORFik experiment object or a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite), Only in the loadRegion function: if it is a GRangesList, it will return it self. |
part |
a character, one of: tx, ncRNA, mrna, leader, cds, trailer, intron, NOTE: difference between tx and mrna is that tx are all transcripts, while mrna are all transcripts with a cds, respectivly ncRNA are all tx without a cds. |
names.keep |
a character vector of subset of names to keep. Example: loadRegions(txdb, names = "ENST1000005"), will return only that transcript. Remember if you set by to "gene", then this list must be with gene names. |
by |
a character, default "tx" Either "tx" or "gene". What names to output region by, the transcript name "tx" or gene names "gene". NOTE: this is not the same as cdsBy(txdb, by = "gene"), cdsBy would then only give 1 cds per Gene, loadRegion gives all isoforms, but with gene names. |
skip.optimized |
logical, default FALSE. If TRUE, will not search for optimized rds files to load created from ORFik::makeTxdbFromGenome(..., optimize = TRUE). The optimized files are ~ 100x faster to load for human genome. |
Load as GRangesList if input is not already GRangesList.
a GRangesList of region
# GTF file is slow, but possible to use gtf <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadTxdb(gtf) loadRegion(txdb, "cds") loadRegion(txdb, "intron") # Use txdb from experiment df <- ORFik.template.experiment() txdb <- loadTxdb(df) loadRegion(txdb, "leaders") # Use ORFik experiment directly loadRegion(df, "mrna")# GTF file is slow, but possible to use gtf <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadTxdb(gtf) loadRegion(txdb, "cds") loadRegion(txdb, "intron") # Use txdb from experiment df <- ORFik.template.experiment() txdb <- loadTxdb(df) loadRegion(txdb, "leaders") # Use ORFik experiment directly loadRegion(df, "mrna")
By default loads all parts to .GlobalEnv (global environemnt) Useful to not spend time on finding the functions to load regions.
loadRegions( txdb, parts = c("mrna", "leaders", "cds", "trailers"), extension = "", names.keep = NULL, by = "tx", skip.optimized = FALSE, envir = .GlobalEnv )loadRegions( txdb, parts = c("mrna", "leaders", "cds", "trailers"), extension = "", names.keep = NULL, by = "tx", skip.optimized = FALSE, envir = .GlobalEnv )
txdb |
a TxDb file, a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite) or an ORFik experiment |
parts |
the transcript parts you want, default:
c("mrna", "leaders", "cds", "trailers"). |
extension |
What to add on the name after leader, like: B -> leadersB |
names.keep |
a character vector of subset of names to keep. Example: loadRegions(txdb, names = "ENST1000005"), will return only that transcript. Remember if you set by to "gene", then this list must be with gene names. |
by |
a character, default "tx" Either "tx" or "gene". What names to output region by, the transcript name "tx" or gene names "gene". NOTE: this is not the same as cdsBy(txdb, by = "gene"), cdsBy would then only give 1 cds per Gene, loadRegion gives all isoforms, but with gene names. |
skip.optimized |
logical, default FALSE. If TRUE, will not search for optimized rds files to load created from ORFik::makeTxdbFromGenome(..., optimize = TRUE). The optimized files are ~ 100x faster to load for human genome. |
envir |
Which environment to save to, default: .GlobalEnv |
invisible(NULL) (regions saved in envir)
# Load all mrna regions to Global environment gtf <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") loadRegions(gtf, parts = c("mrna", "leaders", "cds", "trailers"))# Load all mrna regions to Global environment gtf <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") loadRegions(gtf, parts = c("mrna", "leaders", "cds", "trailers"))
Like rRNA, snoRNA etc. NOTE: Only works on gtf/gff, not .db object for now. Also note that these anotations are not perfect, some rRNA annotations only contain 5S rRNA etc. If your gtf does not contain evertyhing you need, use a resource like repeatmasker and download a gtf: https://genome.ucsc.edu/cgi-bin/hgTables
loadTranscriptType(object, part = "rRNA", tx = NULL)loadTranscriptType(object, part = "rRNA", tx = NULL)
object |
a TxDb, ORFik experiment or path to gtf/gff, |
part |
a character, default rRNA. Can also be: snoRNA, tRNA etc. As long as that biotype is defined in the gtf. |
tx |
a GRangesList of transcripts (Optional, default NULL, all transcript of that type), else it must be names a list to subset on. |
a GRangesList of transcript of that type
doi: 10.1002/0471250953.bi0410s25
gtf <- "path/to.gtf" #loadTranscriptType(gtf, part = "rRNA") #loadTranscriptType(gtf, part = "miRNA")gtf <- "path/to.gtf" #loadTranscriptType(gtf, part = "rRNA") #loadTranscriptType(gtf, part = "miRNA")
Useful to allow fast TxDb loader like .db
loadTxdb(txdb, chrStyle = NULL, organism = NA, chrominfo = NULL)loadTxdb(txdb, chrStyle = NULL, organism = NA, chrominfo = NULL)
txdb |
a TxDb file, a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite) or an ORFik experiment |
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
organism |
character, default NA. Scientific name of organism. Only used if input is path to gff. |
chrominfo |
Seqinfo object, default NULL. Only used if input is path to gff. |
a TxDb object
library(GenomicFeatures) # Get the gtf txdb file txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadTxdb(txdbFile)library(GenomicFeatures) # Get the gtf txdb file txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") txdb <- loadTxdb(txdbFile)
Rule: if seqname, strand and stop site is equal, take longest one. Else keep. If IRangesList or IRanges, seqnames are groups, if GRanges or GRangesList seqnames are the seqlevels (e.g. chromosomes/transcripts)
longestORFs(grl)longestORFs(grl)
grl |
a |
a GRangesList/IRangesList, GRanges/IRanges
(same as input)
Other ORFHelpers:
defineTrailer(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopCodons(),
stopSites(),
txNames(),
uniqueGroups(),
uniqueOrder()
ORF1 = GRanges("1", IRanges(10,21), "+") ORF2 = GRanges("1", IRanges(1,21), "+") # <- longest grl <- GRangesList(ORF1 = ORF1, ORF2 = ORF2) longestORFs(grl) # get only longestORF1 = GRanges("1", IRanges(10,21), "+") ORF2 = GRanges("1", IRanges(1,21), "+") # <- longest grl <- GRangesList(ORF1 = ORF1, ORF2 = ORF2) longestORFs(grl) # get only longest
Faster version (also less safe) of makeGRangesFromDataFrame
makeGRangesFromDataFrameFast(df, keep.extra.columns = TRUE, seqinfo = NULL)makeGRangesFromDataFrameFast(df, keep.extra.columns = TRUE, seqinfo = NULL)
df |
a data.frame/data.table with columns minimum 4 columns:
seqnames, start, strand |
keep.extra.columns |
logical, default TRUE, keep meta cols. |
seqinfo |
Seqinfo object, defaul NULL (created from ranges). Add to avoid warnings later on differences in seqinfo. |
GRanges object
df <- data.frame(start = rep(1L, 1e5), end = 10L, strand = "+", seqnames = "1") system.time(res <- makeGRangesFromDataFrame(df)) system.time(res_fast <- makeGRangesFromDataFrameFast(df)) identical(res, res_fast) # Use width instead of end, does not work in original df2 <- data.frame(start = rep(1L, 1e5), width = 10L, strand = "+", seqnames = "1") system.time(makeGRangesFromDataFrameFast(df2)) df_small <- data.frame(start = 1L, end = 10L, strand = "+", seqnames = "1") system.time(res <- makeGRangesFromDataFrame(df_small)) system.time(res_fast <- makeGRangesFromDataFrameFast(df_small)) identical(res, res_fast)df <- data.frame(start = rep(1L, 1e5), end = 10L, strand = "+", seqnames = "1") system.time(res <- makeGRangesFromDataFrame(df)) system.time(res_fast <- makeGRangesFromDataFrameFast(df)) identical(res, res_fast) # Use width instead of end, does not work in original df2 <- data.frame(start = rep(1L, 1e5), width = 10L, strand = "+", seqnames = "1") system.time(makeGRangesFromDataFrameFast(df2)) df_small <- data.frame(start = 1L, end = 10L, strand = "+", seqnames = "1") system.time(res <- makeGRangesFromDataFrame(df_small)) system.time(res_fast <- makeGRangesFromDataFrameFast(df_small)) identical(res, res_fast)
Convert a character vector to GRangesList
makeGRangesListFromCharacter(x)makeGRangesListFromCharacter(x)
x |
a character vector |
a GRangesList
vec <- c("1:14598834-14598914:+", "1:15210514-15210562:+;1:15214895-15215025:+") makeGRangesListFromCharacter(vec)vec <- c("1:14598834-14598914:+", "1:15210514-15210562:+;1:15214895-15215025:+") makeGRangesListFromCharacter(vec)
grl must be grouped by transcript If a list of orfs are grouped by transcripts, but does not have ORF names, then create them and return the new GRangesList
makeORFNames(grl, groupByTx = TRUE)makeORFNames(grl, groupByTx = TRUE)
grl |
|
groupByTx |
logical (T), should output GRangesList be grouped by transcripts (T) or by ORFs (F)? |
(GRangesList) with ORF names, grouped by transcripts, sorted.
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) makeORFNames(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) makeORFNames(grl)
Make a summerizedExperiment / matrix object from bam files or other library formats sepcified by lib.type argument. Works like HTSeq, to give you count tables per library.
makeSummarizedExperimentFromBam( df, saveName = NULL, longestPerGene = FALSE, geneOrTxNames = "tx", region = "mrna", type = "count", lib.type = "ofst", weight = "score", forceRemake = FALSE, force = TRUE, library.names = bamVarName(df), libraries = outputLibs(df, chrStyle = seqinfo(df), paths = filepath(df, lib.type), type = lib.type, force = force, library.names = library.names, BPPARAM = BPPARAM), format = "qs", BPPARAM = BiocParallel::SerialParam() )makeSummarizedExperimentFromBam( df, saveName = NULL, longestPerGene = FALSE, geneOrTxNames = "tx", region = "mrna", type = "count", lib.type = "ofst", weight = "score", forceRemake = FALSE, force = TRUE, library.names = bamVarName(df), libraries = outputLibs(df, chrStyle = seqinfo(df), paths = filepath(df, lib.type), type = lib.type, force = force, library.names = library.names, BPPARAM = BPPARAM), format = "qs", BPPARAM = BiocParallel::SerialParam() )
df |
an ORFik |
saveName |
a character (default NULL), if set save experiment to path given. Always saved as .rds., it is optional to add .rds, it will be added for you if not present. Also used to load existing file with that name. |
longestPerGene |
a logical (default FALSE), if FALSE all transcript isoforms per gene. Ignored if "region" is not a character of either: "mRNA","tx", "cds", "leaders" or "trailers". |
geneOrTxNames |
a character vector (default "tx"), should row names keep trancript names ("tx") or change to gene names ("gene") |
region |
a character vector (default: "mrna"), make raw count matrices
of whole mrnas or one of (leaders, cds, trailers).
Can also be a |
type |
default: "count" (raw counts matrix), alternative is "fpkm", "log2fpkm" or "log10fpkm" |
lib.type |
a character(default: "default"), load files in experiment or some precomputed variant, either "ofst", "pshifted" or "cov" These are made with ORFik:::convertLibs() or shiftFootprintsByExperiment(). Can also be custom user made folders inside the experiments bam folder. Format "cov" (i.e. covRle format) is by far the fastest to use if existing. |
weight |
numeric or character, a column to score overlaps by. Default "score", will check for a metacolumn called "score" in libraries. If not found, will not use weights. |
forceRemake |
logical, default FALSE. If TRUE, will not look for existing file count table files. |
force |
logical, default TRUE If TRUE, reload library files even if
matching named variables are found in environment used by experiment
(see |
library.names |
character, default: bamVarName(df). Names to load libraries as to environment and names to display in plots. |
libraries |
The call to output libraries, the input is not used! Default:
|
format |
character, default "qs", alternative: "rds". Which format to save summarizedExperiment. |
BPPARAM |
how many cores/threads to use? default: BiocParallel::SerialParam() |
If txdb or gtf path is added, it is a rangedSummerizedExperiment
NOTE: If the file called saveName exists, it will then load file,
not remake it!
There are different ways of counting hits on transcripts, ORFik does
it as pure coverage (if a single read aligns to a region with 2 genes, both
gets a count of 1 from that read).
This is the safest way to avoid false negatives
(genes with no assigned hits that actually have true hits).
a SummarizedExperiment object or data.table if
"type" is not "count, with rownames as transcript / gene names.
##Make experiment df <- ORFik.template.experiment() # makeSummarizedExperimentFromBam(df) ## Only cds (coding sequences): # makeSummarizedExperimentFromBam(df, region = "cds") ## FPKM instead of raw counts on whole mrna regions # makeSummarizedExperimentFromBam(df, type = "fpkm") ## Make count tables of pshifted libraries over uORFs uorfs <- GRangesList(uorf1 = GRanges("chr23", 17599129:17599156, "-")) #saveName <- file.path(dirname(df$filepath[1]), "uORFs", "countTable_uORFs") #makeSummarizedExperimentFromBam(df, saveName, region = uorfs) ## To load the uORFs later # countTable(df, region = "uORFs", count.folder = "uORFs")##Make experiment df <- ORFik.template.experiment() # makeSummarizedExperimentFromBam(df) ## Only cds (coding sequences): # makeSummarizedExperimentFromBam(df, region = "cds") ## FPKM instead of raw counts on whole mrna regions # makeSummarizedExperimentFromBam(df, type = "fpkm") ## Make count tables of pshifted libraries over uORFs uorfs <- GRangesList(uorf1 = GRanges("chr23", 17599129:17599156, "-")) #saveName <- file.path(dirname(df$filepath[1]), "uORFs", "countTable_uORFs") #makeSummarizedExperimentFromBam(df, saveName, region = uorfs) ## To load the uORFs later # countTable(df, region = "uORFs", count.folder = "uORFs")
Make Gene symbols from txdb
makeSymbols( txdb, symbols_file_out_path = file.path(dirname(getGtfPathFromTxdb(txdb, stop.error = TRUE)), "gene_symbol_tx_table.fst"), uniprot_id = FALSE )makeSymbols( txdb, symbols_file_out_path = file.path(dirname(getGtfPathFromTxdb(txdb, stop.error = TRUE)), "gene_symbol_tx_table.fst"), uniprot_id = FALSE )
txdb |
a TxDb file, a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite) or an ORFik experiment |
symbols_file_out_path |
path to save, default |
uniprot_id |
logical default FALSE. If TRUE, will download and store all uniprot id for all transcripts (coding and noncoding)- In a file called: "gene_symbol_tx_table.fst" in same folder as txdb. |
the data.table of tx_ids, gene_ids and gene symbols
Make a Txdb with defined seqlevels and seqlevelsstyle from the fasta genome. This makes it more fail safe than standard Txdb creation. Example is that you can not create a coverage window outside the chromosome boundary, this is only possible if you have set the seqlengths.
makeTxdbFromGenome( gtf, genome = NULL, organism, optimize = FALSE, gene_symbols = FALSE, uniprot_id = FALSE, pseudo_5UTRS_if_needed = NULL, minimum_5UTR_percentage = 30, return = is.null(txdb_file_out_path), txdb_file_out_path = paste0(gtf, ".db"), symbols_file_out_path = file.path(dirname(gtf), "gene_symbol_tx_table.fst") )makeTxdbFromGenome( gtf, genome = NULL, organism, optimize = FALSE, gene_symbols = FALSE, uniprot_id = FALSE, pseudo_5UTRS_if_needed = NULL, minimum_5UTR_percentage = 30, return = is.null(txdb_file_out_path), txdb_file_out_path = paste0(gtf, ".db"), symbols_file_out_path = file.path(dirname(gtf), "gene_symbol_tx_table.fst") )
gtf |
path to gtf file |
genome |
character, default NULL. Path to fasta genome corresponding to the gtf. If NULL, can not set seqlevels. If value is NULL or FALSE, it will be ignored. |
organism |
Scientific name of organism, first letter must be capital! Example: Homo sapiens. Will force first letter to capital and convert any "_" (underscore) to " " (space) |
optimize |
logical, default FALSE. Create a folder within the output folder (defined by txdb_file_out_path), that includes optimized objects to speed up loading of annotation regions from up to 15 seconds on human genome down to 0.1 second. ORFik will then load these optimized objects instead. Currently optimizes filterTranscript() function and loadRegion() function for 5' UTRs, 3' UTRs, CDS, mRNA (all transcript with CDS) and tx (all transcripts). |
gene_symbols |
logical default FALSE. If TRUE, will download and store all gene symbols for all transcripts (coding and noncoding)- In a file called: "gene_symbol_tx_table.fst" in same folder as txdb. hgcn for human, mouse symbols for mouse and rat, more to be added. |
uniprot_id |
logical default FALSE. If TRUE, will download and store all uniprot id for all transcripts (coding and noncoding)- In a file called: "gene_symbol_tx_table.fst" in same folder as txdb. |
pseudo_5UTRS_if_needed |
integer, default NULL. If defined > 0, will add pseudo 5' UTRs of maximum this length if 'minimum_5UTR_percentage" (default 30 mRNAs (coding transcripts) do not have a leader. (NULL and 0 are both the ignore command) |
minimum_5UTR_percentage |
numeric, default 30. What minimum percentage of mRNAs most have a 5' UTRs (leaders), to not do the pseudo_UTR addition. If percentage is higher, addition is ignored, set to 101 to always do it. |
return |
logical, default FALSE. If TRUE, return TXDB object, else invisible(NULL). |
txdb_file_out_path |
character path, default paste0(gtf, ".db"). Set to NULL to not write file to disc. |
symbols_file_out_path |
character path, default file.path(dirname(gtf), "gene_symbol_tx_table.fst"). Must be defined as character if "gene_symbols" is TRUE. Ignored if "gene_symbols" is FALSE. |
logical, default is.null(txdb_file_out_path), Txdb saved to disc named default paste0(gtf, ".db"). Set 'return' argument to TRUE, to also get txdb back as an object.
gtf <- "/path/to/local/annotation.gtf" genome <- "/path/to/local/genome.fasta" #makeTxdbFromGenome(gtf, genome, organism = "Saccharomyces cerevisiae") # Runnable full example df <- ORFik.template.experiment() gtf <- sub("\\.db$", "", df@txdb) genome <- df@fafile txdb <- makeTxdbFromGenome(gtf, genome, organism = "Saccharomyces cerevisiae", txdb_file_out_path = NULL) ## Add pseudo UTRs if needed (< 30% of cds have a defined 5'UTR)gtf <- "/path/to/local/annotation.gtf" genome <- "/path/to/local/genome.fasta" #makeTxdbFromGenome(gtf, genome, organism = "Saccharomyces cerevisiae") # Runnable full example df <- ORFik.template.experiment() gtf <- sub("\\.db$", "", df@txdb) genome <- df@fafile txdb <- makeTxdbFromGenome(gtf, genome, organism = "Saccharomyces cerevisiae", txdb_file_out_path = NULL) ## Add pseudo UTRs if needed (< 30% of cds have a defined 5'UTR)
Will use multithreading to speed up process. Only works for Unix OS (Linux and Mac)
mergeFastq(in_files_by_out_file_list, BPPARAM = bpparam())mergeFastq(in_files_by_out_file_list, BPPARAM = bpparam())
in_files_by_out_file_list |
|
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
invisible(NULL).
# Make small example fastq files fastq.folder <- tempdir() # <- Your fastq files # Seperate files into groups (here it is 4 output files from 12 input files) in_files <- paste0(LETTERS[1:16], ".fastq.gz") in_files <- file.path(fastq.folder, in_files) samples_dna_letters <- vapply(seq_along(in_files), function(x) paste(sample(DNA_ALPHABET[1:4], 12, replace = TRUE), collapse = ""), character(1)) # Write example input files to temp lapply(seq_along(in_files), function(i) { seq <- DNAStringSet(samples_dna_letters[i]) names(seq) <- basename(in_files[i]) writeXStringSet(seq, in_files[i]) }) out_files <- paste0(c("SSU_ribopool", "LSU_ribopool", "SSU_WT", "LSU_WT"), ".fastq.gz") merged.fastq.folder <- file.path(fastq.folder, "merged/") out_files <- file.path(merged.fastq.folder, out_files) in_files_by_out_file_list <- split(in_files, rep(out_files, each = 4)) mergeFastq(in_files_by_out_file_list, BiocParallel::SerialParam()) lapply(out_files, readDNAStringSet)# Make small example fastq files fastq.folder <- tempdir() # <- Your fastq files # Seperate files into groups (here it is 4 output files from 12 input files) in_files <- paste0(LETTERS[1:16], ".fastq.gz") in_files <- file.path(fastq.folder, in_files) samples_dna_letters <- vapply(seq_along(in_files), function(x) paste(sample(DNA_ALPHABET[1:4], 12, replace = TRUE), collapse = ""), character(1)) # Write example input files to temp lapply(seq_along(in_files), function(i) { seq <- DNAStringSet(samples_dna_letters[i]) names(seq) <- basename(in_files[i]) writeXStringSet(seq, in_files[i]) }) out_files <- paste0(c("SSU_ribopool", "LSU_ribopool", "SSU_WT", "LSU_WT"), ".fastq.gz") merged.fastq.folder <- file.path(fastq.folder, "merged/") out_files <- file.path(merged.fastq.folder, out_files) in_files_by_out_file_list <- split(in_files, rep(out_files, each = 4)) mergeFastq(in_files_by_out_file_list, BiocParallel::SerialParam()) lapply(out_files, readDNAStringSet)
Aggregate count of reads (from the "score" column) by making a merged library. Only allowed for .ofst files!
mergeLibs( df, out_dir = file.path(libFolder(df), "ofst_merged"), mode = "all", type = "ofst", keep_all_scores = TRUE, paths = filepath(df, type), lib_names_full = bamVarName(df, skip.libtype = FALSE), max_splits = 20 )mergeLibs( df, out_dir = file.path(libFolder(df), "ofst_merged"), mode = "all", type = "ofst", keep_all_scores = TRUE, paths = filepath(df, type), lib_names_full = bamVarName(df, skip.libtype = FALSE), max_splits = 20 )
df |
an ORFik |
out_dir |
Ouput directory, default |
mode |
character, default "all". Merge all or "rep" for collapsing replicates only, or "lib" for collapsing all per library type. |
type |
a character(default: "default"), load files in experiment
or some precomputed variant, like "ofst" or "pshifted".
These are made with ORFik:::convertLibs(),
shiftFootprintsByExperiment(), etc.
Can also be custom user made folders inside the experiments bam folder.
It acts in a recursive manner with priority: If you state "pshifted",
but it does not exist, it checks "ofst". If no .ofst files, it uses
"default", which always must exists. |
keep_all_scores |
logical, default TRUE, keep all library scores in the merged file. These
score columns are named the libraries full name from |
paths |
character vector, the filpaths to use,
default |
lib_names_full |
character vector, default: bamVarName(df, skip.libtype = FALSE). Name to assign to single libraries inside merged file, only kept if mode != "all" |
max_splits |
integer, default 20. If number of rows to merge > 2^31, how many times can you allow split merging to try to "rescue" the merging process? |
NULL, files saved to disc. A data.table with a score column that now contains the sum of scores per merge setting.
df2 <- ORFik.template.experiment() df2 <- df2[df2$libtype == "RFP",] # Merge all mergeLibs(df2, tempdir(), mode = "all", type = "default") # Read as GRanges with mcols fimport(file.path(tempdir(), "all.ofst")) # Only keep total score, Read as direct fst data.table mergeLibs(df2, tempdir(), mode = "all", type = "default", keep_all_scores = FALSE) fst::read_fst(file.path(tempdir(), "all.ofst")) # Collapse replicates mergeLibs(df2, tempdir(), mode = "rep", type = "default") paths <- file.path(tempdir(), paste0("RFP_", c("Mutant", "WT"), ".ofst")) lapply(paths, fimport) # Collapse by lib types (same as "all" in this case) #mergeLibs(df2, tempdir(), mode = "lib", type = "default")df2 <- ORFik.template.experiment() df2 <- df2[df2$libtype == "RFP",] # Merge all mergeLibs(df2, tempdir(), mode = "all", type = "default") # Read as GRanges with mcols fimport(file.path(tempdir(), "all.ofst")) # Only keep total score, Read as direct fst data.table mergeLibs(df2, tempdir(), mode = "all", type = "default", keep_all_scores = FALSE) fst::read_fst(file.path(tempdir(), "all.ofst")) # Collapse replicates mergeLibs(df2, tempdir(), mode = "rep", type = "default") paths <- file.path(tempdir(), paste0("RFP_", c("Mutant", "WT"), ".ofst")) lapply(paths, fimport) # Collapse by lib types (same as "all" in this case) #mergeLibs(df2, tempdir(), mode = "lib", type = "default")
Guess SRA metadata columns
metadata.autnaming(file)metadata.autnaming(file)
file |
a data.table of SRA metadata |
a data.table of SRA metadata with additional columns: LIBRARYTYPE, REPLICATE, STAGE, CONDITION, INHIBITOR
Sums up coverage over set of GRanges objects as a meta representation.
metaWindow( x, windows, scoring = "sum", withFrames = FALSE, zeroPosition = NULL, scaleTo = 100, fraction = NULL, feature = NULL, forceUniqueEven = !is.null(scoring), forceRescale = TRUE, weight = "score", drop.zero.dt = FALSE, append.zeroes = FALSE )metaWindow( x, windows, scoring = "sum", withFrames = FALSE, zeroPosition = NULL, scaleTo = 100, fraction = NULL, feature = NULL, forceUniqueEven = !is.null(scoring), forceRescale = TRUE, weight = "score", drop.zero.dt = FALSE, append.zeroes = FALSE )
x |
GRanges/GAlignment object of your reads. Remember to resize them beforehand to width of 1 to focus on 5' ends of footprints etc, if that is wanted. |
windows |
GRangesList or GRanges of your ranges |
scoring |
a character, default: "sum", one of (zscore, transcriptNormalized, mean, median, sum, sumLength, NULL), see ?coverageScorings for info and more alternatives. |
withFrames |
a logical (TRUE), return positions with the 3 frames, relative to zeroPosition. zeroPosition is frame 0. |
zeroPosition |
an integer DEFAULT (NULL), the point if all windows are equal size, that should be set to position 0. Like leaders and cds combination, then 0 is the TIS and -1 is last base in leader. NOTE!: if not all windows have equal width, this will be ignored. If all have equal width and zeroPosition is NULL, it is set to as.integer(width / 2). |
scaleTo |
an integer (100), if windows have different size, a meta window can not directly be created, since a meta window must have equal size for all windows. Rescale (bin) all windows to scaleTo. i.e c(1,2,3) -> size 2 -> coverage of position c(1, mean(2,3)) etc. |
fraction |
a character/integer (NULL), the fraction i.e (27) for read length 27, or ("LSU") for large sub-unit TCP-seq. |
feature |
a character string, info on region. Usually either gene name, transcript part like cds, leader, or CpG motifs etc. |
forceUniqueEven |
a logical (TRUE), if TRUE; require that all windows are of same width and even. To avoid bugs. FALSE if score is NULL. |
forceRescale |
logical, default TRUE. If TRUE, if
|
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
drop.zero.dt |
logical FALSE, if TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 positions are used in some sense. (mean, median, zscore coverage will only scale differently) |
append.zeroes |
logical, default FALSE. If TRUE and drop.zero.dt is TRUE and all windows have equal length, it will add back 0 values after transformation. Sometimes needed for correct plots, if TRUE, will call abort if not all windows are equal length! |
A data.table with scored counts (score) of reads mapped to positions (position) specified in windows along with frame (frame) per gene (genes) per library (fraction) per transcript region (feature). Column that does not apply is not given, but position and (score/count) is always returned.
Other coverage:
coverageScorings(),
regionPerReadLength(),
scaledWindowPositions(),
windowPerReadLength()
library(GenomicRanges) windows <- GRangesList(GRanges("chr1", IRanges(c(50, 100), c(80, 200)), "-")) x <- GenomicRanges::GRanges( seqnames = "chr1", ranges = IRanges::IRanges(c(100, 180), c(200, 300)), strand = "-") metaWindow(x, windows, withFrames = FALSE)library(GenomicRanges) windows <- GRangesList(GRanges("chr1", IRanges(c(50, 100), c(80, 200)), "-")) x <- GenomicRanges::GRanges( seqnames = "chr1", ranges = IRanges::IRanges(c(100, 180), c(200, 300)), strand = "-") metaWindow(x, windows, withFrames = FALSE)
The function extends stats::model.matrix.
## S4 method for signature 'experiment' model.matrix(object, design_formula = design(object, as.formula = TRUE))## S4 method for signature 'experiment' model.matrix(object, design_formula = design(object, as.formula = TRUE))
object |
an ORFik |
design_formula |
the experiment design, as formula, subset columns, to
change the model.matrix, default: |
a matrix with design and level attributes
df <- ORFik.template.experiment() model.matrix(df) # Single factor, default model.matrix(df, design(df, as.formula = TRUE, multi.factor = TRUE))df <- ORFik.template.experiment() model.matrix(df) # Single factor, default model.matrix(df, design(df, as.formula = TRUE, multi.factor = TRUE))
Get name of ORFik experiment
name(x)name(x)
x |
an ORFik |
character, name of experiment
Get name of ORFik experiment
## S4 method for signature 'experiment' name(x)## S4 method for signature 'experiment' name(x)
x |
an ORFik |
character, name of experiment
Faster version than S4Vector generic caller
## S4 method for signature 'GRangesList' names(x)## S4 method for signature 'GRangesList' names(x)
x |
a GRangesList |
a character vector
Faster version than S4Vector generic caller
## S4 replacement method for signature 'GRangesList' names(x) <- value## S4 replacement method for signature 'GRangesList' names(x) <- value
x |
a GRangesList |
value |
character vector of names |
a GRangesList with updated names
Internal nrow function for ORFik experiment Number of runs in experiment
## S4 method for signature 'experiment' nrow(x)## S4 method for signature 'experiment' nrow(x)
x |
an ORFik |
number of rows in experiment (integer)
Can also be used generaly to get number of GRanges object per GRangesList group
numExonsPerGroup(grl, keep.names = TRUE)numExonsPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a logical, keep names or not, default: (TRUE) |
an integer vector of counts
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) numExonsPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) numExonsPerGroup(grl)
Collapses and sums the score column of each ofst file It is required that each file is of same ofst type. That is if one file has cigar information, all must have it.
ofst_merge( file_paths, lib_names = sub("\\.ofst$", "", basename(file_paths)), keep_all_scores = TRUE, keepCigar = TRUE, sort = TRUE, max_splits = 20L, dt_max_index_size = 2^31 )ofst_merge( file_paths, lib_names = sub("\\.ofst$", "", basename(file_paths)), keep_all_scores = TRUE, keepCigar = TRUE, sort = TRUE, max_splits = 20L, dt_max_index_size = 2^31 )
file_paths |
Full path to .ofst files wanted to merge |
lib_names |
character, the name to give the resulting score columns.
Default: |
keep_all_scores |
logical, default TRUE, keep all library scores in the merged file. These
score columns are named the libraries full name from |
keepCigar |
logical, default TRUE. If CIGAR is defined, keep column. Setting to FALSE compresses the file much more usually. |
sort |
logical, default TRUE. Sort the ranges. Will make the file smaller and faster to load, but some additional merging time is added. |
max_splits |
integer, default 20. If number of rows to merge > 2^31, how many times can you allow split merging to try to "rescue" the merging process? |
dt_max_index_size |
2^31, the number of rows data.table support, set lower to merge split on lower counts |
a data.table of merged result, it is merged on all columns except "score". The returned file will contain the scores of each file + the aggregate sum score.
A speedup wrapper around transcriptLengths,
default load time of lengths is ~ 15 seconds, if ORFik fst
optimized lengths object has been made, load that file instead:
load time reduced to ~ 0.1 second.
optimizedTranscriptLengths( txdb, with.utr5_len = TRUE, with.utr3_len = TRUE, create.fst.version = FALSE, optimized_path = optimized_txdb_path(txdb, stop.error = FALSE) )optimizedTranscriptLengths( txdb, with.utr5_len = TRUE, with.utr3_len = TRUE, create.fst.version = FALSE, optimized_path = optimized_txdb_path(txdb, stop.error = FALSE) )
txdb |
a TxDb object, ORFik experiment object or a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite), Only in the loadRegion function: if it is a GRangesList, it will return it self. |
with.utr5_len |
logical TRUE, include length of 5' UTRs, ignored if .fst exists |
with.utr3_len |
logical TRUE, include length of 3' UTRs, ignored if .fst exists |
create.fst.version |
logical, FALSE. If TRUE, creates a .fst version
of the transcript length table (if it not already exists),
reducing load time from ~ 15 seconds to
~ 0.01 second next time you run filterTranscripts with this txdb object.
The file is stored in the
same folder as the genome this txdb is created from, with the name: |
optimized_path |
character, path to optimized txdb objects,
default: optimized_txdb_path(txdb, stop.error = FALSE). If no existing file,
will be slower and load lengths through |
a data.table of loaded lengths 8 columns, 1 row per transcript isoform.
dt <- optimizedTranscriptLengths(ORFik.template.experiment()) dt dt[cds_len > 0,] # All mRNAdt <- optimizedTranscriptLengths(ORFik.template.experiment()) dt dt[cds_len > 0,] # All mRNA
Much faster to load
optimizeTranscriptRegions( txdb, base_path = optimized_txdb_path(txdb, create.dir = TRUE), regions = c("tx", "mrna", "leaders", "cds", "trailers", "ncRNA") )optimizeTranscriptRegions( txdb, base_path = optimized_txdb_path(txdb, create.dir = TRUE), regions = c("tx", "mrna", "leaders", "cds", "trailers", "ncRNA") )
txdb |
a TxDb object, ORFik experiment object or a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite), Only in the loadRegion function: if it is a GRangesList, it will return it self. |
base_path |
Directy and file prefix for files, will append "_region.qs", where region is specific region. |
regions |
character, default: c("tx", "mrna", "leaders", "cds", "trailers", "ncRNA"). Valid options specified by loadRegion. |
invisible(NULL)
Per library: get coverage over CDS per frame per readlength Return as data.datable with information and best frame found. Can be used to automize re-shifting of read lengths (find read lengths where frame 0 is not the best frame over the entire cds)
orfFrameDistributions( df, type = "pshifted", weight = "score", orfs = loadRegion(df, part = "cds"), libraries = outputLibs(df, type = type, output.mode = "envirlist"), BPPARAM = BiocParallel::bpparam() )orfFrameDistributions( df, type = "pshifted", weight = "score", orfs = loadRegion(df, part = "cds"), libraries = outputLibs(df, type = type, output.mode = "envirlist"), BPPARAM = BiocParallel::bpparam() )
df |
an ORFik |
type |
type of library loaded, default pshifted, warning if not pshifted might crash if too many read lengths! |
weight |
which column in reads describe duplicates, default "score". |
orfs |
GRangesList, default loadRegion(df, part = "cds") |
libraries |
a list of loaded libraries, default: outputLibs(df, type = type, output.mode = "envirlist") |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
data.table with columns: fraction (library) frame (0, 1, 2) score (coverage) length (read length) percent (coverage percentage of library) percent_length (coverage percentage of library and length) best_frame (TRUE/FALSE, is this the best frame per length)
df <- ORFik.template.experiment()[9,] dt <- orfFrameDistributions(df, BPPARAM = BiocParallel::SerialParam()) ## Check that frame 0 is best frame for all all(dt[frame == 0,]$best_frame)df <- ORFik.template.experiment()[9,] dt <- orfFrameDistributions(df, BPPARAM = BiocParallel::SerialParam()) ## Check that frame 0 is best frame for all all(dt[frame == 0,]$best_frame)
Toy-data created to resemble human genes:
Number of genes: 6
Genome size: 1161nt x 6 chromosomes = 6966 nt
Experimental design (2 replicates, Wild type vs Mutant)
CAGE: 4 libraries
PAS (poly-A): 4 libraries
Ribo-seq: 4 libraries
RNA-seq: 4 libraries
ORFik.template.experiment(as.temp = FALSE)ORFik.template.experiment(as.temp = FALSE)
as.temp |
logical, default FALSE, load as ORFik experiment. If TRUE, loads as data.frame template of the experiment. |
an ORFik experiment
Other ORFik_experiment:
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
ORFik.template.experiment()ORFik.template.experiment()
Toy-data created to resemble Zebrafish genes:
Number of genes: 150
Ribo-seq: 1 library
ORFik.template.experiment.zf(as.temp = FALSE)ORFik.template.experiment.zf(as.temp = FALSE)
as.temp |
logical, default FALSE, load as ORFik experiment. If TRUE, loads as data.frame template of the experiment. |
an ORFik experiment
Other ORFik_experiment:
ORFik.template.experiment(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
ORFik.template.experiment.zf()ORFik.template.experiment.zf()
The ORFik QC uses the aligned files (usually bam files),
fastp and STAR log files
combined with annotation to create relevant statistics.
This report consists of several steps:
1. Convert bam file / Input files to ".ofst" format, if not already done.
This format is around 400x faster to use in R than the bam format.
Files are also outputted to R environment specified by envExp(df)
2. From this report you will get a summary csv table, with distribution of
aligned reads and overlap counts over transcript regions like:
leader, cds, trailer, lincRNAs, tRNAs, rRNAs, snoRNAs etc. It will be called
STATS.csv. And can be imported with QCstats function.
3. It will also make correlation plots and meta coverage plots,
so you get a good understanding of how good the quality of your NGS
data production + aligner step were.
4. Count tables are produced, similar to HTseq count tables.
Over mrna, leader, cds and trailer separately. This tables
are stored as SummarizedExperiment, for easy loading into
DEseq, conversion to normalized fpkm values,
or collapsing replicates in an experiment.
And can be imported with countTable function.
Everything will be outputed in the directory of your NGS data,
inside the folder ./QC_STATS/, relative to data location in 'df'.
You can specify new out location with out.dir if you want.
To make a ORFik experiment, see ?ORFik::experiment
To see some normal mrna coverage profiles of different RNA-seq protocols:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4310221/figure/F6/
ORFikQC( df, out.dir = resFolder(df), plot.ext = ".pdf", create.ofst = TRUE, force.remake.count.tables = FALSE, complex.correlation.plots = TRUE, library.names = bamVarName(df), use_simplified_reads = TRUE, BPPARAM = bpparam() )ORFikQC( df, out.dir = resFolder(df), plot.ext = ".pdf", create.ofst = TRUE, force.remake.count.tables = FALSE, complex.correlation.plots = TRUE, library.names = bamVarName(df), use_simplified_reads = TRUE, BPPARAM = bpparam() )
df |
an ORFik |
out.dir |
character, output directory, default:
|
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". Note that in pdf format the complex correlation plots become very slow to load! |
create.ofst |
logical, default TRUE. Create ".ofst" files from the input libraries, ofst is much faster to load in R, for later use. Stored in ./ofst/ folder relative to experiment main folder. |
force.remake.count.tables |
logical, default FALSE. If TRUE and count tables already exists, delete and make new ones. Useful if you altered input libraries. |
complex.correlation.plots |
logical, default TRUE. Add in addition to simple correlation plot two computationally heavy dots + correlation plots. Useful for deeper analysis, but takes longer time to run, especially on low-quality gpu computers. Set to FALSE to skip these. |
library.names |
character, default: bamVarName(df). Names to load libraries as to environment and names to display in plots. |
use_simplified_reads |
logical, default TRUE. For count tables and coverage plots a speed up for GAlignments is to use 5' ends only. This will lose some detail for splice sites, but is usually irrelevant. Note: If reads are precollapsed GRanges, set to FALSE to avoid recollapsing. |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
invisible(NULL) (objects are stored to disc)
Other QC report:
QCplots(),
QCstats()
# Load an experiment df <- ORFik.template.experiment() # Run QC #QCreport(df, tempdir()) # QC on subset #QCreport(df[9,], tempdir())# Load an experiment df <- ORFik.template.experiment() # Run QC #QCreport(df, tempdir()) # QC on subset #QCreport(df[9,], tempdir())
ORFscore tries to check whether the first frame of the 3 possible frames in
an ORF has more reads than second and third frame. IMPORTANT: Only use
p-shifted libraries, see (detectRibosomeShifts).
Else this score makes no sense.
orfScore( grl, RFP, is.sorted = FALSE, weight = "score", overlapGrl = NULL, coverage = NULL, stop3 = TRUE )orfScore( grl, RFP, is.sorted = FALSE, weight = "score", overlapGrl = NULL, coverage = NULL, stop3 = TRUE )
grl |
a |
RFP |
ribosomal footprints, given as |
is.sorted |
logical (FALSE), is grl sorted. That is + strand groups in increasing ranges (1,2,3), and - strand groups in decreasing ranges (3,2,1) |
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
overlapGrl |
an integer, (default: NULL), if defined must be countOverlaps(grl, RFP), added for speed if you already have it. |
coverage |
a data.table from coveragePerTiling of length same as 'grl' argument. Save time if you have already computed it. |
stop3 |
logical, default TRUE. Stop if any input is of width < 3. |
Pseudocode: assume rff - is reads fraction in specific frame
ORFScore = log(rff1 + rff2 + rff3)
If rff2 or rff3 is bigger than rff1, negate the resulting value.
ORFScore[rff1Smaller] <- ORFScore[rff1Smaller] * -1
As result there is one value per ORF: - Positive values say that the first frame have the most reads, - zero values means it is uniform: (ORFscore between -2.5 and 2.5 can be considered close to uniform), - negative values say that the first frame does not have the most reads. NOTE non-pshifted reads: If reads are not of width 1, then a read from 1-4 on range of 1-4, will get scores frame1 = 2, frame2 = 1, frame3 = 1. What could be logical is that only the 5' end is important, so that only frame1 = 1, to get this, you first resize reads to 5'end only.
General NOTES:
1. p shifting is not exact, so some functional ORFs will get a
bad ORF score.
2. If a score column is defined, it will use it as weights, set
to weight = 1L if you don't have weight, and score column is
something else.
3. If needed a test for significance and critical values,
use chi-squared. There are 3 degrees of freedom (3 frames),
so critical 0.05 (3-1 degrees of freedm = 2), value is: log2(6) = 2.58
see getWeights
a data.table with 4 columns, the orfscore (ORFScores) and score of each of the 3 tiles (frame_zero_RP, frame_one_RP, frame_two_RP)
doi: 10.1002/embj.201488411
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") names(ORF) <- c("tx1", "tx1", "tx1") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+") # 1 width position based score(RFP) <- 28 # original width orfScore(grl, RFP) # negative because more hits on frames 1,2 than 0. # example with positive result, more hits on frame 0 (in frame of ORF) RFP <- GRanges("1", IRanges(c(1, 1, 1, 25), width = 1), "+") score(RFP) <- c(28, 29, 31, 28) # original width orfScore(grl, RFP)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") names(ORF) <- c("tx1", "tx1", "tx1") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+") # 1 width position based score(RFP) <- 28 # original width orfScore(grl, RFP) # negative because more hits on frames 1,2 than 0. # example with positive result, more hits on frame 0 (in frame of ORF) RFP <- GRanges("1", IRanges(c(1, 1, 1, 25), width = 1), "+") score(RFP) <- c(28, 29, 31, 28) # original width orfScore(grl, RFP)
If not defined directly, checks the txdb / gtf organism information, if existing.
## S4 method for signature 'experiment' organism(object)## S4 method for signature 'experiment' organism(object)
object |
an ORFik |
character, name of organism
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
outputLibs(),
read.experiment(),
save.experiment(),
validateExperiments()
# if you have set organism in txdb of ORFik experiment: df <- ORFik.template.experiment() organism(df) #' If you have not set the organism you can do: #gtf <- "pat/to/gff_or_gff" #txdb_path <- paste0(gtf, ".db") # This file is created in next step #txdb <- makeTxdbFromGenome(gtf, genome, organism = "Homo sapiens", # optimize = TRUE, return = TRUE) # then use this txdb in you ORFik experiment and load: # create.experiment(exper = "new_experiment", # txdb = txdb_path) ... # organism(read.experiment("new-experiment))# if you have set organism in txdb of ORFik experiment: df <- ORFik.template.experiment() organism(df) #' If you have not set the organism you can do: #gtf <- "pat/to/gff_or_gff" #txdb_path <- paste0(gtf, ".db") # This file is created in next step #txdb <- makeTxdbFromGenome(gtf, genome, organism = "Homo sapiens", # optimize = TRUE, return = TRUE) # then use this txdb in you ORFik experiment and load: # create.experiment(exper = "new_experiment", # txdb = txdb_path) ... # organism(read.experiment("new-experiment))
By default loads the original files of the experiment into
the global environment, named by the rows of the experiment
required to make all libraries have unique names.
Uses multiple cores to load, defined by multicoreParam
outputLibs( df, type = "default", paths = filepath(df, type, only_unique_mappers = only_unique_mappers), param = NULL, strandMode = 0, naming = "minimum", library.names = name_decider(df, naming), output.mode = "envir", chrStyle = NULL, envir = envExp(df), verbose = TRUE, force = TRUE, validate_libs = TRUE, only_unique_mappers = uniqueMappers(df), BPPARAM = bpparam() )outputLibs( df, type = "default", paths = filepath(df, type, only_unique_mappers = only_unique_mappers), param = NULL, strandMode = 0, naming = "minimum", library.names = name_decider(df, naming), output.mode = "envir", chrStyle = NULL, envir = envExp(df), verbose = TRUE, force = TRUE, validate_libs = TRUE, only_unique_mappers = uniqueMappers(df), BPPARAM = bpparam() )
df |
an ORFik |
type |
a character(default: "default"), load files in experiment
or some precomputed variant, like "ofst" or "pshifted".
These are made with ORFik:::convertLibs(),
shiftFootprintsByExperiment(), etc.
Can also be custom user made folders inside the experiments bam folder.
It acts in a recursive manner with priority: If you state "pshifted",
but it does not exist, it checks "ofst". If no .ofst files, it uses
"default", which always must exists. |
paths |
character vector, the filpaths to use,
default |
param |
By default (i.e. |
strandMode |
numeric, default 0. Only used for paired end bam files. One of (0: strand = *, 1: first read of pair is +, 2: first read of pair is -). See ?strandMode. Note: Sets default to 0 instead of 1, as readGAlignmentPairs uses 1. This is to guarantee hits, but will also make mismatches of overlapping transcripts in opposite directions. |
naming |
a character (default: "minimum"). Name files as minimum information needed to make all files unique. Set to "full" to get full names. Set to "fullexp", to get full name with experiment name as prefix, the last one guarantees uniqueness. |
library.names |
character vector, names of libraries, default: name_decider(df, naming) |
output.mode |
character, default "envir". Output libraries to environment.
Alternative: "list", return as list. "envirlist", output to envir and return
as list. If output is list format, the list elements are named from:
|
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
envir |
environment to save to, default
|
verbose |
logical, default TRUE, message about library output status. |
force |
logical, default TRUE If TRUE, reload library files even if
matching named variables are found in environment used by experiment
(see |
validate_libs |
logical, default TRUE. If FALSE, don't check that default files exists (i.e. bam files), useful if you are using pshifted ofst etc and don't have the bams anymore. |
only_unique_mappers |
logical, default |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
The functions checks if the total set of libraries have already been loaded: i.e. Check if all names from 'library.names' exists as S4 objects in environment of experiment.
NULL (libraries set by envir assignment), unless output.mode is "list" or "envirlist": Then you get a list of the libraries. The library objects will have 3 additional attributes, "exp", "filepath" and "short_name".
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
read.experiment(),
save.experiment(),
validateExperiments()
## Load a template ORFik experiment df <- ORFik.template.experiment() ## Default library type load, usually bam files outputLibs(df, type = "default") RFP_WT_r1 attr(RFP_WT_r1, "filepath") attr(RFP_WT_r1, "exp") ## .ofst file load, if ofst files does not exists ## it will load default # outputLibs(df, type = "ofst") ## .wig file load, if wiggle files does not exists ## it will load default # outputLibs(df, type = "wig") ## Load as list outputLibs(df, output.mode = "list") ## Load libs to new environment (called ORFik in Global) # outputLibs(df, envir = assign(name(df), new.env(parent = .GlobalEnv))) ## Load to hidden environment given by experiment # envExp(df) <- new.env() # outputLibs(df)## Load a template ORFik experiment df <- ORFik.template.experiment() ## Default library type load, usually bam files outputLibs(df, type = "default") RFP_WT_r1 attr(RFP_WT_r1, "filepath") attr(RFP_WT_r1, "exp") ## .ofst file load, if ofst files does not exists ## it will load default # outputLibs(df, type = "ofst") ## .wig file load, if wiggle files does not exists ## it will load default # outputLibs(df, type = "wig") ## Load as list outputLibs(df, output.mode = "list") ## Load libs to new environment (called ORFik in Global) # outputLibs(df, envir = assign(name(df), new.env(parent = .GlobalEnv))) ## Load to hidden environment given by experiment # envExp(df) <- new.env() # outputLibs(df)
Detect outlier libraries with PCA analysis. Will output PCA plot of PCA component 1 (x-axis) vs PCA component 2 (y-axis) for each library (colored by library), shape by replicate. Will be extended to allow batch correction in the future.
pcaExperiment( df, output.dir = NULL, table = countTable(df, "cds", type = "fpkm"), title = "PCA analysis by CDS fpkm", subtitle = paste("Numer of genes/regions:", nrow(table)), plot.ext = ".pdf", return.data = FALSE, color.by.group = TRUE, PCA_X = "PC1", PCA_Y = "PC2" )pcaExperiment( df, output.dir = NULL, table = countTable(df, "cds", type = "fpkm"), title = "PCA analysis by CDS fpkm", subtitle = paste("Numer of genes/regions:", nrow(table)), plot.ext = ".pdf", return.data = FALSE, color.by.group = TRUE, PCA_X = "PC1", PCA_Y = "PC2" )
df |
an ORFik |
output.dir |
default NULL, else character path to directory. File saved as "PCAplot_(experiment name)(plot.ext)" |
table |
data.table, e.g. countTable(df, "cds", type = "fpkm"), a data.table of counts per column (default normalized fpkm values). |
title |
character, default "CDS fpkm". |
subtitle |
character, default: |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
return.data |
logical, default FALSE. Return data instead of plot |
color.by.group |
logical, default TRUE. Colors in PCA plot represent unique library groups, if FALSE. Color each sample in seperate color (harder to distinguish for > 10 samples) |
PCA_X |
name of priniciple component to use for x axis: valid options: PC1-PC6 |
PCA_Y |
name of priniciple component to use for y axis: valid options: PC1-PC6 |
ggplot if return.data is false, data.table of PCAs if return.data is TRUE, if data has < 3 samples, returns (invisible(NULL))
df <- ORFik.template.experiment() # Select only Ribo-seq and RNA-seq pcaExperiment(df[df$libtype %in% c("RNA", "RFP"),])df <- ORFik.template.experiment() # Select only Ribo-seq and RNA-seq pcaExperiment(df[df$libtype %in% c("RNA", "RFP"),])
Detect outlier libraries with PCA analysis. Will output PCA plot of PCA component 1 (x-axis) vs PCA component 2 (y-axis) for each library (colored by library), shape by replicate.
pcaPlot( table, path = NULL, group = sub("_r[0-9]+$", "", colnames(table)), replicate = sub(".*_r([0-9]+)$", "\\1", colnames(table)), PCA_X = "PC1", PCA_Y = "PC2", title = "PCA analysis by CDS fpkm", subtitle = paste("Numer of genes/regions:", nrow(table)), plot.ext = ".pdf", return.data = FALSE )pcaPlot( table, path = NULL, group = sub("_r[0-9]+$", "", colnames(table)), replicate = sub(".*_r([0-9]+)$", "\\1", colnames(table)), PCA_X = "PC1", PCA_Y = "PC2", title = "PCA analysis by CDS fpkm", subtitle = paste("Numer of genes/regions:", nrow(table)), plot.ext = ".pdf", return.data = FALSE )
table |
data.table, e.g. countTable(df, "cds", type = "fpkm"), a data.table of counts per column (default normalized fpkm values). |
path |
default NULL, else character path to file to save. File saved as "PCAplot_(experiment name)(plot.ext)" |
group |
character vector of equal size to nrow of dt,
|
replicate |
haracter vector of equal size to nrow of dt,
|
PCA_X |
name of priniciple component to use for x axis: valid options: PC1-PC6 |
PCA_Y |
name of priniciple component to use for y axis: valid options: PC1-PC6 |
title |
character, default "CDS fpkm". |
subtitle |
character, default: |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
return.data |
logical, default FALSE. Return data instead of plot |
ggplot or invisible(NULL) if output.dir is defined or < 3 samples. Returns data.table with PCA analysis if return.data is TRUE.
df <- ORFik.template.experiment() # Select only Ribo-seq and RNA-seq df <- df[df$libtype %in% c("RNA", "RFP"),] table <- countTable(df, "cds", type = "fpkm") pcaPlot(table)df <- ORFik.template.experiment() # Select only Ribo-seq and RNA-seq df <- df[df$libtype %in% c("RNA", "RFP"),] table <- countTable(df, "cds", type = "fpkm") pcaPlot(table)
Map range coordinates between features in the transcriptome and genome (reference) space. The length of x must be the same as length of transcripts. Only exception is if x have integer names like (1, 3, 3, 5), so that x[1] maps to 1, x[2] maps to transcript 3 etc.
pmapFromTranscriptF(x, transcripts, removeEmpty = FALSE)pmapFromTranscriptF(x, transcripts, removeEmpty = FALSE)
x |
IRangesList/IRanges/GRanges to map to genomic coordinates |
transcripts |
a GRangesList to map against (the genomic coordinates) |
removeEmpty |
a logical, remove non hit exons, else they are set to 0. That is all exons in the reference that the transcript coordinates do not span. |
This version tries to fix the short commings of GenomicFeature's version. Much faster and uses less memory. Implemented as dynamic program optimized c++ code.
a GRangesList of mapped reads, names from ranges are kept.
ranges <- IRanges(start = c( 5, 6), end = c(10, 10)) seqnames = rep("chr1", 2) strands = rep("-", 2) grl <- split(GRanges(seqnames, IRanges(c(85, 70), c(89, 82)), strands), c(1, 1)) ranges <- split(ranges, c(1,1)) # both should be mapped to transcript 1 pmapFromTranscriptF(ranges, grl, TRUE)ranges <- IRanges(start = c( 5, 6), end = c(10, 10)) seqnames = rep("chr1", 2) strands = rep("-", 2) grl <- split(GRanges(seqnames, IRanges(c(85, 70), c(89, 82)), strands), c(1, 1)) ranges <- split(ranges, c(1,1)) # both should be mapped to transcript 1 pmapFromTranscriptF(ranges, grl, TRUE)
Map range coordinates between features in the transcriptome and genome (reference) space. The length of x must be the same as length of transcripts. Only exception is if x have integer names like (1, 3, 3, 5), so that x[1] maps to 1, x[2] maps to transcript 3 etc.
pmapToTranscriptF( x, transcripts, ignore.strand = FALSE, x.is.sorted = TRUE, tx.is.sorted = TRUE )pmapToTranscriptF( x, transcripts, ignore.strand = FALSE, x.is.sorted = TRUE, tx.is.sorted = TRUE )
x |
GRangesList/GRanges/IRangesList/IRanges to map to transcriptomic coordinates |
transcripts |
a GRangesList/GRanges/IRangesList/IRanges to map against (the genomic coordinates). Must be of lower abstraction level than x. So if x is GRanges, transcripts can not be IRanges etc. |
ignore.strand |
When ignore.strand is TRUE, strand is ignored in
overlaps operations (i.e., all strands are considered "+") and the
strand in the output is '*'. |
x.is.sorted |
if x is a GRangesList object, are "-" strand groups pre-sorted in decreasing order within group, default: TRUE |
tx.is.sorted |
if transcripts is a GRangesList object, are "-" strand groups pre-sorted in decreasing order within group, default: TRUE |
This version tries to fix the shortcommings of GenomicFeature's version. Much faster and uses less memory. Implemented as dynamic program optimized c++ code.
object of same class as input x, names from ranges are kept.
library(GenomicFeatures) # Need 2 ranges object, the target region and whole transcript # x is target region x <- GRanges("chr1", IRanges(start = c(26, 29), end = c(27, 29)), "+") names(x) <- rep("tx1_ORF1", length(x)) x <- groupGRangesBy(x) # tx is the whole region tx_gr <- GRanges("chr1", IRanges(c(5, 29), c(27, 30)), "+") names(tx_gr) <- rep("tx1", length(tx_gr)) tx <- groupGRangesBy(tx_gr) pmapToTranscriptF(x, tx) pmapToTranscripts(x, tx) # Reuse names for matching x <- GRanges("chr1", IRanges(start = c(26, 29, 5), end = c(27, 29, 18)), "+") names(x) <- c(rep("tx1_1", 2), "tx1_2") x <- groupGRangesBy(x) tx1_2 <- GRanges("chr1", IRanges(c(4, 28), c(26, 31)), "+") names(tx1_2) <- rep("tx1", 2) tx <- c(tx, groupGRangesBy(tx1_2)) a <- pmapToTranscriptF(x, tx[txNames(x)]) b <- pmapToTranscripts(x, tx[txNames(x)]) identical(a, b) seqinfo(a) # A note here, a & b only have 1 seqlength, even though the 2 "tx1" # are different in size. This is an artifact of using duplicated names. ## Also look at the asTx for a similar useful function.library(GenomicFeatures) # Need 2 ranges object, the target region and whole transcript # x is target region x <- GRanges("chr1", IRanges(start = c(26, 29), end = c(27, 29)), "+") names(x) <- rep("tx1_ORF1", length(x)) x <- groupGRangesBy(x) # tx is the whole region tx_gr <- GRanges("chr1", IRanges(c(5, 29), c(27, 30)), "+") names(tx_gr) <- rep("tx1", length(tx_gr)) tx <- groupGRangesBy(tx_gr) pmapToTranscriptF(x, tx) pmapToTranscripts(x, tx) # Reuse names for matching x <- GRanges("chr1", IRanges(start = c(26, 29, 5), end = c(27, 29, 18)), "+") names(x) <- c(rep("tx1_1", 2), "tx1_2") x <- groupGRangesBy(x) tx1_2 <- GRanges("chr1", IRanges(c(4, 28), c(26, 31)), "+") names(tx1_2) <- rep("tx1", 2) tx <- c(tx, groupGRangesBy(tx1_2)) a <- pmapToTranscriptF(x, tx[txNames(x)]) b <- pmapToTranscripts(x, tx[txNames(x)]) identical(a, b) seqinfo(a) # A note here, a & b only have 1 seqlength, even though the 2 "tx1" # are different in size. This is an artifact of using duplicated names. ## Also look at the asTx for a similar useful function.
If an intron is of length < 'width' * 2, it will not be split into pseudo.
pseudoIntronsPerGroup(grl, width = 100)pseudoIntronsPerGroup(grl, width = 100)
grl |
a GrangesList of length 1 |
width |
numeric, default 100. The size of pseudo flanks. |
a GRangesList
tx <- GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")) pseudoIntronsPerGroup(tx) # See intron 1 is not split tx_2 <- rep(GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")), 2) pseudoIntronsPerGroup(tx_2) pseudoIntronsPerGroup(tx_2, 1e6)tx <- GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")) pseudoIntronsPerGroup(tx) # See intron 1 is not split tx_2 <- rep(GRangesList(GRanges("1", IRanges(c(1, 150, 1e5, 1e6)), "+")), 2) pseudoIntronsPerGroup(tx_2) pseudoIntronsPerGroup(tx_2, 1e6)
Usefull to validate p-shifting is correct Can be used for any coverage of region around a point, like TIS, TSS, stop site etc.
pSitePlot( hitMap, length = unique(hitMap$fraction), region = "start", output = NULL, type = "canonical CDS", scoring = "Averaged counts", forHeatmap = FALSE, title = "auto", facet = FALSE, frameSum = FALSE )pSitePlot( hitMap, length = unique(hitMap$fraction), region = "start", output = NULL, type = "canonical CDS", scoring = "Averaged counts", forHeatmap = FALSE, title = "auto", facet = FALSE, frameSum = FALSE )
hitMap |
a data.frame/data.table, given from metaWindow (must have columns: position, (score or count) and frame) |
length |
an integer (29), which read length is this for? |
region |
a character (start), either "start or "stop" |
output |
character (NULL), if set, saves the plot as pdf or png to path given. If no format is given, is save as pdf. |
type |
character (canonical CDS), type for plot |
scoring |
character, default: (Averaged counts), which scoring did you use ? see ?coverageScorings for info and more alternatives. |
forHeatmap |
a logical (FALSE), should the plot be part of a heatmap? It will scale it differently. Removing title, x and y labels, and truncate spaces between bars. |
title |
character, title of plot. Default "auto", will make it: paste("Length", length, "over", region, "of", type). Else set your own (set to NULL to remove all together). |
facet |
logical, default FALSE. If you input multiple read lengths, specified by fraction column of hitMap, it will split the plots for each read length, putting them under each other. Ignored if forHeatmap is TRUE. |
frameSum |
logical default FALSE. If TRUE, add an addition plot to the right, sum per frame over all positions per length. |
The region is represented as a histogram with different colors for the 3 frames. To make it easy to see patterns in the reads. Remember if you want to change anything like colors, just return the ggplot object, and reassign like: obj + scale_color_brewer() etc.
a ggplot object of the coverage plot, NULL if output is set, then the plot will only be saved to location.
Other coveragePlot:
coverageHeatMap(),
savePlot(),
windowCoveragePlot()
# An ORF grl <- GRangesList(tx1 = GRanges("1", IRanges(1, 6), "+")) # Ribo-seq reads range <- IRanges(c(rep(1, 3), 2, 3, rep(4, 2), 5, 6), width = 1 ) reads <- GRanges("1", range, "+") coverage <- coveragePerTiling(grl, reads, TRUE, as.data.table = TRUE, withFrames = TRUE) pSitePlot(coverage) pSitePlot(coverage, frameSum = TRUE) # See vignette for more examples# An ORF grl <- GRangesList(tx1 = GRanges("1", IRanges(1, 6), "+")) # Ribo-seq reads range <- IRanges(c(rep(1, 3), 2, 3, rep(4, 2), 5, 6), width = 1 ) reads <- GRanges("1", range, "+") coverage <- coveragePerTiling(grl, reads, TRUE, as.data.table = TRUE, withFrames = TRUE) pSitePlot(coverage) pSitePlot(coverage, frameSum = TRUE) # See vignette for more examples
Get path to ORFik experiment QC folder
QCfolder(x)QCfolder(x)
x |
an ORFik |
a character path
Get path to ORFik experiment QC folder
## S4 method for signature 'experiment' QCfolder(x)## S4 method for signature 'experiment' QCfolder(x)
x |
an ORFik |
a character path
The ORFik QC uses the aligned files (usually bam files),
fastp and STAR log files
combined with annotation to create relevant statistics.
This report consists of several steps:
1. Convert bam file / Input files to ".ofst" format, if not already done.
This format is around 400x faster to use in R than the bam format.
Files are also outputted to R environment specified by envExp(df)
2. From this report you will get a summary csv table, with distribution of
aligned reads and overlap counts over transcript regions like:
leader, cds, trailer, lincRNAs, tRNAs, rRNAs, snoRNAs etc. It will be called
STATS.csv. And can be imported with QCstats function.
3. It will also make correlation plots and meta coverage plots,
so you get a good understanding of how good the quality of your NGS
data production + aligner step were.
4. Count tables are produced, similar to HTseq count tables.
Over mrna, leader, cds and trailer separately. This tables
are stored as SummarizedExperiment, for easy loading into
DEseq, conversion to normalized fpkm values,
or collapsing replicates in an experiment.
And can be imported with countTable function.
Everything will be outputed in the directory of your NGS data,
inside the folder ./QC_STATS/, relative to data location in 'df'.
You can specify new out location with out.dir if you want.
To make a ORFik experiment, see ?ORFik::experiment
To see some normal mrna coverage profiles of different RNA-seq protocols:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4310221/figure/F6/
QCreport( df, out.dir = resFolder(df), plot.ext = ".pdf", create.ofst = TRUE, force.remake.count.tables = FALSE, complex.correlation.plots = TRUE, library.names = bamVarName(df), use_simplified_reads = TRUE, BPPARAM = bpparam() )QCreport( df, out.dir = resFolder(df), plot.ext = ".pdf", create.ofst = TRUE, force.remake.count.tables = FALSE, complex.correlation.plots = TRUE, library.names = bamVarName(df), use_simplified_reads = TRUE, BPPARAM = bpparam() )
df |
an ORFik |
out.dir |
character, output directory, default:
|
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". Note that in pdf format the complex correlation plots become very slow to load! |
create.ofst |
logical, default TRUE. Create ".ofst" files from the input libraries, ofst is much faster to load in R, for later use. Stored in ./ofst/ folder relative to experiment main folder. |
force.remake.count.tables |
logical, default FALSE. If TRUE and count tables already exists, delete and make new ones. Useful if you altered input libraries. |
complex.correlation.plots |
logical, default TRUE. Add in addition to simple correlation plot two computationally heavy dots + correlation plots. Useful for deeper analysis, but takes longer time to run, especially on low-quality gpu computers. Set to FALSE to skip these. |
library.names |
character, default: bamVarName(df). Names to load libraries as to environment and names to display in plots. |
use_simplified_reads |
logical, default TRUE. For count tables and coverage plots a speed up for GAlignments is to use 5' ends only. This will lose some detail for splice sites, but is usually irrelevant. Note: If reads are precollapsed GRanges, set to FALSE to avoid recollapsing. |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
invisible(NULL) (objects are stored to disc)
Other QC report:
QCplots(),
QCstats()
# Load an experiment df <- ORFik.template.experiment() # Run QC #QCreport(df, tempdir()) # QC on subset #QCreport(df[9,], tempdir())# Load an experiment df <- ORFik.template.experiment() # Run QC #QCreport(df, tempdir()) # QC on subset #QCreport(df[9,], tempdir())
Loads the pre / post alignment statistcs made in ORFik.
QCstats(df, path = file.path(QCfolder(df), "STATS.csv"))QCstats(df, path = file.path(QCfolder(df), "STATS.csv"))
df |
an ORFik |
path |
path to QC statistics report, default: file.path(dirname(df$filepath[1]), "/QC_STATS/STATS.csv") |
The ORFik QC uses the aligned files (usually bam files), fastp and STAR log files combined with annotation to create relevant statistics.
data.table of QC report or NULL if not exists
Other QC report:
QCplots(),
QCreport()
df <- ORFik.template.experiment() ## First make QC report # QCreport(df) # stats <- QCstats(df)df <- ORFik.template.experiment() ## First make QC report # QCreport(df) # stats <- QCstats(df)
From post-alignment QC relative to annotation, make a plot for all samples. Will contain among others read lengths, reads overlapping leaders, cds, trailers, mRNA / rRNA etc.
QCstats.plot(stats, output.dir = NULL, plot.ext = ".pdf", as_gg_list = FALSE)QCstats.plot(stats, output.dir = NULL, plot.ext = ".pdf", as_gg_list = FALSE)
stats |
the experiment object or path to custom ORFik QC folder where a file called "STATS.csv" is located. |
output.dir |
NULL or character path, default: NULL, plot not saved to disc. If defined saves plot to that directory with the name "/STATS_plot.pdf". |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
as_gg_list |
logical, default FALSE. Return as a list of ggplot objects instead of as a grob. Gives you the ability to modify plots more directly. |
the plot object, a grob of ggplot objects of the the statistics data
df <- ORFik.template.experiment()[3,] ## First make QC report # QCreport(df) ## Now you can get plot # QCstats.plot(df)df <- ORFik.template.experiment()[3,] ## First make QC report # QCreport(df) ## Now you can get plot # QCstats.plot(df)
strandMode covRle
r(x)r(x)
x |
a covRle object |
the forward RleList
strandMode covRle
## S4 method for signature 'covRle' r(x)## S4 method for signature 'covRle' r(x)
x |
a covRle object |
the forward RleList
Creates an ordering of ORFs per transcript, so that ORF with the most upstream start codon is 1, second most upstream start codon is 2, etc. Must input a grl made from ORFik, txNames_2 -> 2.
rankOrder(grl)rankOrder(grl)
grl |
a |
a numeric vector of integers
doi: 10.1074/jbc.R116.733899
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) grl <- ORFik:::makeORFNames(grl) rankOrder(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) grl <- ORFik:::makeORFNames(grl) rankOrder(grl)
Read RDS or QS format file
read_RDSQS(file, nthread = 5)read_RDSQS(file, nthread = 5)
file |
path to file with "rds" or "qs" file extension |
nthread |
numeric, number of threads for qs2::qs_read |
R object loaded from file
df <- ORFik::ORFik.template.experiment() path <- ORFik:::countTablePath(df) read_RDSQS(path)df <- ORFik::ORFik.template.experiment() path <- ORFik:::countTablePath(df) read_RDSQS(path)
experiment
Read in runs / samples from an experiment as a single R object.
To read an ORFik experiment, you must of course make one first.
See create.experiment
The file must be csv and be a valid ORFik experiment
read.experiment( file, in.dir = ORFik::config()["exp"], validate = TRUE, output.env = .GlobalEnv )read.experiment( file, in.dir = ORFik::config()["exp"], validate = TRUE, output.env = .GlobalEnv )
file |
relative path to a ORFik experiment. That is a .csv file following
ORFik experiment style ("," as seperator).
, or a template data.frame from |
in.dir |
Directory to load experiment csv file from, default:
|
validate |
logical, default TRUE. Abort if any library files does not exist. Do not set this to FALSE, unless you know what you are doing! |
output.env |
an environment, default .GlobalEnv. Which environment
should ORFik output libraries to (if this is done),
can be updated later with |
an ORFik experiment
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
save.experiment(),
validateExperiments()
# From file ## Not run: # Read from file df <- read.experiment(filepath) # <- valid ORFik .csv file ## End(Not run) ## Read from (create.experiment() template) df <- ORFik.template.experiment() ## To save it, do: # save.experiment(df, file = "path/to/save/experiment") ## You can then do: # read.experiment("path/to/save/experiment") # or (identical): # read.experiment("experiment", in.dir = "path/to/save/")# From file ## Not run: # Read from file df <- read.experiment(filepath) # <- valid ORFik .csv file ## End(Not run) ## Read from (create.experiment() template) df <- ORFik.template.experiment() ## To save it, do: # save.experiment(df, file = "path/to/save/experiment") ## You can then do: # read.experiment("path/to/save/experiment") # or (identical): # read.experiment("experiment", in.dir = "path/to/save/")
Read in Bam file from either single end or paired end.
Safer combined version of readGAlignments and
readGAlignmentPairs that takes care of some common errors.
If QNAMES of the aligned reads are from collapsed fasta files
(if the names are formated from collapsing in either
(ORFik, ribotoolkit or fastx)), the
bam file will contain a meta column called "score" with the counts
of duplicates per read. Only works for single end reads, as perfect duplication
events for paired end is more rare and therefor not supported!.
readBam( path, chrStyle = NULL, param = NULL, strandMode = 0, only_unique_mappers = FALSE )readBam( path, chrStyle = NULL, param = NULL, strandMode = 0, only_unique_mappers = FALSE )
path |
a character / data.table with path to .bam file. There are 3 input file possibilities.
|
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
param |
By default (i.e. |
strandMode |
numeric, default 0. Only used for paired end bam files. One of (0: strand = *, 1: first read of pair is +, 2: first read of pair is -). See ?strandMode. Note: Sets default to 0 instead of 1, as readGAlignmentPairs uses 1. This is to guarantee hits, but will also make mismatches of overlapping transcripts in opposite directions. |
only_unique_mappers |
logical, default FALSE. Only load unique mappers. For bam files it extracts NH flag, for other formats, it presumes the presence of a directory './unique_mappers' relative to bam file directory. |
In the future will use a faster .bam loader for big .bam files in R.
a GAlignments or GAlignmentPairs object of bam file
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBigWig(),
readWig()
bam_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") readBam(bam_file, "UCSC")bam_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") readBam(bam_file, "UCSC")
The 'seq' flag of the bam, with a specified number of rows
readBamIsUniqueMapper(bam_paths, yieldSize = NA_integer_)readBamIsUniqueMapper(bam_paths, yieldSize = NA_integer_)
bam_paths |
paths to bam files |
yieldSize |
integer, default NA_integer_, number of reads to read in, set to NA_integer_ to get full file. |
a list of logical elements, 1 for each bam file, TRUE is unique mapper.
df <- ORFik.template.experiment.zf() bam_file_path <- filepath(df, "default") readBamIsUniqueMapper(bam_file_path, 1e2)df <- ORFik.template.experiment.zf() bam_file_path <- filepath(df, "default") readBamIsUniqueMapper(bam_file_path, 1e2)
The 'seq' flag of the bam, with a specified number of rows
readBamSeqs(path, yieldSize = NA_integer_)readBamSeqs(path, yieldSize = NA_integer_)
path |
path to bam file |
yieldSize |
integer, default NA_integer_, number of reads to read in, set to NA_integer_ to get full file. |
a DNAStringSet of length yieldSize (all in file if NA was specified)
df <- ORFik.template.experiment.zf() bam_file_path <- filepath(df, "default") readBamSeqs(bam_file_path, 1e2)df <- ORFik.template.experiment.zf() bam_file_path <- filepath(df, "default") readBamSeqs(bam_file_path, 1e2)
Given 2 bigWig files (.bw, .bigWig), first is forward second is reverse. Merge them and return as GRanges object. If they contain name reverse and forward, first and second order does not matter, it will search for forward and reverse.
readBigWig(path, chrStyle = NULL, as = "GRanges")readBigWig(path, chrStyle = NULL, as = "GRanges")
path |
a character path to two .bigWig files, or a data.table with 2 columns, (forward, filepath) and reverse, only 1 row. |
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
as |
Specifies the class of the return object. Default is
|
a GRanges object of the file/s
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readWig()
Input any reads, e.g. ribo-seq object and get width of reads, this is to avoid confusion between width, qwidth and meta column containing original read width.
readWidths(reads, after.softclips = TRUE, along.reference = FALSE)readWidths(reads, after.softclips = TRUE, along.reference = FALSE)
reads |
a GRanges, GAlignment, GAlignmentPairs or covRleList object. |
after.softclips |
logical (TRUE), include softclips in width. Does not apply if along.reference is TRUE. |
along.reference |
logical (FALSE), example: The cigar "26MI2" is by default width 28, but if along.reference is TRUE, it will be 26. The length of the read along the reference. Also "1D20M" will be 21 if by along.reference is TRUE. Intronic regions (cigar: N) will be removed. So: "1M200N19M" is 20, not 220. |
If input is p-shifted and GRanges, the "$size" or "$score" colum" must exist, and the column must contain the original read widths. In ORFik "$size" have higher priority than "$score" for defining length. ORFik P-shifting creates a $size column, other softwares like shoelaces creates a score column.
Remember to think about how you define length. Like the question: is a Illumina error mismatch sufficient to reduce size of read and how do you know what is biological variance and what are Illumina errors?
an integer vector of widths
gr <- GRanges("chr1", 1) readWidths(gr) # GAlignment with hit (1M) and soft clipped base (1S) ga <- GAlignments(seqnames = "1", pos = as.integer(1), cigar = "1M1S", strand = factor("+", levels = c("+", "-", "*"))) readWidths(ga) # Without soft-clip bases readWidths(ga, after.softclips = FALSE) # With soft-clip basesgr <- GRanges("chr1", 1) readWidths(gr) # GAlignment with hit (1M) and soft clipped base (1S) ga <- GAlignments(seqnames = "1", pos = as.integer(1), cigar = "1M1S", strand = factor("+", levels = c("+", "-", "*"))) readWidths(ga) # Without soft-clip bases readWidths(ga, after.softclips = FALSE) # With soft-clip bases
Given 2 wig files, first is forward second is reverse. Merge them and return as GRanges object. If they contain name reverse and forward, first and second order does not matter, it will search for forward and reverse.
readWig(path, chrStyle = NULL)readWig(path, chrStyle = NULL)
path |
a character path to two .wig files, or a data.table with 2 columns, (forward, filepath) and reverse, only 1 row. |
chrStyle |
a GRanges object, TxDb, FaFile,
, a |
a GRanges object of the file/s
Other utils:
bedToGR(),
convertToOneBasedRanges(),
export.bed12(),
export.bigWig(),
export.fstwig(),
export.wiggle(),
fimport(),
findFa(),
fread.bed(),
optimizeReads(),
readBam(),
readBigWig()
Given a GRangesList of 5' UTRs or transcripts, reassign the start sites using max peaks from CageSeq data. A max peak is defined as new TSS if it is within boundary of 5' leader range, specified by 'extension' in bp. A max peak must also be higher than minimum CageSeq peak cutoff specified in 'filterValue'. The new TSS will then be the positioned where the cage read (with highest read count in the interval). If removeUnused is TRUE, leaders without cage hits, will be removed, if FALSE the original TSS will be used.
reassignTSSbyCage( fiveUTRs, cage, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, preCleanup = TRUE, cageMcol = FALSE )reassignTSSbyCage( fiveUTRs, cage, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, preCleanup = TRUE, cageMcol = FALSE )
fiveUTRs |
(GRangesList) The 5' leaders or full transcript sequences |
cage |
Either a filePath for the CageSeq file as .bed .bam or .wig, with possible compressions (".gzip", ".gz", ".bgz"), or already loaded CageSeq peak data as GRanges or GAlignment. NOTE: If it is a .bam file, it will add a score column by running: convertToOneBasedRanges(cage, method = "5prime", addScoreColumn = TRUE) The score column is then number of replicates of read, if score column is something else, like read length, set the score column to NULL first. |
extension |
The maximum number of basses upstream of the TSS to search for CageSeq peak. |
filterValue |
The minimum number of reads on cage position, for it to be counted as possible new tss. (represented in score column in CageSeq data) If you already filtered, set it to 0. |
restrictUpstreamToTx |
a logical (FALSE). If TRUE: restrict leaders to not extend closer than 5 bases from closest upstream leader, set this to TRUE. |
removeUnused |
logical (FALSE), if False: (standard is to set them to original annotation), If TRUE: remove leaders that did not have any cage support. |
preCleanup |
logical (TRUE), if TRUE, remove all reads in region (-5:-1, 1:5) of all original tss in leaders. This is to keep original TSS if it is only +/- 5 bases from the original. |
cageMcol |
a logical (FALSE), if TRUE, add a meta column to the returned object with the raw CAGE counts in support for new TSS. |
Note: If you used CAGEr, you will get reads of a probability region, with always score of 1. Remember then to set filterValue to 0. And you should use the 5' end of the read as input, use: ORFik:::convertToOneBasedRanges(cage) NOTE on filtervalue: To get high quality TSS, set filtervalue to median count of reads overlapping per leader. This will make you discard a lot of new TSS positions though. I usually use 10 as a good standard.
TIP: do summary(countOverlaps(fiveUTRs, cage)) so you can find a good cutoff value for noise.
a GRangesList of newly assigned TSS for fiveUTRs, using CageSeq data.
Other CAGE:
assignTSSByCage(),
reassignTxDbByCage()
# example 5' leader, notice exon_rank column fiveUTRs <- GenomicRanges::GRangesList( GenomicRanges::GRanges(seqnames = "chr1", ranges = IRanges::IRanges(1000, 2000), strand = "+", exon_rank = 1)) names(fiveUTRs) <- "tx1" # make fake CAGE data from promoter of 5' leaders, notice score column cage <- GenomicRanges::GRanges( seqnames = "1", ranges = IRanges::IRanges(500, width = 1), strand = "+", score = 10) # <- Number of tags (reads) per position # notice also that seqnames use different naming, this is fixed by ORFik # finally reassign TSS for fiveUTRs reassignTSSbyCage(fiveUTRs, cage) # See vignette for example using gtf file and real CAGE data.# example 5' leader, notice exon_rank column fiveUTRs <- GenomicRanges::GRangesList( GenomicRanges::GRanges(seqnames = "chr1", ranges = IRanges::IRanges(1000, 2000), strand = "+", exon_rank = 1)) names(fiveUTRs) <- "tx1" # make fake CAGE data from promoter of 5' leaders, notice score column cage <- GenomicRanges::GRanges( seqnames = "1", ranges = IRanges::IRanges(500, width = 1), strand = "+", score = 10) # <- Number of tags (reads) per position # notice also that seqnames use different naming, this is fixed by ORFik # finally reassign TSS for fiveUTRs reassignTSSbyCage(fiveUTRs, cage) # See vignette for example using gtf file and real CAGE data.
Given a TxDb object, reassign the start site per transcript using max peaks from CageSeq data. A max peak is defined as new TSS if it is within boundary of 5' leader range, specified by 'extension' in bp. A max peak must also be higher than minimum CageSeq peak cutoff specified in 'filterValue'. The new TSS will then be the positioned where the cage read (with highest read count in the interval).
reassignTxDbByCage( txdb, cage, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, preCleanup = TRUE )reassignTxDbByCage( txdb, cage, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, preCleanup = TRUE )
txdb |
a TxDb file, a path to one of: (.gtf ,.gff, .gff2, .gff2, .db or .sqlite) or an ORFik experiment |
cage |
Either a filePath for the CageSeq file as .bed .bam or .wig, with possible compressions (".gzip", ".gz", ".bgz"), or already loaded CageSeq peak data as GRanges or GAlignment. NOTE: If it is a .bam file, it will add a score column by running: convertToOneBasedRanges(cage, method = "5prime", addScoreColumn = TRUE) The score column is then number of replicates of read, if score column is something else, like read length, set the score column to NULL first. |
extension |
The maximum number of basses upstream of the TSS to search for CageSeq peak. |
filterValue |
The minimum number of reads on cage position, for it to be counted as possible new tss. (represented in score column in CageSeq data) If you already filtered, set it to 0. |
restrictUpstreamToTx |
a logical (FALSE). If TRUE: restrict leaders to not extend closer than 5 bases from closest upstream leader, set this to TRUE. |
removeUnused |
logical (FALSE), if False: (standard is to set them to original annotation), If TRUE: remove leaders that did not have any cage support. |
preCleanup |
logical (TRUE), if TRUE, remove all reads in region (-5:-1, 1:5) of all original tss in leaders. This is to keep original TSS if it is only +/- 5 bases from the original. |
Note: If you used CAGEr, you will get reads of a probability region, with always score of 1. Remember then to set filterValue to 0. And you should use the 5' end of the read as input, use: ORFik:::convertToOneBasedRanges(cage)
a TxDb obect of reassigned transcripts
Other CAGE:
assignTSSByCage(),
reassignTSSbyCage()
## Not run: library(GenomicFeatures) # Get the gtf txdb file txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") cagePath <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") reassignTxDbByCage(txdbFile, cagePath) ## End(Not run)## Not run: library(GenomicFeatures) # Get the gtf txdb file txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") cagePath <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") reassignTxDbByCage(txdbFile, cagePath) ## End(Not run)
Reduce away all GRanges elements with 0-width.
reduceKeepAttr( grl, keep.names = FALSE, drop.empty.ranges = FALSE, min.gapwidth = 1L, with.revmap = FALSE, with.inframe.attrib = FALSE, ignore.strand = FALSE, min.strand.decreasing = TRUE )reduceKeepAttr( grl, keep.names = FALSE, drop.empty.ranges = FALSE, min.gapwidth = 1L, with.revmap = FALSE, with.inframe.attrib = FALSE, ignore.strand = FALSE, min.strand.decreasing = TRUE )
grl |
a |
keep.names |
(FALSE) keep the names and meta columns of the GRangesList |
drop.empty.ranges |
(FALSE) if a group is empty (width 0), delete it. |
min.gapwidth |
(1L) how long gap can it be between two ranges, to merge them. |
with.revmap |
(FALSE) return info on which mapped to which |
with.inframe.attrib |
(FALSE) For internal use. |
ignore.strand |
(FALSE), can different strands be reduced together. |
min.strand.decreasing |
(TRUE), if GRangesList, return minus strand group ranges in decreasing order (1-5, 30-50) -> (30-50, 1-5) |
Extends function reduce
by trying to keep names and meta columns, if it is a
GRangesList. It also does not lose sorting for GRangesList,
since original reduce sorts all by ascending position.
If keep.names == FALSE, it's just the normal GenomicRanges::reduce
with sorting negative strands descending for GRangesList.
A reduced GRangesList
Other ExtendGenomicRanges:
asTX(),
coveragePerTiling(),
extendLeaders(),
extendTrailers(),
tile1(),
txSeqsFromFa(),
windowPerGroup()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 2, 3), end = c(1, 2, 3)), strand = "+") # For GRanges reduceKeepAttr(ORF, keep.names = TRUE) # For GRangesList grl <- GRangesList(tx1_1 = ORF) reduceKeepAttr(grl, keep.names = TRUE)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 2, 3), end = c(1, 2, 3)), strand = "+") # For GRanges reduceKeepAttr(ORF, keep.names = TRUE) # For GRangesList grl <- GRangesList(tx1_1 = ORF) reduceKeepAttr(grl, keep.names = TRUE)
Get path to ORFik experiment genome reference folder
refFolder(x)refFolder(x)
x |
an ORFik |
a character path
Get path to ORFik experiment genome reference folder
## S4 method for signature 'experiment' refFolder(x)## S4 method for signature 'experiment' refFolder(x)
x |
an ORFik |
a character path
This is defined as: Given some transcript region (like CDS), get coverage per position. By default only returns positions that have hits, set drop.zero.dt to FALSE to get all 0 positions.
regionPerReadLength( grl, reads, acceptedLengths = NULL, withFrames = TRUE, scoring = "transcriptNormalized", weight = "score", exclude.zero.cov.grl = TRUE, drop.zero.dt = TRUE, BPPARAM = bpparam() )regionPerReadLength( grl, reads, acceptedLengths = NULL, withFrames = TRUE, scoring = "transcriptNormalized", weight = "score", exclude.zero.cov.grl = TRUE, drop.zero.dt = TRUE, BPPARAM = bpparam() )
grl |
a |
reads |
a |
acceptedLengths |
an integer vector (NULL), the read lengths accepted. Default NULL, means all lengths accepted. |
withFrames |
logical TRUE, add ORF frame (frame 0, 1, 2), starting on first position of every grl. |
scoring |
a character (transcriptNormalized), which meta coverage scoring ? one of (zscore, transcriptNormalized, mean, median, sum, sumLength, fracPos), see ?coverageScorings for more info. Use to decide a scoring of hits per position for metacoverage etc. Set to NULL if you do not want meta coverage, but instead want per gene per position raw counts. |
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
exclude.zero.cov.grl |
logical, default TRUE. Do not include ranges that does not have any coverage (0 reads on them), this makes it faster to run. |
drop.zero.dt |
logical, default TRUE. If TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 count positions are used in some sense. |
BPPARAM |
how many cores/threads to use? default: bpparam() |
a data.table with lengths by coverage.
Other coverage:
coverageScorings(),
metaWindow(),
scaledWindowPositions(),
windowPerReadLength()
# Raw counts per gene per position cds <- GRangesList(tx1 = GRanges("1", 100:129, "+")) reads <- GRanges("1", seq(79,129, 3), "+") reads$size <- 28 # <- Set read length of reads regionPerReadLength(cds, reads, scoring = NULL) ## Sum up reads in each frame per read length per gene regionPerReadLength(cds, reads, scoring = "frameSumPerLG")# Raw counts per gene per position cds <- GRangesList(tx1 = GRanges("1", 100:129, "+")) reads <- GRanges("1", seq(79,129, 3), "+") reads$size <- 28 # <- Set read length of reads regionPerReadLength(cds, reads, scoring = NULL) ## Sum up reads in each frame per read length per gene regionPerReadLength(cds, reads, scoring = "frameSumPerLG")
Variable names defined by df, in envir defined
remove.experiments(df, envir = envExp(df))remove.experiments(df, envir = envExp(df))
df |
an ORFik |
envir |
environment to save to, default
|
NULL (objects removed from envir specified)
df <- ORFik.template.experiment() # Output to .GlobalEnv with: # outputLibs(df) # Then remove them with: # remove.experiments(df)df <- ORFik.template.experiment() # Output to .GlobalEnv with: # outputLibs(df) # Then remove them with: # remove.experiments(df)
Get ORFik experiment main output directory
resFolder(x)resFolder(x)
x |
an ORFik |
a character path
Get ORFik experiment main output directory
## S4 method for signature 'experiment' resFolder(x)## S4 method for signature 'experiment' resFolder(x)
x |
an ORFik |
a character path
A data.table of periods and amplitudes, great to detect ribosomal read lengths. Uses 5' end of reads to detect periodicity. Works both before and after p-shifting. Plot results with ribo_fft_plot.
ribo_fft(footprints, cds, read_lengths = 26:34, firstN = 150)ribo_fft(footprints, cds, read_lengths = 26:34, firstN = 150)
footprints |
Ribosome footprints in either |
cds |
a |
read_lengths |
integer vector, default: 26:34, which read length to check for. Will exclude all read_lengths that does not exist for footprints. |
firstN |
(integer) Represents how many bases of the transcripts downstream of start codons to use for initial estimation of the periodicity. |
a data.table with read_length, amplitude and periods
## Note, this sample data is not intended to be strongly periodic. ## Real data should have a cleaner peak for x = 3 (periodicity) # Load sample data df <- ORFik.template.experiment() # Load annotation loadRegions(df, "cds", names.keep = filterTranscripts(df)) # Select a riboseq library df <- df[df$libtype == "RFP", ] footprints <- fimport(filepath(df[1,], "default")) fft_dt <-ribo_fft(footprints, cds) ribo_fft_plot(fft_dt)## Note, this sample data is not intended to be strongly periodic. ## Real data should have a cleaner peak for x = 3 (periodicity) # Load sample data df <- ORFik.template.experiment() # Load annotation loadRegions(df, "cds", names.keep = filterTranscripts(df)) # Select a riboseq library df <- df[df$libtype == "RFP", ] footprints <- fimport(filepath(df[1,], "default")) fft_dt <-ribo_fft(footprints, cds) ribo_fft_plot(fft_dt)
Get periodogram plot per read length
ribo_fft_plot(fft_dt, period_window = c(0, 6))ribo_fft_plot(fft_dt, period_window = c(0, 6))
fft_dt |
a data.table with read_length, amplitude and periods |
period_window |
x axis limits, default c(0,6) |
a ggplot, geom_line plot facet by read length.
## Note, this sample data is not intended to be strongly periodic. ## Real data should have a cleaner peak for x = 3 (periodicity) # Load sample data df <- ORFik.template.experiment() # Load annotation cds <- loadRegion(df, "cds", names.keep = filterTranscripts(df)) # Select a riboseq library df <- df[df$libtype == "RFP", ] footprints <- fimport(filepath(df[1,], "default")) fft_dt <-ribo_fft(footprints, cds) ribo_fft_plot(fft_dt)## Note, this sample data is not intended to be strongly periodic. ## Real data should have a cleaner peak for x = 3 (periodicity) # Load sample data df <- ORFik.template.experiment() # Load annotation cds <- loadRegion(df, "cds", names.keep = filterTranscripts(df)) # Select a riboseq library df <- df[df$libtype == "RFP", ] footprints <- fimport(filepath(df[1,], "default")) fft_dt <-ribo_fft(footprints, cds) ribo_fft_plot(fft_dt)
Load Predicted translons
riboORFs(df, type = "table", folder = riboORFsFolder(df))riboORFs(df, type = "table", folder = riboORFsFolder(df))
df |
ORFik experiment |
type |
default "table", alternatives: c("table", "ranges_candidates", "ranges_predictions", "predictions") |
folder |
base folder to check for computed results, default: riboORFsFolder(df) |
a data.table, GRangesList or list of logical vector depending on input
df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][c(1,2),] # riboORFs(df) # Works when you have run predictiondf <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][c(1,2),] # riboORFs(df) # Works when you have run prediction
Define folder for prediction output
riboORFsFolder(df, parrent_dir = resFolder(df))riboORFsFolder(df, parrent_dir = resFolder(df))
df |
ORFik experiment |
parrent_dir |
Parrent directory of computed study results, default: resFolder(df) |
a file path (full path)
df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][c(1,2),] riboORFsFolder(df) riboORFsFolder(df, tempdir())df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][c(1,2),] riboORFsFolder(df) riboORFsFolder(df, tempdir())
Combines several statistics from the pshifted reads into a plot:
-1 Coding frame distribution per read length
-2 Alignment statistics
-3 Biotype of non-exonic pshifted reads
-4 mRNA localization of pshifted reads
RiboQC.plot( df, output.dir = QCfolder(df), width = 6.6, height = 4.5, plot.ext = ".pdf", type = "pshifted", weight = "score", bar.position = "dodge", as_gg_list = FALSE, BPPARAM = BiocParallel::SerialParam(progressbar = TRUE) )RiboQC.plot( df, output.dir = QCfolder(df), width = 6.6, height = 4.5, plot.ext = ".pdf", type = "pshifted", weight = "score", bar.position = "dodge", as_gg_list = FALSE, BPPARAM = BiocParallel::SerialParam(progressbar = TRUE) )
df |
an ORFik |
output.dir |
NULL or character path, default: NULL, plot not saved to disc. If defined saves plot to that directory with the name "/STATS_plot.pdf". |
width |
width of plot, default 6.6 (in inches) |
height |
height of plot, default 4.5 (in inches) |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
type |
type of library loaded, default pshifted, warning if not pshifted might crash if too many read lengths! |
weight |
which column in reads describe duplicates, default "score". |
bar.position |
character, default "dodge". Should Ribo-seq frames per read length be positioned as "dodge" or "stack" (on top of each other). |
as_gg_list |
logical, default FALSE. Return as a list of ggplot objects instead of as a grob. Gives you the ability to modify plots more directly. |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
the plot object, a grob of ggplot objects of the the data
df <- ORFik.template.experiment() df <- df[9,] #lets only p-shift RFP sample at index 9 #shiftFootprintsByExperiment(df) #RiboQC.plot(df, tempdir())df <- ORFik.template.experiment() df <- df[9,] #lets only p-shift RFP sample at index 9 #shiftFootprintsByExperiment(df) #RiboQC.plot(df, tempdir())
Ribosome Release Score is defined as
(RPFs over ORF)/(RPFs over 3' utrs)
and additionaly normalized by lengths. If RNA is added as argument, it will normalize by RNA counts to justify location of 3' utrs. It can be understood as a ribosome stalling feature. A pseudo-count of one was added to both the ORF and downstream sums.
ribosomeReleaseScore( grl, RFP, GtfOrThreeUtrs, RNA = NULL, weight.RFP = 1L, weight.RNA = 1L, overlapGrl = NULL )ribosomeReleaseScore( grl, RFP, GtfOrThreeUtrs, RNA = NULL, weight.RFP = 1L, weight.RNA = 1L, overlapGrl = NULL )
grl |
a |
RFP |
RiboSeq reads as GAlignments, GRanges or GRangesList object |
GtfOrThreeUtrs |
if Gtf: a TxDb object of a gtf file transcripts is called from: 'threeUTRsByTranscript(Gtf, use.names = TRUE)', if object is GRangesList, it is presumed to be the 3' utrs |
RNA |
RnaSeq reads as |
weight.RFP |
a vector (default: 1L). Can also be character name of column in RFP. As in translationalEff(weight = "score") for: GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. |
weight.RNA |
Same as weightRFP but for RNA weights. (default: 1L) |
overlapGrl |
an integer, (default: NULL), if defined must be countOverlaps(grl, RFP), added for speed if you already have it |
a named vector of numeric values of scores, NA means that no 3' utr was found for that transcript.
doi: 10.1016/j.cell.2013.06.009
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) threeUTRs <- GRangesList(tx1 = GRanges("1", IRanges(40, 50), "+")) RFP <- GRanges("1", IRanges(25, 25), "+") RNA <- GRanges("1", IRanges(1, 50), "+") ribosomeReleaseScore(grl, RFP, threeUTRs, RNA)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) threeUTRs <- GRangesList(tx1 = GRanges("1", IRanges(40, 50), "+")) RFP <- GRanges("1", IRanges(25, 25), "+") RNA <- GRanges("1", IRanges(1, 50), "+") ribosomeReleaseScore(grl, RFP, threeUTRs, RNA)
Is defined as
(RPFs over ORF stop sites)/(RPFs over ORFs)
and normalized by lengths A pseudo-count of one was added to both the ORF and downstream sums.
ribosomeStallingScore(grl, RFP, weight = 1L, overlapGrl = NULL)ribosomeStallingScore(grl, RFP, weight = 1L, overlapGrl = NULL)
grl |
a |
RFP |
RiboSeq reads as GAlignments, GRanges or GRangesList object |
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
overlapGrl |
an integer, (default: NULL), if defined must be countOverlaps(grl, RFP), added for speed if you already have it |
a named vector of numeric values of RSS scores
doi: 10.1016/j.cels.2017.08.004
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+") ribosomeStallingScore(grl, RFP)ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+") ribosomeStallingScore(grl, RFP)
Normalizes per position per gene by this function: (reads at position / min(librarysize, 1) * number of genes) / fpkm of that gene's RNA-seq
rnaNormalize(coverage, df, dfr = NULL, tx, normalizeMode = "position")rnaNormalize(coverage, df, dfr = NULL, tx, normalizeMode = "position")
coverage |
a data.table containing at least columns (count/score, position), it is possible to have additionals: (genes, fraction, feature) |
df |
an ORFik |
dfr |
an ORFik |
tx |
a |
normalizeMode |
a character (default: "position"), how to normalize library against rna library. Either on "position", normalize by number of genes, sum of reads and RNA seq, on tx "region" or "feature": same as position but RNA is split into the feature groups to normalize. Useful if you have a list of targets and background genes. |
Good way to compare libraries
a data.table of normalized transcripts by RNA.
Get SRR/DRR/ERR run ids from ORFik experiment
runIDs(x)runIDs(x)
x |
an ORFik |
a character vector of runIDs, "" if not existing.
Get SRR/DRR/ERR run ids from ORFik experiment
## S4 method for signature 'experiment' runIDs(x)## S4 method for signature 'experiment' runIDs(x)
x |
an ORFik |
a character vector of runIDs, "" if not existing.
Read RDS or QS format file
save_RDSQS(object, file, nthread = 5)save_RDSQS(object, file, nthread = 5)
object |
the object to save |
file |
path to file with "rds" or "qs" file extension |
nthread |
numeric, number of threads for qs2::qs_save |
R object loaded from file
path <- tempfile(fileext = ".qs") # Simple numeric save x <- 1 save_RDSQS(x, path) read_RDSQS(path) # Save a list x <- list(a = 1, b = c(1,2,3)) save_RDSQS(x, path) read_RDSQS(path)path <- tempfile(fileext = ".qs") # Simple numeric save x <- 1 save_RDSQS(x, path) read_RDSQS(path) # Save a list x <- list(a = 1, b = c(1,2,3)) save_RDSQS(x, path) read_RDSQS(path)
experiment to discSave experiment to disc
save.experiment(df, file)save.experiment(df, file)
df |
an ORFik |
file |
name of file to save df as |
NULL (experiment save only)
Other ORFik_experiment:
ORFik.template.experiment(),
ORFik.template.experiment.zf(),
bamVarName(),
create.experiment(),
experiment-class,
filepath(),
libraryTypes(),
organism,experiment-method,
outputLibs(),
read.experiment(),
validateExperiments()
df <- ORFik.template.experiment() ## Save with: #save.experiment(df, file = "path/to/save/experiment.csv") ## Identical (.csv not needed, can be added): #save.experiment(df, file = "path/to/save/experiment")df <- ORFik.template.experiment() ## Save with: #save.experiment(df, file = "path/to/save/experiment.csv") ## Identical (.csv not needed, can be added): #save.experiment(df, file = "path/to/save/experiment")
For example scale a coverage table of a all human CDS to width 100
scaledWindowPositions( grl, reads, scaleTo = 100, scoring = "meanPos", weight = "score", is.sorted = FALSE, drop.zero.dt = FALSE )scaledWindowPositions( grl, reads, scaleTo = 100, scoring = "meanPos", weight = "score", is.sorted = FALSE, drop.zero.dt = FALSE )
grl |
a |
reads |
a |
scaleTo |
an integer (100), if windows have different size, a meta window can not directly be created, since a meta window must have equal size for all windows. Rescale all windows to scaleTo. i.e c(1,2,3) -> size 2 -> c(1, mean(2,3)) etc. Can also be a vector, 1 number per grl group. |
scoring |
a character, one of (zscore, transcriptNormalized, mean, median, sum, log2sum, log10sum, sumLength, meanPos and frameSum, periodic, NULL). More info in details |
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
is.sorted |
logical (FALSE), is grl sorted. That is + strand groups in increasing ranges (1,2,3), and - strand groups in decreasing ranges (3,2,1) |
drop.zero.dt |
logical FALSE, if TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 positions are used in some sense. (mean, median, zscore coverage will only scale differently) |
Nice for making metaplots, the score will be mean of merged positions.
A data.table with scored counts (counts) of reads mapped to positions (position) specified in windows along with frame (frame).
Other coverage:
coverageScorings(),
metaWindow(),
regionPerReadLength(),
windowPerReadLength()
library(GenomicRanges) windows <- GRangesList(GRanges("chr1", IRanges(1, 200), "-")) x <- GenomicRanges::GRanges( seqnames = "chr1", ranges = IRanges::IRanges(c(1, 100, 199), c(2, 101, 200)), strand = "-") scaledWindowPositions(windows, x, scaleTo = 100)library(GenomicRanges) windows <- GRangesList(GRanges("chr1", IRanges(1, 200), "-")) x <- GenomicRanges::GRanges( seqnames = "chr1", ranges = IRanges::IRanges(c(1, 100, 199), c(2, 101, 200)), strand = "-") scaledWindowPositions(windows, x, scaleTo = 100)
If txdb or gtf path is added, it is a rangedSummerizedExperiment For FPKM values, DESeq2::fpkm(robust = FALSE) is used
scoreSummarizedExperiment( final, score = "transcriptNormalized", collapse = FALSE )scoreSummarizedExperiment( final, score = "transcriptNormalized", collapse = FALSE )
final |
ranged summarized experiment object |
score |
default: "transcriptNormalized" (row normalized raw counts matrix), alternative is "fpkm", "log2fpkm" or "log10fpkm" |
collapse |
a logical/character (default FALSE), if TRUE all samples within the group SAMPLE will be collapsed to one. If "all", all groups will be merged into 1 column called merged_all. Collapse is defined as rowSum(elements_per_group) / ncol(elements_per_group) |
a DEseq summerizedExperiment object (transcriptNormalized) or matrix (if fpkm input)
Seqinfo covRle Extracted from forward RleList
## S4 method for signature 'covRle' seqinfo(x)## S4 method for signature 'covRle' seqinfo(x)
x |
a covRle object |
integer vector with names
Seqinfo covRle Extracted from forward RleList
## S4 method for signature 'covRleList' seqinfo(x)## S4 method for signature 'covRleList' seqinfo(x)
x |
a covRle object |
integer vector with names
Seqinfo ORFik experiment Extracted from fasta genome index
## S4 method for signature 'experiment' seqinfo(x)## S4 method for signature 'experiment' seqinfo(x)
x |
an ORFik |
integer vector with names
Seqlevels covRle Extracted from forward RleList
## S4 method for signature 'covRle' seqlevels(x)## S4 method for signature 'covRle' seqlevels(x)
x |
a covRle object |
integer vector with names
Seqlevels covRleList Extracted from forward RleList
## S4 method for signature 'covRleList' seqlevels(x)## S4 method for signature 'covRleList' seqlevels(x)
x |
a covRle object |
integer vector with names
Seqlevels ORFik experiment Extracted from fasta genome index
## S4 method for signature 'experiment' seqlevels(x)## S4 method for signature 'experiment' seqlevels(x)
x |
an ORFik |
integer vector with names
Seqnames ORFik experiment Extracted from fasta genome index
## S4 method for signature 'experiment' seqnames(x)## S4 method for signature 'experiment' seqnames(x)
x |
an ORFik |
integer vector with names
Get first seqname per GRangesList group
seqnamesPerGroup(grl, keep.names = TRUE)seqnamesPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
a character vector or Rle of seqnames(if seqnames == T)
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) seqnamesPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) seqnamesPerGroup(grl)
Function shifts footprints (GRanges) using specified offsets for every of the specified lengths. Reads that do not conform to the specified lengths are filtered out and rejected. Reads are resized to single base in 5' end fashion, treated as p site. This function takes account for junctions and soft clips in cigars of the reads. Length of the footprint is saved in size' parameter of GRanges output. Footprints are also sorted according to their genomic position, ready to be saved as a ofst, covRle, bed or wig file.
shiftFootprints(footprints, shifts, sort = TRUE)shiftFootprints(footprints, shifts, sort = TRUE)
footprints |
|
shifts |
a data.frame / data.table with minimum 2 columns,
fraction (selected read lengths) and offsets_start (relative position in nt).
Output from |
sort |
logical, default TRUE. If False will keep original order of reads, and not sort output reads in increasing genomic location per chromosome and strand. |
The two columns in the shift data.frame/data.table argument are:
- fraction Numeric vector of lengths of footprints you select
for shifting.
- offsets_start Numeric vector of shifts for corresponding
selected_lengths. eg. c(-10, -10) with selected_lengths of c(31, 32) means
length of 31 will be shifted left by 10. Footprints of length 32 will be
shifted right by 10.
NOTE: It will remove softclips from valid width, the CIGAR 3S30M is qwidth 33, but will remove 3S so final read width is 30 in ORFik.
A GRanges object of shifted footprints, sorted and
resized to 1bp of p-site,
with metacolumn "size" indicating footprint size before shifting and
resizing, sorted in increasing order.
https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4912-6
Other pshifting:
changePointAnalysis(),
detectRibosomeShifts(),
shiftFootprintsByExperiment(),
shiftPlots(),
shifts_load(),
shifts_save()
## Basic run # Transcriptome annotation -> gtf_file <- system.file("extdata/references/danio_rerio", "annotations.gtf", package = "ORFik") # Ribo seq data -> riboSeq_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") ## Not run: footprints <- readBam(riboSeq_file) # detect the shifts automagically shifts <- detectRibosomeShifts(footprints, gtf_file) # shift the RiboSeq footprints shiftedReads <- shiftFootprints(footprints, shifts) ## End(Not run)## Basic run # Transcriptome annotation -> gtf_file <- system.file("extdata/references/danio_rerio", "annotations.gtf", package = "ORFik") # Ribo seq data -> riboSeq_file <- system.file("extdata/Danio_rerio_sample", "ribo-seq.bam", package = "ORFik") ## Not run: footprints <- readBam(riboSeq_file) # detect the shifts automagically shifts <- detectRibosomeShifts(footprints, gtf_file) # shift the RiboSeq footprints shiftedReads <- shiftFootprints(footprints, shifts) ## End(Not run)
A function that combines the steps of periodic read length detection,
p-site shift detection and p-shifting into 1 function.
For more details, see: detectRibosomeShifts
Saves files to a specified location as .ofst and .wig,
The .ofst file will include a 'score' column with read count at that
position per read width (read width column is called 'size')
The .wig files, will be saved in pairs of +/- strand, and score column
will be replicates of reads starting at that position,
score = 5 means 5 reads.
Remember that different species might have different default Ribosome
read lengths, for human, mouse etc, normally around 27:30.
shiftFootprintsByExperiment( df, out.dir = pasteDir(libFolder(df), "/pshifted/"), start = TRUE, stop = FALSE, top_tx = 10L, minFiveUTR = 30L, minCDS = 150L, minThreeUTR = if (stop) { 30 } else NULL, firstN = 150L, min_reads = 1000, min_reads_TIS = 50, accepted.lengths = 26:34, output_format = c("ofst", "wig"), BPPARAM = bpparam(), tx = NULL, shift.list = NULL, log = TRUE, heatmap = FALSE, must.be.periodic = TRUE, strict.fft = TRUE, verbose = FALSE )shiftFootprintsByExperiment( df, out.dir = pasteDir(libFolder(df), "/pshifted/"), start = TRUE, stop = FALSE, top_tx = 10L, minFiveUTR = 30L, minCDS = 150L, minThreeUTR = if (stop) { 30 } else NULL, firstN = 150L, min_reads = 1000, min_reads_TIS = 50, accepted.lengths = 26:34, output_format = c("ofst", "wig"), BPPARAM = bpparam(), tx = NULL, shift.list = NULL, log = TRUE, heatmap = FALSE, must.be.periodic = TRUE, strict.fft = TRUE, verbose = FALSE )
df |
an ORFik |
out.dir |
output directory for files, default: pasteDir(libFolder(df), "/pshifted/"), making a /pshifted folder inside default bam file location |
start |
(logical) Whether to include predictions based on the start codons. Default TRUE. |
stop |
(logical) Whether to include predictions based on the stop codons. Default FASLE. Only use if there exists 3' UTRs for the annotation. If peridicity around stop codon is stronger than at the start codon, use stop instead of start region for p-shifting. |
top_tx |
(integer), default 10. Specify which % of the top TIS coverage transcripts to use for estimation of the shifts. By default we take top 10 top covered transcripts as they represent less noisy data-set. This is only applicable when there are more than 1000 transcripts. |
minFiveUTR |
(integer) minimum bp for 5' UTR during filtering for the transcripts. Set to NULL if no 5' UTRs exists for annotation. |
minCDS |
(integer) minimum bp for CDS during filtering for the transcripts |
minThreeUTR |
(integer) minimum bp for 3' UTR during filtering for the transcripts. Set to NULL if no 3' UTRs exists for annotation. |
firstN |
(integer) Represents how many bases of the transcripts downstream of start codons to use for initial estimation of the periodicity. |
min_reads |
default (1000), how many reads must a read-length have in total to be considered for periodicity. |
min_reads_TIS |
default (50), how many reads must a read-length have in the TIS region to be considered for periodicity. |
accepted.lengths |
accepted read lengths, default 26:34, usually ribo-seq is strongest between 27:32. |
output_format |
default c("ofst", "wig"), use export.ofst or
wiggle format (wig) using |
BPPARAM |
how many cores/threads to use? default: bpparam() |
tx |
a GRangesList, if you do not have 5' UTRs in annotation, send your own version. Example: extendLeaders(tx, 30) Where 30 bases will be new "leaders". Since each original transcript was either only CDS or non-coding (filtered out). |
shift.list |
default NULL, or a list containing named data.frames / data.tables
with minimum 2 columns, fraction (selected read lengths) and
offsets_start (relative position in nt). 1 named data.frame / data.table per library.
Output from |
log |
logical, default (TRUE), output a log file with parameters used and
a .rds file with all shifts per library
(can be loaded with |
heatmap |
a logical or character string, default FALSE. If TRUE, will plot heatmap of raw reads before p-shifting to console, to see if shifts given make sense. You can also set a filepath to save the file there. |
must.be.periodic |
logical TRUE, if FALSE will not filter on periodic read lengths. (The Fourier transform filter will be skipped). This is useful if you are not going to do periodicity analysis, that is: for you more coverage depth (more read lengths) is more important than only keeping the high quality periodic read lengths. |
strict.fft |
logical, TRUE. Use a FFT without noise filter. This means keep only reads lengths that are "periodic for the human eye". If you want more coverage, set to FALSE, to also get read lengths that are "messy", but the noise filter detects the periodicity of 3. This should only be done when you do not need high quality periodic reads! Example would be differential translation analysis by counts over each ORF. |
verbose |
logical, default FALSE. Report details of analysis/periodogram. Good if you are not sure if the analysis was correct. |
NULL (Objects are saved to out.dir/pshited/"name_pshifted.ofst", wig, bedo or .bedo)
https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-018-4912-6
Other pshifting:
changePointAnalysis(),
detectRibosomeShifts(),
shiftFootprints(),
shiftPlots(),
shifts_load(),
shifts_save()
df <- ORFik.template.experiment.zf() df <- df[1,] #lets only p-shift first RFP sample ## Output files as both .ofst and .wig(can be viewed in IGV/UCSC) shiftFootprintsByExperiment(df) # If you only need in R, do: (then you get no .wig files) #shiftFootprintsByExperiment(df, output_format = "ofst") ## With debug info: #shiftFootprintsByExperiment(df, verbose = TRUE) ## Re-shift, if you think some are wrong ## Here as an example we update library 1, third read length to shift 12 shift.list <- shifts_load(df) shift.list[[1]]$offsets_start[3] <- -12 #shiftFootprintsByExperiment(df, shift.list = shift.list) ## For additional speedup in R for nucleotide coverage (coveragePerTiling etc)df <- ORFik.template.experiment.zf() df <- df[1,] #lets only p-shift first RFP sample ## Output files as both .ofst and .wig(can be viewed in IGV/UCSC) shiftFootprintsByExperiment(df) # If you only need in R, do: (then you get no .wig files) #shiftFootprintsByExperiment(df, output_format = "ofst") ## With debug info: #shiftFootprintsByExperiment(df, verbose = TRUE) ## Re-shift, if you think some are wrong ## Here as an example we update library 1, third read length to shift 12 shift.list <- shifts_load(df) shift.list[[1]]$offsets_start[3] <- -12 #shiftFootprintsByExperiment(df, shift.list = shift.list) ## For additional speedup in R for nucleotide coverage (coveragePerTiling etc)
Around CDS TISs, plot coverage. A good validation for you p-shifting, to see shifts are corresponding and close to the CDS TIS.
shiftPlots( df, output = NULL, title = "Ribo-seq", scoring = "transcriptNormalized", pShifted = TRUE, upstream = if (pShifted) 5 else 20, downstream = if (pShifted) 20 else 5, type = "bar", addFracPlot = TRUE, plot.ext = ".pdf", dpi = ifelse(nrow(df) < 22, 300, 200), height_scaler = ifelse(type == "heatmap", 85, 95), BPPARAM = bpparam() )shiftPlots( df, output = NULL, title = "Ribo-seq", scoring = "transcriptNormalized", pShifted = TRUE, upstream = if (pShifted) 5 else 20, downstream = if (pShifted) 20 else 5, type = "bar", addFracPlot = TRUE, plot.ext = ".pdf", dpi = ifelse(nrow(df) < 22, 300, 200), height_scaler = ifelse(type == "heatmap", 85, 95), BPPARAM = bpparam() )
df |
an ORFik |
output |
name to save file, full path. (Default NULL) No saving. Sett to "auto" to save to QC_STATS folder of experiment named: "pshifts_barplots.png" or "pshifts_heatmaps.png" depending on type argument. Folder must exist! |
title |
Title for top of plot, default "Ribo-seq". A more informative name could be "Ribo-seq zebrafish Chew et al. 2013" |
scoring |
which scoring scheme to use for heatmap, default "transcriptNormalized". Some alternatives: "sum", "zscore". |
pShifted |
a logical (TRUE), are Ribo-seq reads p-shifted to size 1 width reads? If upstream and downstream is set, this argument is irrelevant. So set to FALSE if this is not p-shifted Ribo-seq. |
upstream |
an integer (5), relative region to get upstream from. Default:
|
downstream |
an integer (20), relative region to get downstream from. Default:
|
type |
character, default "bar". Plot as faceted bars, gives more detailed information of read lengths, but harder to see patterns over multiple read lengths. Alternative: "heatmap", better overview of patterns over multiple read lengths. |
addFracPlot |
logical, default TRUE, add positional sum plot on top per heatmap. |
plot.ext |
default ".pdf". Alternative ".png". Only added if output is "auto". |
dpi |
numeric, default: ifelse(nrow(df) < 22, 300, 200) |
height_scaler |
numeric default: ifelse(type == "heatmap", 85, 95).
The total height of plot in unit "mm" is
|
BPPARAM |
how many cores/threads to use? default: bpparam() |
a ggplot2 grob object
Other pshifting:
changePointAnalysis(),
detectRibosomeShifts(),
shiftFootprints(),
shiftFootprintsByExperiment(),
shifts_load(),
shifts_save()
df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][1,] #lets only p-shift first RFP sample #shiftFootprintsByExperiment(df, output_format = "ofst") #grob <- shiftPlots(df, title = "Ribo-seq Human ORFik et al. 2020") #plot(grob) #Only plot in RStudio for small amount of files!df <- ORFik.template.experiment() df <- df[df$libtype == "RFP",][1,] #lets only p-shift first RFP sample #shiftFootprintsByExperiment(df, output_format = "ofst") #grob <- shiftPlots(df, title = "Ribo-seq Human ORFik et al. 2020") #plot(grob) #Only plot in RStudio for small amount of files!
When you p-shift using the function shiftFootprintsByExperiment, you will get a list of shifts per library. To automatically load them, you can use this function. Defaults to loading pshifts, if you made a-sites or e-sites, change the path argument to ashifted/eshifted folder instead.
shifts_load( df, path = file.path(libFolder(df), "pshifted", "shifting_table.rds") )shifts_load( df, path = file.path(libFolder(df), "pshifted", "shifting_table.rds") )
df |
an ORFik |
path |
path, default file.path(libFolder(df), "pshifted", "shifting_table.rds"). Path to .rds file containing the shifts as a list, one list element per shifted bam file. |
a list of the shifts, one list element per shifted bam file.
Other pshifting:
changePointAnalysis(),
detectRibosomeShifts(),
shiftFootprints(),
shiftFootprintsByExperiment(),
shiftPlots(),
shifts_save()
df <- ORFik.template.experiment() # subset on Ribo-seq df <- df[df$libtype == "RFP",][1,] #shiftFootprintsByExperiment(df) #shifts_load(df)df <- ORFik.template.experiment() # subset on Ribo-seq df <- df[df$libtype == "RFP",][1,] #shiftFootprintsByExperiment(df) #shifts_load(df)
Should be stored in pshifted folder relative to default files
shifts_save(shifts, folder)shifts_save(shifts, folder)
shifts |
a list of data.table/data.frame objects. Must be named with the full path to ofst/bam files that defines the shifts. |
folder |
directory to save file, Usually: file.path(libFolder(df), "pshifted"), where df is the ORFik experiment / or your path of default file types. It will be named file.path(folder, "shifting_table.rds"). For ORFik to work optimally, the folder should be the /pshifted/ folder relative to default files. |
invisible(NULL), file saved to disc as "shifting_table.rds".
Other pshifting:
changePointAnalysis(),
detectRibosomeShifts(),
shiftFootprints(),
shiftFootprintsByExperiment(),
shiftPlots(),
shifts_load()
df <- ORFik.template.experiment.zf() shifts <- shifts_load(df) original_shifts <- file.path(libFolder(df), "pshifted", "shifting_table.rds") # Move to temp new_shifts_path <- file.path(tempdir(), "shifting_table.rds") new_shifts <- c(shifts, shifts) names(new_shifts)[2] <- file.path(tempdir(), "RiboSeqTemp.ofst") saveRDS(new_shifts, new_shifts_path) new_shifts[[1]][1,2] <- -10 # Now update the new shifts, here we input only first shifts_save(new_shifts[1], tempdir()) readRDS(new_shifts_path) # You still get 2 outputsdf <- ORFik.template.experiment.zf() shifts <- shifts_load(df) original_shifts <- file.path(libFolder(df), "pshifted", "shifting_table.rds") # Move to temp new_shifts_path <- file.path(tempdir(), "shifting_table.rds") new_shifts <- c(shifts, shifts) names(new_shifts)[2] <- file.path(tempdir(), "RiboSeqTemp.ofst") saveRDS(new_shifts, new_shifts_path) new_shifts[[1]][1,2] <- -10 # Now update the new shifts, here we input only first shifts_save(new_shifts[1], tempdir()) readRDS(new_shifts_path) # You still get 2 outputs
Show a simplified version of the covRle
## S4 method for signature 'covRle' show(object)## S4 method for signature 'covRle' show(object)
object |
print state of covRle
Show a simplified version of the covRleList.
## S4 method for signature 'covRleList' show(object)## S4 method for signature 'covRleList' show(object)
object |
print state of covRleList
Show a simplified version of the experiment. The show function simplifies the view so that any column of data (like replicate or stage) is not shown, if all values are identical in that column. Filepaths are also never shown.
## S4 method for signature 'experiment' show(object)## S4 method for signature 'experiment' show(object)
object |
an ORFik |
print state of experiment
Export as either .ofst, .wig, .bigWig,.bedo (legacy format) or .bedoc (legacy format) files:
Export files as .ofst for fastest load speed into R.
Export files as .wig / bigWig for use in IGV or other genome browsers.
The input files are checked if they exist from: envExp(df).
simpleLibs( df, out.dir = libFolder(df), addScoreColumn = TRUE, addSizeColumn = TRUE, must.overlap = NULL, method = "None", type = "ofst", input.type = "ofst", reassign.when.saving = FALSE, envir = envExp(df), force = TRUE, library.names = bamVarName(df), libs = outputLibs(df, type = input.type, chrStyle = must.overlap, library.names = library.names, output.mode = "list", force = force, BPPARAM = BPPARAM), BPPARAM = bpparam() )simpleLibs( df, out.dir = libFolder(df), addScoreColumn = TRUE, addSizeColumn = TRUE, must.overlap = NULL, method = "None", type = "ofst", input.type = "ofst", reassign.when.saving = FALSE, envir = envExp(df), force = TRUE, library.names = bamVarName(df), libs = outputLibs(df, type = input.type, chrStyle = must.overlap, library.names = library.names, output.mode = "list", force = force, BPPARAM = BPPARAM), BPPARAM = bpparam() )
df |
an ORFik |
out.dir |
optional output directory, default: libFolder(df), if it is NULL, it will just reassign R objects to simplified libraries. Will then create a final folder specfied as: paste0(out.dir, "/", type, "/"). Here the files will be saved in format given by the type argument. |
addScoreColumn |
logical, default TRUE, if FALSE will not add replicate numbers as score column, see ORFik::convertToOneBasedRanges. |
addSizeColumn |
logical, default TRUE, if FALSE will not add size (width) as size column, see ORFik::convertToOneBasedRanges. Does not apply for (GAlignment version of.ofst) or .bedoc. Since they contain the original cigar. |
must.overlap |
default (NULL), else a GRanges / GRangesList object, so only reads that overlap (must.overlap) are kept. This is useful when you only need the reads over transcript annotation or subset etc. |
method |
character, default "None", the method to reduce ranges,
for more info see |
type |
character, output format, default "ofst". Alternatives: "ofst", "bigWig", "wig","bedo" or "bedoc". Which format you want. Will make a folder within out.dir with this name containing the files. |
input.type |
character, input type "ofst". Remember this function uses the loaded libraries if existing, so this argument is usually ignored. Only used if files do not already exist. |
reassign.when.saving |
logical, default FALSE. If TRUE, will reassign library to converted form after saving. Ignored when out.dir = NULL. |
envir |
environment to save to, default
|
force |
logical, default TRUE If TRUE, reload library files even if
matching named variables are found in environment used by experiment
(see |
library.names |
character vector, names of libraries, default: name_decider(df, naming) |
libs |
list, output of outputLibs as list of GRanges/GAlignments/GAlignmentPairs objects. Set input.type and force arguments to define parameters. |
BPPARAM |
how many cores/threads to use? default: bpparam().
To see number of threads used, do |
We advice you to not use this directly, as other function are more safe for library type conversions. See family description below. This is mostly used internally in ORFik. It is only adviced to use if large bam files are already loaded in R and conversions are wanted from those.
See export.ofst, export.wiggle,
export.bedo and export.bedoc
for information on file formats.
If libraries of the experiment are
already loaded into environment (default: .globalEnv) is will export
using those files as templates. If they are not in environment the
.ofst files from the bam files are loaded (unless you are converting
to .ofst then the .bam files are loaded).
invisible NULL (saves files to disc or R .GlobalEnv)
Other lib_converters:
convert_bam_to_ofst(),
convert_to_bigWig(),
convert_to_covRle(),
convert_to_covRleList()
df <- ORFik.template.experiment() #convertLibs(df, out.dir = NULL) # Keep only 5' ends of reads #convertLibs(df, out.dir = NULL, method = "5prime")df <- ORFik.template.experiment() #convertLibs(df, out.dir = NULL) # Keep only 5' ends of reads #convertLibs(df, out.dir = NULL, method = "5prime")
A faster, more versatile reimplementation of
sort.GenomicRanges for GRangesList,
needed since the original works poorly for more than 10k groups.
This function sorts each group, where "+" strands are
increasing by starts and "-" strands are decreasing by ends.
sortPerGroup(grl, ignore.strand = FALSE, quick.rev = FALSE)sortPerGroup(grl, ignore.strand = FALSE, quick.rev = FALSE)
grl |
|
ignore.strand |
a boolean, (default FALSE): should minus strands be sorted from highest to lowest ends. If TRUE: from lowest to highest ends. |
quick.rev |
default: FALSE, if TRUE, given that you know all ranges are sorted from min to max for both strands, it will only reverse coordinates for minus strand groups, and only if they are in increasing order. Much quicker |
Note: will not work if groups have equal names.
an equally named GRangesList, where each group is sorted within group.
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(14, 7), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(1, 4), c(3, 9)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) sortPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(14, 7), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(1, 4), c(3, 9)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) sortPerGroup(grl)
Does either all files as paired end or single end,
so if you have mix, split them in two different folders.
If STAR halts at .... loading genome, it means the STAR
index was aborted early, then you need to run:
STAR.remove.crashed.genome(), with the genome that crashed, and rerun.
STAR.align.folder( input.dir, output.dir, index.dir, star.path = STAR.install(), fastp = install.fastp(), paired.end = FALSE, steps = "tr-ge", adapter.sequence = "auto", quality.filtering = FALSE, min.length = 20, mismatches = 3, trim.front = 0, trim.tail = 0, max.multimap = 10, alignment.type = "Local", allow.introns = TRUE, max.cpus = min(90, BiocParallel::bpparam()$workers), include.subfolders = "n", resume = NULL, multiQC = TRUE, keep.contaminants = FALSE, keep.contaminants.type = c("bam", "fastq")[1], keep.unaligned.genome = FALSE, keep.index.in.memory = FALSE, script.folder = system.file("STAR_Aligner", "RNA_Align_pipeline_folder.sh", package = "ORFik"), script.single = system.file("STAR_Aligner", "RNA_Align_pipeline.sh", package = "ORFik") )STAR.align.folder( input.dir, output.dir, index.dir, star.path = STAR.install(), fastp = install.fastp(), paired.end = FALSE, steps = "tr-ge", adapter.sequence = "auto", quality.filtering = FALSE, min.length = 20, mismatches = 3, trim.front = 0, trim.tail = 0, max.multimap = 10, alignment.type = "Local", allow.introns = TRUE, max.cpus = min(90, BiocParallel::bpparam()$workers), include.subfolders = "n", resume = NULL, multiQC = TRUE, keep.contaminants = FALSE, keep.contaminants.type = c("bam", "fastq")[1], keep.unaligned.genome = FALSE, keep.index.in.memory = FALSE, script.folder = system.file("STAR_Aligner", "RNA_Align_pipeline_folder.sh", package = "ORFik"), script.single = system.file("STAR_Aligner", "RNA_Align_pipeline.sh", package = "ORFik") )
input.dir |
path to fast files to align, the valid input files will be search for from formats: (".fasta", ".fastq", ".fq", or ".fa") with or without compression of .gz. Also either paired end or single end reads. Pairs will automatically be detected from similarity of naming, separated by something as .1 and .2 in the end. If files are renamed, where pairs are not similarily named, this process will fail to find correct pairs! |
output.dir |
directory to save indices, default: paste0(dirname(arguments[1]), "/STAR_index/"), where arguments is the arguments input for this function. |
index.dir |
path to STAR index folder. Path returned from ORFik function STAR.index, when you created the index folders. |
star.path |
path to STAR, default: STAR.install(), if you don't have STAR installed at default location, it will install it there, set path to a runnable star if you already have it. |
fastp |
path to fastp trimmer, default: install.fastp(), if you have it somewhere else already installed, give the path. Only works for unix (linux or Mac OS), if not on unix, use your favorite trimmer and give the output files from that trimmer as input.dir here. |
paired.end |
a logical: default FALSE, alternative TRUE. If TRUE, will auto detect
pairs by names. Can not be a combination of both TRUE and FALSE! |
steps |
a character, default: "tr-ge", trimming then genome alignment
If not "all", a subset of these ("tr-co-ph-rR-nc-tR-ge") |
adapter.sequence |
character, default: "auto". Auto detect adapter using fastp
adapter auto detection, checking first 1.5M reads. (Auto detection of adapter will
not work 100% of the time (if the library is of low quality), then you must rerun
this function with specified adapter from fastp adapter analysis.
, using FASTQC or other adapter detection tools, else alignment will most likely fail!).
If already trimmed or trimming not wanted:
adapter.sequence = "disable" .You can manually assign adapter like:
"ATCTCGTATGCCGTCTTCTGCTTG" or "AAAAAAAAAAAAA". You can also specify one of the three
presets:
Paired end auto detection uses overlap sequence of pairs, to use the slower more secure paired end adapter detection, specify as: "autoPE". |
quality.filtering |
logical, default FALSE. Not needed for modern
library prep of RNA-seq, Ribo-seq etc (usually < ~ 0.5
If you are aligning bad quality data, set this to TRUE.
|
min.length |
20, minimum length of aligned read without mismatches to pass filter. Anything under 20 is dangerous, as chance of random hits will become high! |
mismatches |
3, max non matched bases. Excludes soft-clipping, this only filters reads that have defined mismatches in STAR. Only applies for genome alignment step. |
trim.front |
0, default trim 0 bases on 5' ends. Ignored if tr (trim) is not one of the arguments in "steps". For Ribo-seq use default 0, unless you have 5' end custom barcodes to remove. Alignment to STAR might fail if you have large barcodes, which are not removed! |
trim.tail |
0, default trim 0 bases on 3' ends. Ignored if tr (trim) is not one of the arguments in "steps". For Ribo-seq use default 0, unless you have 3' end custom barcodes to remove. Alignment to STAR might fail if you have large barcodes, which are not removed! |
max.multimap |
numeric, default 10. If a read maps to more locations than specified, will skip the read. Set to 1 to only get unique mapping reads. Only applies for genome alignment step. The depletions are allowing for multimapping. |
alignment.type |
default: "Local": standard local alignment with soft-clipping allowed, "EndToEnd" (global): force end-to-end read alignment, does not soft-clip. |
allow.introns |
logical, default TRUE. Allow large gaps of N in reads during genome alignment, if FALSE: sets –alignIntronMax to 1 (no introns). NOTE: You will still get some spliced reads if you assigned a gtf at the index step. |
max.cpus |
integer, default: |
include.subfolders |
"n" (no), do recursive search downwards for fast files if "y". |
resume |
default: NULL, continue from step, lets say steps are "tr-ph-ge": (trim, phix depletion, genome alignment) and resume is "ge", you will then use the assumed already trimmed and phix depleted data and start at genome alignment, useful if something crashed. Like if you specified wrong STAR version, but the trimming step was completed. Resume mode can only run 1 step at the time. |
multiQC |
logical, default TRUE. Do mutliQC comparison of STAR alignment between all the samples. Outputted in aligned/LOGS folder. See ?STAR.multiQC |
keep.contaminants |
logical, default FALSE. Create and keep contaminant aligning bam files, default is to only keep unaliged fastq reads, which will be further processed in "ge" genome alignment step. Useful if you want to do further processing on contaminants, like specific coverage of specific tRNAs etc. |
keep.contaminants.type |
logical, default "bam". If aligned files of contaminants are kept, which format to output as, only supports "bam" for now. Fasta / Fastq will be implemented later. |
keep.unaligned.genome |
logical, default FALSE. Create and keep reads that did not align at the genome alignment step, default is to only keep the aliged bam file. Useful if you want to do further processing on plasmids/custom sequences. |
keep.index.in.memory |
logical or character, default FALSE (i.e. LoadAndRemove).
For STAR.align.single: |
script.folder |
location of STAR index script, default internal ORFik file. You can change it and give your own if you need special alignments. |
script.single |
location of STAR single file alignment script, default internal ORFik file. You can change it and give your own if you need special alignments. |
Can only run on unix systems (Linux, Mac and WSL (Windows Subsystem Linux)),
and requires a minimum of 30GB memory on genomes like human, rat, zebrafish etc.
If for some reason the internal STAR alignment bash script will not work for you,
like if you want more customization of the STAR/fastp arguments.
You can copy the internal alignment script,
edit it and give that as the script used for this function.
The trimmer used is fastp (the fastest I could find), also works on
(Linux, Mac and WSL (Windows Subsystem Linux)).
If you want to use your own trimmer set file1/file2 to the location of
the trimmed files from your program.
A note on trimming from creator of STAR about trimming:
"adapter trimming it definitely needed for short RNA sequencing.
For long RNA-seq, I would agree with Devon that in most cases adapter trimming
is not advantageous, since, by default, STAR performs local (not end-to-end) alignment,
i.e. it auto-trims." So trimming can be skipped for longer reads.
output.dir, can be used as as input in ORFik::create.experiment
Other STAR:
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.install(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation(),
install.fastp()
# First specify directories wanted (temp directory here) config_file <- tempfile() #config.save(config_file, base.dir = tempdir()) #config <- ORFik::config(config_file) ## Yeast RNA-seq samples (small genome) #project <- ORFik::config.exper("chalmers_2012", "Saccharomyces_cerevisiae", "RNA-seq", config) #annotation.dir <- project["ref"] #fastq.input.dir <- project["fastq RNA-seq"] #bam.output.dir <- project["bam RNA-seq"] ## Download some SRA data and metadata (subset to 50k reads) # info <- download.SRA.metadata("SRP012047", outdir = conf["fastq RNA-seq"]) # info <- info[1:2,] # Subset to 2 first libraries # download.SRA(info, fastq.input.dir, rename = FALSE, subset = 50000) ## No contaminant depletion: # annotation <- getGenomeAndAnnotation("Saccharomyces cerevisiae", annotation.dir) # index <- STAR.index(annotation) # STAR.align.folder(fastq.input.dir, bam.output.dir, # index, paired.end = FALSE) # Trim, then align to genome ## Human Ribo-seq sample (NB! very large genome and libraries!) ## Requires >= 32 GB memory #project <- ORFik::config.exper("subtelny_2014", "Homo_sapiens", "Ribo-seq", config) #annotation.dir <- project["ref"] #fastq.input.dir <- project["fastq Ribo-seq"] #bam.output.dir <- project["bam Ribo-seq"] ## Download some SRA data and metadata (full libraries) # info <- download.SRA.metadata("DRR041459", fastq.input.dir) # download.SRA(info, fastq.input.dir, rename = FALSE) ## Now align 2 different ways, without and with contaminant depletion ## No contaminant depletion: # annotation <- getGenomeAndAnnotation("Homo sapiens", annotation.dir) # index <- STAR.index(annotation) # STAR.align.folder(fastq.input.dir, bam.output.dir, # index, paired.end = FALSE) ## All contaminants merged: # annotation <- getGenomeAndAnnotation( # organism = "Homo_sapiens", # phix = TRUE, ncRNA = TRUE, tRNA = TRUE, rRNA = TRUE, # output.dir = annotation.dir # ) # index <- STAR.index(annotation) # STAR.align.folder(fastq.input.dir, bam.output.dir, # index, paired.end = FALSE, # steps = "tr-ge")# First specify directories wanted (temp directory here) config_file <- tempfile() #config.save(config_file, base.dir = tempdir()) #config <- ORFik::config(config_file) ## Yeast RNA-seq samples (small genome) #project <- ORFik::config.exper("chalmers_2012", "Saccharomyces_cerevisiae", "RNA-seq", config) #annotation.dir <- project["ref"] #fastq.input.dir <- project["fastq RNA-seq"] #bam.output.dir <- project["bam RNA-seq"] ## Download some SRA data and metadata (subset to 50k reads) # info <- download.SRA.metadata("SRP012047", outdir = conf["fastq RNA-seq"]) # info <- info[1:2,] # Subset to 2 first libraries # download.SRA(info, fastq.input.dir, rename = FALSE, subset = 50000) ## No contaminant depletion: # annotation <- getGenomeAndAnnotation("Saccharomyces cerevisiae", annotation.dir) # index <- STAR.index(annotation) # STAR.align.folder(fastq.input.dir, bam.output.dir, # index, paired.end = FALSE) # Trim, then align to genome ## Human Ribo-seq sample (NB! very large genome and libraries!) ## Requires >= 32 GB memory #project <- ORFik::config.exper("subtelny_2014", "Homo_sapiens", "Ribo-seq", config) #annotation.dir <- project["ref"] #fastq.input.dir <- project["fastq Ribo-seq"] #bam.output.dir <- project["bam Ribo-seq"] ## Download some SRA data and metadata (full libraries) # info <- download.SRA.metadata("DRR041459", fastq.input.dir) # download.SRA(info, fastq.input.dir, rename = FALSE) ## Now align 2 different ways, without and with contaminant depletion ## No contaminant depletion: # annotation <- getGenomeAndAnnotation("Homo sapiens", annotation.dir) # index <- STAR.index(annotation) # STAR.align.folder(fastq.input.dir, bam.output.dir, # index, paired.end = FALSE) ## All contaminants merged: # annotation <- getGenomeAndAnnotation( # organism = "Homo_sapiens", # phix = TRUE, ncRNA = TRUE, tRNA = TRUE, rRNA = TRUE, # output.dir = annotation.dir # ) # index <- STAR.index(annotation) # STAR.align.folder(fastq.input.dir, bam.output.dir, # index, paired.end = FALSE, # steps = "tr-ge")
Given a single NGS fastq/fasta library, or a paired setup of 2 mated libraries. Run either combination of fastq trimming, contamination removal and genome alignment. Works for (Linux, Mac and WSL (Windows Subsystem Linux))
STAR.align.single( file1, file2 = NULL, output.dir, index.dir, star.path = STAR.install(), fastp = install.fastp(), steps = "tr-ge", adapter.sequence = "auto", quality.filtering = FALSE, min.length = 20, mismatches = 3, trim.front = 0, trim.tail = 0, max.multimap = 10, alignment.type = "Local", allow.introns = TRUE, max.cpus = min(90, BiocParallel::bpparam()$workers), resume = NULL, multiQC = FALSE, keep.contaminants = FALSE, keep.unaligned.genome = FALSE, keep.index.in.memory = FALSE, script.single = system.file("STAR_Aligner", "RNA_Align_pipeline.sh", package = "ORFik") )STAR.align.single( file1, file2 = NULL, output.dir, index.dir, star.path = STAR.install(), fastp = install.fastp(), steps = "tr-ge", adapter.sequence = "auto", quality.filtering = FALSE, min.length = 20, mismatches = 3, trim.front = 0, trim.tail = 0, max.multimap = 10, alignment.type = "Local", allow.introns = TRUE, max.cpus = min(90, BiocParallel::bpparam()$workers), resume = NULL, multiQC = FALSE, keep.contaminants = FALSE, keep.unaligned.genome = FALSE, keep.index.in.memory = FALSE, script.single = system.file("STAR_Aligner", "RNA_Align_pipeline.sh", package = "ORFik") )
file1 |
library file, if paired must be R1 file. Allowed formats are: (.fasta, .fastq, .fq, or.fa) with or without compression of .gz. This filename usually contains a suffix of .1 |
file2 |
default NULL, set if paired end to R2 file. Allowed formats are: (.fasta, .fastq, .fq, or.fa) with or without compression of .gz. This filename usually contains a suffix of .2 |
output.dir |
directory to save indices, default: paste0(dirname(arguments[1]), "/STAR_index/"), where arguments is the arguments input for this function. |
index.dir |
path to STAR index folder. Path returned from ORFik function STAR.index, when you created the index folders. |
star.path |
path to STAR, default: STAR.install(), if you don't have STAR installed at default location, it will install it there, set path to a runnable star if you already have it. |
fastp |
path to fastp trimmer, default: install.fastp(), if you have it somewhere else already installed, give the path. Only works for unix (linux or Mac OS), if not on unix, use your favorite trimmer and give the output files from that trimmer as input.dir here. |
steps |
a character, default: "tr-ge", trimming then genome alignment
If not "all", a subset of these ("tr-co-ph-rR-nc-tR-ge") |
adapter.sequence |
character, default: "auto". Auto detect adapter using fastp
adapter auto detection, checking first 1.5M reads. (Auto detection of adapter will
not work 100% of the time (if the library is of low quality), then you must rerun
this function with specified adapter from fastp adapter analysis.
, using FASTQC or other adapter detection tools, else alignment will most likely fail!).
If already trimmed or trimming not wanted:
adapter.sequence = "disable" .You can manually assign adapter like:
"ATCTCGTATGCCGTCTTCTGCTTG" or "AAAAAAAAAAAAA". You can also specify one of the three
presets:
Paired end auto detection uses overlap sequence of pairs, to use the slower more secure paired end adapter detection, specify as: "autoPE". |
quality.filtering |
logical, default FALSE. Not needed for modern
library prep of RNA-seq, Ribo-seq etc (usually < ~ 0.5
If you are aligning bad quality data, set this to TRUE.
|
min.length |
20, minimum length of aligned read without mismatches to pass filter. Anything under 20 is dangerous, as chance of random hits will become high! |
mismatches |
3, max non matched bases. Excludes soft-clipping, this only filters reads that have defined mismatches in STAR. Only applies for genome alignment step. |
trim.front |
0, default trim 0 bases on 5' ends. Ignored if tr (trim) is not one of the arguments in "steps". For Ribo-seq use default 0, unless you have 5' end custom barcodes to remove. Alignment to STAR might fail if you have large barcodes, which are not removed! |
trim.tail |
0, default trim 0 bases on 3' ends. Ignored if tr (trim) is not one of the arguments in "steps". For Ribo-seq use default 0, unless you have 3' end custom barcodes to remove. Alignment to STAR might fail if you have large barcodes, which are not removed! |
max.multimap |
numeric, default 10. If a read maps to more locations than specified, will skip the read. Set to 1 to only get unique mapping reads. Only applies for genome alignment step. The depletions are allowing for multimapping. |
alignment.type |
default: "Local": standard local alignment with soft-clipping allowed, "EndToEnd" (global): force end-to-end read alignment, does not soft-clip. |
allow.introns |
logical, default TRUE. Allow large gaps of N in reads during genome alignment, if FALSE: sets –alignIntronMax to 1 (no introns). NOTE: You will still get some spliced reads if you assigned a gtf at the index step. |
max.cpus |
integer, default: |
resume |
default: NULL, continue from step, lets say steps are "tr-ph-ge": (trim, phix depletion, genome alignment) and resume is "ge", you will then use the assumed already trimmed and phix depleted data and start at genome alignment, useful if something crashed. Like if you specified wrong STAR version, but the trimming step was completed. Resume mode can only run 1 step at the time. |
multiQC |
logical, default TRUE. Do mutliQC comparison of STAR alignment between all the samples. Outputted in aligned/LOGS folder. See ?STAR.multiQC |
keep.contaminants |
logical, default FALSE. Create and keep contaminant aligning bam files, default is to only keep unaliged fastq reads, which will be further processed in "ge" genome alignment step. Useful if you want to do further processing on contaminants, like specific coverage of specific tRNAs etc. |
keep.unaligned.genome |
logical, default FALSE. Create and keep reads that did not align at the genome alignment step, default is to only keep the aliged bam file. Useful if you want to do further processing on plasmids/custom sequences. |
keep.index.in.memory |
logical or character, default FALSE (i.e. LoadAndRemove).
For STAR.align.single: |
script.single |
location of STAR single file alignment script, default internal ORFik file. You can change it and give your own if you need special alignments. |
Can only run on unix systems (Linux, Mac and WSL (Windows Subsystem Linux)),
and requires a minimum of 30GB memory on genomes like human, rat, zebrafish etc.
If for some reason the internal STAR alignment bash script will not work for you,
like if you want more customization of the STAR/fastp arguments.
You can copy the internal alignment script,
edit it and give that as the script used for this function.
The trimmer used is fastp (the fastest I could find), also works on
(Linux, Mac and WSL (Windows Subsystem Linux)).
If you want to use your own trimmer set file1/file2 to the location of
the trimmed files from your program.
A note on trimming from creator of STAR about trimming:
"adapter trimming it definitely needed for short RNA sequencing.
For long RNA-seq, I would agree with Devon that in most cases adapter trimming
is not advantageous, since, by default, STAR performs local (not end-to-end) alignment,
i.e. it auto-trims." So trimming can be skipped for longer reads.
output.dir, can be used as as input in ORFik::create.experiment
Other STAR:
STAR.align.folder(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.install(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation(),
install.fastp()
## Specify output libraries (using temp config) config_file <- tempfile() #config.save(config_file, base.dir = tempdir()) #config <- ORFik::config(config_file) #project <- ORFik::config.exper("yeast_1", "Saccharomyces_cerevisiae", "RNA-seq", config) # Get genome of yeast (quite small) # arguments <- getGenomeAndAnnotation("Saccharomyces cerevisiae", project["ref"]) # index <- STAR.index(arguments) ## Make fake reads #genome <- readDNAStringSet(arguments["genome"]) #which_chromosomes <- sample(seq_along(genome), 1000, TRUE, prob = width(genome)) #nt50_windows <- lapply(which_chromosomes, function(x) # {window <- sample(width(genome[x]) - 51, 1); genome[[x]][seq(window, window+49)]}) #nt50_windows <- DNAStringSet(nt50_windows) #names(nt50_windows) <- paste0("read_", seq_along(nt50_windows)) #dir.create(project["fastq RNA-seq"], recursive = TRUE) #fake_fasta <- file.path(project["fastq RNA-seq"], "fake-RNA-seq.fasta") #writeXStringSet(nt50_windows, fake_fasta, format = "fasta") ## Align the fake reads and import bam # STAR.align.single(fake_fasta, NULL, project["bam RNA-seq"], index, steps = "ge") #bam_file <- list.files(file.path(project["bam RNA-seq"], "aligned"), # pattern = "\.bam$", full.names = TRUE) #fimport(bam_file)## Specify output libraries (using temp config) config_file <- tempfile() #config.save(config_file, base.dir = tempdir()) #config <- ORFik::config(config_file) #project <- ORFik::config.exper("yeast_1", "Saccharomyces_cerevisiae", "RNA-seq", config) # Get genome of yeast (quite small) # arguments <- getGenomeAndAnnotation("Saccharomyces cerevisiae", project["ref"]) # index <- STAR.index(arguments) ## Make fake reads #genome <- readDNAStringSet(arguments["genome"]) #which_chromosomes <- sample(seq_along(genome), 1000, TRUE, prob = width(genome)) #nt50_windows <- lapply(which_chromosomes, function(x) # {window <- sample(width(genome[x]) - 51, 1); genome[[x]][seq(window, window+49)]}) #nt50_windows <- DNAStringSet(nt50_windows) #names(nt50_windows) <- paste0("read_", seq_along(nt50_windows)) #dir.create(project["fastq RNA-seq"], recursive = TRUE) #fake_fasta <- file.path(project["fastq RNA-seq"], "fake-RNA-seq.fasta") #writeXStringSet(nt50_windows, fake_fasta, format = "fasta") ## Align the fake reads and import bam # STAR.align.single(fake_fasta, NULL, project["bam RNA-seq"], index, steps = "ge") #bam_file <- list.files(file.path(project["bam RNA-seq"], "aligned"), # pattern = "\.bam$", full.names = TRUE) #fimport(bam_file)
Takes a folder with multiple Log.final.out files from STAR, and create a multiQC report. This is automatically run with STAR.align.folder function.
STAR.allsteps.multiQC( folder, steps = "auto", plot.ext = ".pdf", output.file = file.path(folder, "full_process.csv") )STAR.allsteps.multiQC( folder, steps = "auto", plot.ext = ".pdf", output.file = file.path(folder, "full_process.csv") )
folder |
path to main output folder of STAR run. The folder that contains /aligned/, "/trim/, "contaminants_depletion" etc. To find the LOGS folders in, to use for summarized statistics. |
steps |
a character, default "auto". Find which steps you did. If manual, a combination of "tr-co-ge". See STAR alignment functions for description. |
plot.ext |
character, default ".pdf". Which format to save QC plot. Alternative: ".png". |
output.file |
character, file path, default: file.path(folder, "full_process.csv") |
data.table of main statistics, plots and data saved to disc. Named: "/00_STAR_LOG_plot.pdf" and "/00_STAR_LOG_table.csv"
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.index(),
STAR.install(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation(),
install.fastp()
process_dir <- system.file("extdata/test_processing/", package = "ORFik") STAR.allsteps.multiQC(process_dir) STAR.allsteps.multiQC(process_dir, steps = "tr-ge")process_dir <- system.file("extdata/test_processing/", package = "ORFik") STAR.allsteps.multiQC(process_dir) STAR.allsteps.multiQC(process_dir, steps = "tr-ge")
Used as reference when aligning data
Get genome and gtf by running getGenomeAndFasta()
STAR.index( arguments, output.dir = paste0(dirname(arguments[1]), "/STAR_index/"), star.path = STAR.install(), max.cpus = min(90, BiocParallel::bpparam()$workers), max.ram = 30, SAsparse = 1, tmpDirStar = "-", remake = FALSE, script = system.file("STAR_Aligner", "STAR_MAKE_INDEX.sh", package = "ORFik"), notify_load_existing = TRUE )STAR.index( arguments, output.dir = paste0(dirname(arguments[1]), "/STAR_index/"), star.path = STAR.install(), max.cpus = min(90, BiocParallel::bpparam()$workers), max.ram = 30, SAsparse = 1, tmpDirStar = "-", remake = FALSE, script = system.file("STAR_Aligner", "STAR_MAKE_INDEX.sh", package = "ORFik"), notify_load_existing = TRUE )
arguments |
a named character vector containing paths wanted to use for index creation. They must be named correctly: names must be a subset of: c("gtf", "genome", "contaminants", "phix", "rRNA", "tRNA","ncRNA") |
output.dir |
directory to save indices, default: paste0(dirname(arguments[1]), "/STAR_index/"), where arguments is the arguments input for this function. |
star.path |
path to STAR, default: STAR.install(), if you don't have STAR installed at default location, it will install it there, set path to a runnable star if you already have it. |
max.cpus |
integer, default: |
max.ram |
integer, default 30, in Giga Bytes (GB). Maximum amount of RAM allowed for STAR limitGenomeGenerateRAM argument. RULE: idealy 10x genome size, but do not set too close to machine limit. Default fits well for human genome size (3 GB * 10 = 30 GB) |
SAsparse |
int > 0, default 1. If you do not have at least 64GB RAM, you might need to set this to 2. suffux array sparsity, i.e. distance between indices: use bigger numbers to decrease needed RAM at the cost of mapping speed reduction. Only applies to genome, not conaminants. |
tmpDirStar |
character, default "-". STAR automatic temp folder creation,
deleted when done. The directory can not exists, as a safety STAR must make it!.
If you are on a NFS file share drive, and you have a non NFS tmp dir,
set this to |
remake |
logical, default: FALSE, if TRUE remake everything specified |
script |
location of STAR index script, default internal ORFik file. You can change it and give your own if you need special alignments. |
notify_load_existing |
logical, default TRUE. If annotation exists (defined as: locally (a file called outputs.rds) exists in outputdir), print a small message notifying the user it is not redownloading. Set to FALSE, if this is not wanted |
Can only run on unix systems (Linux and Mac), and requires
minimum 30GB memory on genomes like human, rat, zebrafish etc.
If for some reason the internal STAR index bash script will not work for you,
like if you have a very small genome. You can copy the internal index script,
edit it and give that as the Index script used for this function.
It is recommended to run through the RStudio local job tab, to give full info
about the run. The system console will not stall, as can happen in happen in
normal RStudio console.
output.dir, can be used as as input for STAR.align..
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.install(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation(),
install.fastp()
## Manual way, specify all paths yourself. #arguments <- c(path.GTF, path.genome, path.phix, path.rrna, path.trna, path.ncrna) #names(arguments) <- c("gtf", "genome", "phix", "rRNA", "tRNA","ncRNA") #STAR.index(arguments, "output.dir") ## Or use ORFik way: output.dir <- "/Bio_data/references/Human" # arguments <- getGenomeAndAnnotation("Homo sapiens", output.dir) # STAR.index(arguments, output.dir)## Manual way, specify all paths yourself. #arguments <- c(path.GTF, path.genome, path.phix, path.rrna, path.trna, path.ncrna) #names(arguments) <- c("gtf", "genome", "phix", "rRNA", "tRNA","ncRNA") #STAR.index(arguments, "output.dir") ## Or use ORFik way: output.dir <- "/Bio_data/references/Human" # arguments <- getGenomeAndAnnotation("Homo sapiens", output.dir) # STAR.index(arguments, output.dir)
Will not run "make", only use precompiled STAR file.
Can only run on unix systems (Linux and Mac), and requires
minimum 30GB memory on genomes like human, rat, zebrafish etc.
STAR.install(folder = "~/bin", version = "2.7.4a")STAR.install(folder = "~/bin", version = "2.7.4a")
folder |
path to folder for download, fille will be named "STAR-version", where version is version wanted. |
version |
default "2.7.4a" |
ORFik for now only uses precompiled STAR binaries, so if you already have a STAR version it is adviced to redownload the same version, since STAR genome indices usually does not work between STAR versions.
path to runnable STAR
https://www.ncbi.nlm.nih.gov/pubmed/23104886
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.multiQC(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation(),
install.fastp()
## Default folder install: #STAR.install() ## Manual set folder: folder <- "/I/WANT/IT/HERE" #STAR.install(folder, version = "2.7.4a")## Default folder install: #STAR.install() ## Manual set folder: folder <- "/I/WANT/IT/HERE" #STAR.install(folder, version = "2.7.4a")
Takes a folder with multiple Log.final.out files from STAR, and create a multiQC report
STAR.multiQC( folder, type = "aligned", plot.ext = ".pdf", log_files = dir(folder, "Log.final.out", full.names = TRUE), simplified_table = TRUE )STAR.multiQC( folder, type = "aligned", plot.ext = ".pdf", log_files = dir(folder, "Log.final.out", full.names = TRUE), simplified_table = TRUE )
folder |
path to LOGS folder of ORFik STAR runs. Can also be the path to the aligned/ (parent directory of LOGS), then it will move into LOG from there. Only if no files with pattern Log.final.out are found in parent directory. If no LOGS folder is found it can check for a folder /aligned/LOGS/ so to go 2 folders down. |
type |
a character path, default "aligned". Which subfolder to check for. If you want log files for contamination do type = "contaminants_depletion" |
plot.ext |
character, default ".pdf". Which format to save QC plot. Alternative: ".png". |
log_files |
character, path to "Log.final.out" STAR files, default: dir(folder, "Log.final.out", full.names = TRUE) |
simplified_table |
logical, default TRUE. Subset columns, to the most important ones. |
a data.table with all information from STAR runs, plot and data saved to disc. Named: "/00_STAR_LOG_plot.pdf" and "/00_STAR_LOG_table.csv"
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.install(),
STAR.remove.crashed.genome(),
getGenomeAndAnnotation(),
install.fastp()
#' @examples process_dir <- system.file("extdata/test_processing/", package = "ORFik") STAR.multiQC(process_dir)#' @examples process_dir <- system.file("extdata/test_processing/", package = "ORFik") STAR.multiQC(process_dir)
This happens if you abort STAR run early, and it halts at: ..... loading genome
STAR.remove.crashed.genome(index.path, star.path = STAR.install())STAR.remove.crashed.genome(index.path, star.path = STAR.install())
index.path |
path to index folder of genome |
star.path |
path to STAR, default: STAR.install(), if you don't have STAR installed at default location, it will install it there, set path to a runnable star if you already have it. |
return value from system call, 0 if all good.
Other STAR:
STAR.align.folder(),
STAR.align.single(),
STAR.allsteps.multiQC(),
STAR.index(),
STAR.install(),
STAR.multiQC(),
getGenomeAndAnnotation(),
install.fastp()
index.path = "/home/data/human_GRCh38/STAR_INDEX/genomeDir/" # STAR.remove.crashed.genome(index.path = index.path) ## If you have the index argument from STAR.index function: # index.path <- STAR.index() # STAR.remove.crashed.genome(file.path(index.path, "genomeDir")) # STAR.remove.crashed.genome(file.path(index.path, "contaminants_genomeDir"))index.path = "/home/data/human_GRCh38/STAR_INDEX/genomeDir/" # STAR.remove.crashed.genome(index.path = index.path) ## If you have the index argument from STAR.index function: # index.path <- STAR.index() # STAR.remove.crashed.genome(file.path(index.path, "genomeDir")) # STAR.remove.crashed.genome(file.path(index.path, "contaminants_genomeDir"))
Faster version than S4Vector generic caller
## S4 method for signature 'GRanges' start(x)## S4 method for signature 'GRanges' start(x)
x |
a GRanges |
an integer (length equal to x)
In ATGTTTTGA, get the positions ATG. It takes care of exons boundaries, with exons < 3 length.
startCodons(grl, is.sorted = FALSE)startCodons(grl, is.sorted = FALSE)
grl |
a |
is.sorted |
a boolean, a speedup if you know the ranges are sorted |
a GRangesList of start codons, since they might be split on exons
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startSites(),
stopCodons(),
stopSites(),
txNames(),
uniqueGroups(),
uniqueOrder()
gr_plus <- GRanges(seqnames = "chr1", ranges = IRanges(c(7, 14), width = 3), strand = "+") gr_minus <- GRanges(seqnames = "chr2", ranges = IRanges(c(4, 1), c(9, 3)), strand = "-") grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) startCodons(grl, is.sorted = FALSE)gr_plus <- GRanges(seqnames = "chr1", ranges = IRanges(c(7, 14), width = 3), strand = "+") gr_minus <- GRanges(seqnames = "chr2", ranges = IRanges(c(4, 1), c(9, 3)), strand = "-") grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) startCodons(grl, is.sorted = FALSE)
According to: <http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/ index.cgi?chapter=tgencodes#SG1> ncbi genetic code number for translation. This version is a cleaned up version, unknown indices removed.
startDefinition(transl_table)startDefinition(transl_table)
transl_table |
numeric. NCBI genetic code number for translation. |
A string of START sites separatd with "|".
Other findORFs:
findMapORFs(),
findORFs(),
findORFsFasta(),
findUORFs(),
stopDefinition()
startDefinition startDefinition(1)startDefinition startDefinition(1)
Get the start region of each ORF. If you want the start codon only,
set upstream = 0 or just use startCodons.
Standard is 2 upstream and 2 downstream, a width 5 window centered at
start site. since p-shifting is not 100
usually the reads from the start site.
startRegion(grl, tx = NULL, is.sorted = TRUE, upstream = 2L, downstream = 2L)startRegion(grl, tx = NULL, is.sorted = TRUE, upstream = 2L, downstream = 2L)
grl |
a |
tx |
default NULL, a GRangesList of transcripts or (container region), names of tx must contain all grl names. The names of grl can also be the ORFik orf names. that is "txName_id" |
is.sorted |
logical (TRUE), is grl sorted. |
upstream |
an integer (2), relative region to get upstream from. |
downstream |
an integer (2), relative region to get downstream from |
If tx is null, then upstream will be forced to 0 and downstream to a maximum of grl width (3' UTR end for mRNAs). Since there is no reference for splicing.
a GRanges, or GRangesList object if any group had > 1 exon.
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegionCoverage(),
stopRegion(),
subsetCoverage(),
translationalEff()
## ORF start region orf <- GRangesList(tx1 = GRanges("1", 200:300, "+")) tx <- GRangesList(tx1 = GRanges("1", IRanges(c(100, 200), c(195, 400)), "+")) startRegion(orf, tx, upstream = 6, downstream = 6) ## 2nd codon of ORF startRegion(orf, tx, upstream = -3, downstream = 6)## ORF start region orf <- GRangesList(tx1 = GRanges("1", 200:300, "+")) tx <- GRangesList(tx1 = GRanges("1", IRanges(c(100, 200), c(195, 400)), "+")) startRegion(orf, tx, upstream = 6, downstream = 6) ## 2nd codon of ORF startRegion(orf, tx, upstream = -3, downstream = 6)
Get the number of reads in the start region of each ORF. If you want the start codon coverage only, set upstream = 0. Standard is 2 upstream and 2 downstream, a width 5 window centered at start site. since p-shifting is not 100 start site.
startRegionCoverage( grl, RFP, tx = NULL, is.sorted = TRUE, upstream = 2L, downstream = 2L, weight = 1L )startRegionCoverage( grl, RFP, tx = NULL, is.sorted = TRUE, upstream = 2L, downstream = 2L, weight = 1L )
grl |
a |
RFP |
ribo seq reads as GAlignments, GRanges or GRangesList object |
tx |
default NULL, a GRangesList of transcripts or (container region), names of tx must contain all grl names. The names of grl can also be the ORFik orf names. that is "txName_id" |
is.sorted |
logical (TRUE), is grl sorted. |
upstream |
an integer (2), relative region to get upstream from. |
downstream |
an integer (2), relative region to get downstream from |
weight |
a numeric/integer vector or metacolumn name. (default: 1L, no differential weighting). If weight is name of defined meta column in reads object, it gives the number of times a read was found at that position. GRanges("chr1", 1, "+", score = 5), would mean "score" column tells that this alignment region was found 5 times. if 1L it means each read is weighted equal as 1, this is what among others countOverlaps() presumes, if single number (!= 1), it repeats for all ranges, if vector with length > 1, it must be equal size of the reads object. |
If tx is null, then upstream will be force to 0 and downstream to a maximum of grl width. Since there is no reference for splicing.
a numeric vector of counts
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
stopRegion(),
subsetCoverage(),
translationalEff()
ORF <- GRanges(seqnames = "1", ranges = IRanges(21, 40), strand = "+") names(ORF) <- c("tx1") grl <- GRangesList(tx1 = ORF) tx <- extendLeaders(grl, 20) # 1 width p-shifted reads reads <- GRanges("1", IRanges(c(21, 23, 50, 50, 50, 53, 53, 56, 59), width = 1), "+") score(reads) <- 28 # original width startRegionCoverage(grl, reads, tx)ORF <- GRanges(seqnames = "1", ranges = IRanges(21, 40), strand = "+") names(ORF) <- c("tx1") grl <- GRangesList(tx1 = ORF) tx <- extendLeaders(grl, 20) # 1 width p-shifted reads reads <- GRanges("1", IRanges(c(21, 23, 50, 50, 50, 53, 53, 56, 59), width = 1), "+") score(reads) <- 28 # original width startRegionCoverage(grl, reads, tx)
One window per start site, if upstream and downstream are both 0, then only the startsite is returned.
startRegionString(grl, tx, faFile, upstream = 20, downstream = 20)startRegionString(grl, tx, faFile, upstream = 20, downstream = 20)
grl |
a |
tx |
a |
faFile |
|
upstream |
an integer, default (0), relative region to get upstream end from. (0 means start site, +1 is one upstream, -1 is one downstream) |
downstream |
an integer, default (0), relative region to get downstream end from (0 means start site, +1 is one downstream, -1 is one upstream) |
a character vector of start regions
In ATGTTTTGG, get the position of the A.
startSites(grl, asGR = FALSE, keep.names = FALSE, is.sorted = FALSE)startSites(grl, asGR = FALSE, keep.names = FALSE, is.sorted = FALSE)
grl |
a |
asGR |
a boolean, return as GRanges object |
keep.names |
a logical (FALSE), keep names of input. |
is.sorted |
a speedup, if you know the ranges are sorted |
if asGR is False, a vector, if True a GRanges object
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
stopCodons(),
stopSites(),
txNames(),
uniqueGroups(),
uniqueOrder()
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) startSites(grl, is.sorted = FALSE)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) startSites(grl, is.sorted = FALSE)
In ATGTTTTGA, get the positions TGA. It takes care of exons boundaries, with exons < 3 length.
stopCodons(grl, is.sorted = FALSE)stopCodons(grl, is.sorted = FALSE)
grl |
a |
is.sorted |
a boolean, a speedup if you know the ranges are sorted |
a GRangesList of stop codons, since they might be split on exons
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopSites(),
txNames(),
uniqueGroups(),
uniqueOrder()
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) stopCodons(grl, is.sorted = FALSE)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) stopCodons(grl, is.sorted = FALSE)
According to: <http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/ index.cgi?chapter=tgencodes#SG1> ncbi genetic code number for translation. This version is a cleaned up version, unknown indices removed.
stopDefinition(transl_table)stopDefinition(transl_table)
transl_table |
numeric. NCBI genetic code number for translation. |
A string of STOP sites separatd with "|".
Other findORFs:
findMapORFs(),
findORFs(),
findORFsFasta(),
findUORFs(),
startDefinition()
stopDefinition stopDefinition(1)stopDefinition stopDefinition(1)
Get the stop region of each ORF / region. If you want the stop codon only,
set downstream = 0 or just use stopCodons.
Standard is 2 upstream and 2 downstream, a width 5 window centered at
stop site.
stopRegion(grl, tx = NULL, is.sorted = TRUE, upstream = 2L, downstream = 2L)stopRegion(grl, tx = NULL, is.sorted = TRUE, upstream = 2L, downstream = 2L)
grl |
a |
tx |
default NULL, a GRangesList of transcripts or (container region), names of tx must contain all grl names. The names of grl can also be the ORFik orf names. that is "txName_id" |
is.sorted |
logical (TRUE), is grl sorted. |
upstream |
an integer (2), relative region to get upstream from. |
downstream |
an integer (2), relative region to get downstream from |
If tx is null, then downstream will be forced to 0 and upstream to a minimum of -grl width (to the TSS). . Since there is no reference for splicing.
a GRanges, or GRangesList object if any group had > 1 exon.
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
subsetCoverage(),
translationalEff()
## ORF stop region orf <- GRangesList(tx1 = GRanges("1", 200:300, "+")) tx <- GRangesList(tx1 = GRanges("1", IRanges(c(100, 305), c(300, 400)), "+")) stopRegion(orf, tx, upstream = 6, downstream = 6) ## 2nd last codon of ORF stopRegion(orf, tx, upstream = 6, downstream = -3)## ORF stop region orf <- GRangesList(tx1 = GRanges("1", 200:300, "+")) tx <- GRangesList(tx1 = GRanges("1", IRanges(c(100, 305), c(300, 400)), "+")) stopRegion(orf, tx, upstream = 6, downstream = 6) ## 2nd last codon of ORF stopRegion(orf, tx, upstream = 6, downstream = -3)
In ATGTTTTGC, get the position of the C.
stopSites(grl, asGR = FALSE, keep.names = FALSE, is.sorted = FALSE)stopSites(grl, asGR = FALSE, keep.names = FALSE, is.sorted = FALSE)
grl |
a |
asGR |
a boolean, return as GRanges object |
keep.names |
a logical (FALSE), keep names of input. |
is.sorted |
a speedup, if you know the ranges are sorted |
if asGR is False, a vector, if True a GRanges object
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopCodons(),
txNames(),
uniqueGroups(),
uniqueOrder()
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) stopSites(grl, is.sorted = FALSE)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) stopSites(grl, is.sorted = FALSE)
Helper function to get a logical list of True/False, if GRangesList group have + strand = T, if - strand = F Also checks for * strands, so a good check for bugs
strandBool(grl)strandBool(grl)
grl |
a |
a logical vector
gr <- GRanges(Rle(c("chr2", "chr2", "chr1", "chr3"), c(1, 3, 2, 4)), IRanges(1:10, width = 10:1), Rle(strand(c("-", "+", "*", "+", "-")), c(1, 2, 2, 3, 2))) strandBool(gr)gr <- GRanges(Rle(c("chr2", "chr2", "chr1", "chr3"), c(1, 3, 2, 4)), IRanges(1:10, width = 10:1), Rle(strand(c("-", "+", "*", "+", "-")), c(1, 2, 2, 3, 2))) strandBool(gr)
strandMode covRle
## S4 method for signature 'covRle' strandMode(x)## S4 method for signature 'covRle' strandMode(x)
x |
a covRle object |
integer vector with names
strandMode covRle
## S4 method for signature 'covRleList' strandMode(x)## S4 method for signature 'covRleList' strandMode(x)
x |
a covRle object |
integer vector with names
Get first strand per GRangesList group
strandPerGroup(grl, keep.names = TRUE)strandPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
a vector named/unnamed of characters
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) strandPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) strandPerGroup(grl)
Usually used for ORFs to get specific frame (0-2): frame 0, frame 1, frame 2
subsetToFrame(x, frame)subsetToFrame(x, frame)
x |
A tiled to size of 1 GRanges object |
frame |
A numeric indicating which frame to extract |
GRanges object should be beforehand tiled to size of 1. This subsetting takes account for strand.
GRanges object reduced to only first frame
subsetToFrame(GRanges("1", IRanges(1:10, width = 1), "+"), 2)subsetToFrame(GRanges("1", IRanges(1:10, width = 1), "+"), 2)
Sum coverage per chromosome
## S4 method for signature 'covRle' sum(x)## S4 method for signature 'covRle' sum(x)
x |
a covRle object |
an integer, sum of coverage per chromosomes in covRle object
Loads premade fst table at path: file.path(refFolder(x), "gene_symbol_tx_table.fst")
symbols(x)symbols(x)
x |
an ORFik |
a data.table with gene id, gene symbols and tx ids (3 columns)
df <- ORFik.template.experiment() symbols(df)df <- ORFik.template.experiment() symbols(df)
Get path to ORFik experiment QC folder
## S4 method for signature 'experiment' symbols(x)## S4 method for signature 'experiment' symbols(x)
x |
an ORFik |
a character path
Create TE plot of:
- Within sample (TE log2 vs mRNA fpkm)
te_rna.plot( dt, output.dir = NULL, filter.rfp = 1, filter.rna = 1, plot.title = "", plot.ext = ".pdf", width = 6, height = "auto", dpi = 300, dot.size = 0.4, xlim = c(filter.rna, filter.rna + 2.5) )te_rna.plot( dt, output.dir = NULL, filter.rfp = 1, filter.rna = 1, plot.title = "", plot.ext = ".pdf", width = 6, height = "auto", dpi = 300, dot.size = 0.4, xlim = c(filter.rna, filter.rna + 2.5) )
dt |
a data.table with the results from |
output.dir |
a character path, default NULL(no save), or a directory to save to a file will be called "TE_within.pdf" |
filter.rfp |
numeric, default 1. What is the minimum fpkm value? |
filter.rna |
numeric, default 1. What is the minimum fpkm value? |
plot.title |
title for plots, usually name of experiment etc |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". Multiple values allowed, if so will save file in each format specified. |
width |
numeric, default 6 (in inches) |
height |
a numeric, width of plot in inches. Default "auto". |
dpi |
numeric, default 300. |
dot.size |
numeric, default 0.4, size of point dots in plot. |
xlim |
numeric vector of length 2. X-axis limits. Default:
|
a ggplot object
Other DifferentialExpression:
DEG.plot.static(),
DEG_model(),
DTEG.analysis(),
DTEG.plot(),
te.table()
df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] #dt <- te.table(df.rfp, df.rna) #te_rna.plot(dt, filter.rfp = 0, filter.rna = 5, dot.size = 1)df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] #dt <- te.table(df.rfp, df.rna) #te_rna.plot(dt, filter.rfp = 0, filter.rna = 5, dot.size = 1)
Create 2 TE plots of:
- Within sample (TE log2 vs mRNA fpkm) ("default")
- Between all combinations of samples
(x-axis: rna1fpkm - rna2fpkm, y-axis rfp1fpkm - rfp2fpkm)
te.plot( df.rfp, df.rna, output.dir = QCfolder(df.rfp), type = c("default", "between"), filter.rfp = 1, filter.rna = 1, collapse = FALSE, plot.title = "", plot.ext = ".pdf", width = 6, height = "auto" )te.plot( df.rfp, df.rna, output.dir = QCfolder(df.rfp), type = c("default", "between"), filter.rfp = 1, filter.rna = 1, collapse = FALSE, plot.title = "", plot.ext = ".pdf", width = 6, height = "auto" )
df.rfp |
a |
df.rna |
a |
output.dir |
directory to save plots, plots will be named "TE_between.pdf" and "TE_within.pdf" |
type |
which plots to make, default: c("default", "between"). Both plots. |
filter.rfp |
numeric, default 1. minimum fpkm value to be included in plots |
filter.rna |
numeric, default 1. minimum fpkm value to be included in plots |
collapse |
a logical/character (default FALSE), if TRUE all samples within the group SAMPLE will be collapsed to one. If "all", all groups will be merged into 1 column called merged_all. Collapse is defined as rowSum(elements_per_group) / ncol(elements_per_group) |
plot.title |
title for plots, usually name of experiment etc |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
width |
numeric, default 6 (in inches) |
height |
numeric or character, default "auto", which is: 3 + (ncol(RFP_CDS_FPKM)-2). Else a numeric value of height (in inches) |
Ribo-seq and RNA-seq must have equal nrows, with matching samples. Only exception is if RNA-seq is 1 single sample. Then it will use that for each of the Ribo-seq samples. Same stages, conditions etc, with a unique pairing 1 to 1. If not you can run collapse = "all". It will then merge all and do combined of all RNA-seq vs all Ribo-seq
a data.table with TE values, fpkm and log fpkm values, library samples melted into rows with split variable called "variable".
## # df.rfp <- read.experiment("zf_baz14_RFP") # df.rna <- read.experiment("zf_baz14_RNA") # te.plot(df.rfp, df.rna) ## Collapse replicates: # te.plot(df.rfp, df.rna, collapse = TRUE)## # df.rfp <- read.experiment("zf_baz14_RFP") # df.rna <- read.experiment("zf_baz14_RNA") # te.plot(df.rfp, df.rna) ## Collapse replicates: # te.plot(df.rfp, df.rna, collapse = TRUE)
Creates a data.table with 6 columns, column names are:
variable, rfp_log2, rna_log2, rna_log10, TE_log2, id
te.table(df.rfp, df.rna, filter.rfp = 1, filter.rna = 1, collapse = FALSE)te.table(df.rfp, df.rna, filter.rfp = 1, filter.rna = 1, collapse = FALSE)
df.rfp |
a |
df.rna |
a |
filter.rfp |
numeric, default 1. What is the minimum fpkm value? |
filter.rna |
numeric, default 1. What is the minimum fpkm value? |
collapse |
a logical/character (default FALSE), if TRUE all samples within the group SAMPLE will be collapsed to one. If "all", all groups will be merged into 1 column called merged_all. Collapse is defined as rowSum(elements_per_group) / ncol(elements_per_group) |
a data.table with 6 columns
Other DifferentialExpression:
DEG.plot.static(),
DEG_model(),
DTEG.analysis(),
DTEG.plot(),
te_rna.plot()
df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] #te.table(df.rfp, df.rna)df <- ORFik.template.experiment() df.rfp <- df[df$libtype == "RFP",] df.rna <- df[df$libtype == "RNA",] #te.table(df.rfp, df.rna)
Must have ofst files already created!
template_shift_table(df, accepted.lengths = 26:34)template_shift_table(df, accepted.lengths = 26:34)
df |
an ORFik |
accepted.lengths |
accepted read lengths, default 26:34, usually ribo-seq is strongest between 27:32. |
a list with names of elements as file path to the ofst, the data.table elements 2 columns fraction: read length and offset_start, the shifts in negative coordinates.
df <- ORFik:::ORFik.template.experiment() template_shift_table(df)df <- ORFik:::ORFik.template.experiment() template_shift_table(df)
Will tile a GRangesList into single bp resolution, each group of the list will be splited by positions of 1. Returned values are sorted as the same groups as the original GRangesList, except they are in bp resolutions. This is not supported originally by GenomicRanges for GRangesList.
tile1( grl, sort.on.return = TRUE, matchNaming = TRUE, is.sorted = TRUE, mergeEqualNamed = TRUE )tile1( grl, sort.on.return = TRUE, matchNaming = TRUE, is.sorted = TRUE, mergeEqualNamed = TRUE )
grl |
a |
sort.on.return |
logical (TRUE), should the groups be sorted before return (Negative ranges should be in decreasing order). Makes it a bit slower, but much safer for downstream analysis. |
matchNaming |
logical (TRUE), should groups keep unlisted names and meta data.(This make the list very big, for > 100K groups) |
is.sorted |
logical (TRUE), grl is presorted (negative coordinates are decreasing). Set to FALSE if they are not, else output will most likely be wrong! |
mergeEqualNamed |
logical, default TRUE. Merge groups with equal name |
a GRangesList grouped by original group, tiled to 1. Groups with identical names will be merged unless mergeEqualNamed is FALSE!
Other ExtendGenomicRanges:
asTX(),
coveragePerTiling(),
extendLeaders(),
extendTrailers(),
reduceKeepAttr(),
txSeqsFromFa(),
windowPerGroup()
gr1 <- GRanges("1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") gr2 <- GRanges("1", ranges = IRanges(start = c(20, 30, 40), end = c(25, 35, 45)), strand = "+") names(gr1) = rep("tx1_1", 3) names(gr2) = rep("tx1_2", 3) grl <- GRangesList(tx1_1 = gr1, tx1_2 = gr2) tile1(grl)gr1 <- GRanges("1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") gr2 <- GRanges("1", ranges = IRanges(start = c(20, 30, 40), end = c(25, 35, 45)), strand = "+") names(gr1) = rep("tx1_1", 3) names(gr2) = rep("tx1_2", 3) grl <- GRangesList(tx1_1 = gr1, tx1_2 = gr2) tile1(grl)
Given sequences, DNA or RNA. And some score, scanning efficiency (SE), ribo-seq fpkm, TE etc.
TOP.Motif.ecdf( seqs, rate, start = 1, stop = max(nchar(seqs)), xlim = c("q10", "q99"), type = "Scanning efficiency", legend.position.1st = c(0.75, 0.28), legend.position.motif = c(0.75, 0.28) )TOP.Motif.ecdf( seqs, rate, start = 1, stop = max(nchar(seqs)), xlim = c("q10", "q99"), type = "Scanning efficiency", legend.position.1st = c(0.75, 0.28), legend.position.motif = c(0.75, 0.28) )
seqs |
the sequences (character vector, DNAStringSet), of 5' UTRs (leaders). See example below for input. |
rate |
a scoring vector (equal size to seqs) |
start |
position in seqs to start at (first is 1), default 1. |
stop |
position in seqs to stop at (first is 1), default max(nchar(seqs)), that is the longest sequence length |
xlim |
What interval of rate values you want to show type: numeric or quantile of length 2, 1. default c("q10","q99"). bigger than 10 percentile and less than 99 percentile. 2. Set to numeric values, like c(5, 1000), 3. Set to NULL if you want all values. Backend uses coord_cartesian. |
type |
What type is the rate scoring ? default ("Scanning efficiency") |
legend.position.1st |
adjust left plot label position, default c(0.75, 0.28), ("none", "left", "right", "bottom", "top", or two-element numeric vector) |
legend.position.motif |
adjust right plot label position, default c(0.75, 0.28), ("none", "left", "right", "bottom", "top", or two-element numeric vector) |
Top motif defined as a TSS of C and 4 T's or C's (pyrimidins) downstream of TSS C.
The right plot groups: C nucleotide, TOP motif (C, then 4 pyrimidines) and OTHER (all other TSS variants).
a ggplot gtable of the TOP motifs in 2 plots
## Not run: if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") #Extract sequences of Coding sequences. leaders <- loadRegion(txdbFile, "leaders") # Should update by CAGE if not already done cageData <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") leadersCage <- reassignTSSbyCage(leaders, cageData) # Get region to check seqs <- startRegionString(leadersCage, NULL, BSgenome.Hsapiens.UCSC.hg19::Hsapiens, 0, 4) # Some toy ribo-seq fpkm scores on cds set.seed(3) fpkm <- sample(1:115, length(leadersCage), replace = TRUE) # Standard arguments TOP.Motif.ecdf(seqs, fpkm, type = "ribo-seq FPKM", legend.position.1st = "bottom", legend.position.motif = "bottom") # with no zoom on x-axis: TOP.Motif.ecdf(seqs, fpkm, xlim = NULL, legend.position.1st = "bottom", legend.position.motif = "bottom") } ## End(Not run)## Not run: if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") #Extract sequences of Coding sequences. leaders <- loadRegion(txdbFile, "leaders") # Should update by CAGE if not already done cageData <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") leadersCage <- reassignTSSbyCage(leaders, cageData) # Get region to check seqs <- startRegionString(leadersCage, NULL, BSgenome.Hsapiens.UCSC.hg19::Hsapiens, 0, 4) # Some toy ribo-seq fpkm scores on cds set.seed(3) fpkm <- sample(1:115, length(leadersCage), replace = TRUE) # Standard arguments TOP.Motif.ecdf(seqs, fpkm, type = "ribo-seq FPKM", legend.position.1st = "bottom", legend.position.motif = "bottom") # with no zoom on x-axis: TOP.Motif.ecdf(seqs, fpkm, xlim = NULL, legend.position.1st = "bottom", legend.position.motif = "bottom") } ## End(Not run)
Per leader, detect if the leader has a TOP motif at TSS (5' end of leader) TOP motif defined as: (C, then 4 pyrimidines)
topMotif(seqs, start = 1, stop = max(nchar(seqs)), return.sequence = TRUE)topMotif(seqs, start = 1, stop = max(nchar(seqs)), return.sequence = TRUE)
seqs |
the sequences (character vector, DNAStringSet),
of 5' UTRs (leaders) start region.
seqs must be of minimum widths start - stop + 1 to be included.
|
start |
position in seqs to start at (first is 1), default 1. |
stop |
position in seqs to stop at (first is 1), default max(nchar(seqs)), that is the longest sequence length |
return.sequence |
logical, default TRUE, return as data.table with sequence as columns in addition to TOP class. If FALSE, return character vector. |
default: return.sequence == FALSE, a character vector of either TOP, C or OTHER. C means leaders started on C, Other means not TOP and did not start on C. If return.sequence == TRUE, a data.table is returned with the base per position in the motif is included as additional columns (per position called seq1, seq2 etc) and a id column called X.gene_id (with names of seqs).
## Not run: if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") #Extract sequences of Coding sequences. leaders <- loadRegion(txdbFile, "leaders") # Should update by CAGE if not already done cageData <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") leadersCage <- reassignTSSbyCage(leaders, cageData) # Get region to check seqs <- startRegionString(leadersCage, NULL, BSgenome.Hsapiens.UCSC.hg19::Hsapiens, 0, 4) topMotif(seqs) } ## End(Not run)## Not run: if (requireNamespace("BSgenome.Hsapiens.UCSC.hg19")) { txdbFile <- system.file("extdata", "hg19_knownGene_sample.sqlite", package = "GenomicFeatures") #Extract sequences of Coding sequences. leaders <- loadRegion(txdbFile, "leaders") # Should update by CAGE if not already done cageData <- system.file("extdata", "cage-seq-heart.bed.bgz", package = "ORFik") leadersCage <- reassignTSSbyCage(leaders, cageData) # Get region to check seqs <- startRegionString(leadersCage, NULL, BSgenome.Hsapiens.UCSC.hg19::Hsapiens, 0, 4) topMotif(seqs) } ## End(Not run)
Gives you binned meta coverage plots, either saved seperatly or all in one.
transcriptWindow( leaders, cds, trailers, df, outdir = NULL, scores = c("sum", "transcriptNormalized"), allTogether = TRUE, colors = experiment.colors(df), title = "Coverage metaplot", windowSize = min(min(c(wanted_window_size, widthPerGroup(leaders, FALSE))), min(c(wanted_window_size, widthPerGroup(cds, FALSE))), min(c(wanted_window_size, widthPerGroup(trailers, FALSE)))), wanted_window_size = 100, returnPlot = is.null(outdir), dfr = NULL, idName = "", plot.ext = ".pdf", type = "ofst", is.sorted = FALSE, drop.zero.dt = TRUE, verbose = TRUE, force = TRUE, library.names = bamVarName(df), BPPARAM = bpparam() )transcriptWindow( leaders, cds, trailers, df, outdir = NULL, scores = c("sum", "transcriptNormalized"), allTogether = TRUE, colors = experiment.colors(df), title = "Coverage metaplot", windowSize = min(min(c(wanted_window_size, widthPerGroup(leaders, FALSE))), min(c(wanted_window_size, widthPerGroup(cds, FALSE))), min(c(wanted_window_size, widthPerGroup(trailers, FALSE)))), wanted_window_size = 100, returnPlot = is.null(outdir), dfr = NULL, idName = "", plot.ext = ".pdf", type = "ofst", is.sorted = FALSE, drop.zero.dt = TRUE, verbose = TRUE, force = TRUE, library.names = bamVarName(df), BPPARAM = bpparam() )
leaders |
a |
cds |
a |
trailers |
a |
df |
an ORFik |
outdir |
directory to save to (default: NULL, no saving) |
scores |
scoring function (default: c("sum", "transcriptNormalized")), see ?coverageScorings for possible scores. |
allTogether |
plot all coverage plots in 1 output? (defualt: TRUE) |
colors |
Which colors to use, default auto color from function
|
title |
title of ggplot |
windowSize |
size of binned windows, minimum of 'wanted_window_size' and minimum of ranges given. Will inform you if windowSize is < wanted_window_size. |
wanted_window_size |
numeric, default 100. The wanted window size to bin on. |
returnPlot |
return plot from function, default is.null(outdir), so TRUE if outdir is not defined. |
dfr |
an ORFik |
idName |
A character ID to add to saved name of plot, if you make several plots in the same folder, and same experiment, like splitting transcripts in two groups like targets / nontargets etc. (default: "") |
plot.ext |
character, default: ".pdf". Alternatives: ".png" or ".jpg". |
type |
a character(default: "default"), load files in experiment
or some precomputed variant, like "ofst" or "pshifted".
These are made with ORFik:::convertLibs(),
shiftFootprintsByExperiment(), etc.
Can also be custom user made folders inside the experiments bam folder.
It acts in a recursive manner with priority: If you state "pshifted",
but it does not exist, it checks "ofst". If no .ofst files, it uses
"default", which always must exists. |
is.sorted |
logical (FALSE), is grl sorted. That is + strand groups in increasing ranges (1,2,3), and - strand groups in decreasing ranges (3,2,1) |
drop.zero.dt |
logical FALSE, if TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 positions are used in some sense. (mean, median, zscore coverage will only scale differently) |
verbose |
logical, default TRUE, message about library output status. |
force |
logical, default TRUE If TRUE, reload library files even if
matching named variables are found in environment used by experiment
(see |
library.names |
character vector, names of libraries, default: name_decider(df, naming) |
BPPARAM |
how many cores/threads to use? default: bpparam() |
NULL, or ggplot object if returnPlot is TRUE
Other experiment plots:
transcriptWindow1(),
transcriptWindowPer()
df <- ORFik.template.experiment()[3,] # Only third library loadRegions(df) # Load leader, cds and trailers as GRangesList #transcriptWindow(leaders, cds, trailers, df, outdir = "directory/to/save")df <- ORFik.template.experiment()[3,] # Only third library loadRegions(df) # Load leader, cds and trailers as GRangesList #transcriptWindow(leaders, cds, trailers, df, outdir = "directory/to/save")
Uses RnaSeq and RiboSeq to get translational efficiency of every element in 'grl'. Translational efficiency is defined as:
(density of RPF within ORF) / (RNA expression of ORFs transcript)
translationalEff( grl, RNA, RFP, tx, with.fpkm = FALSE, pseudoCount = 0, librarySize = "full", weight.RFP = 1L, weight.RNA = 1L )translationalEff( grl, RNA, RFP, tx, with.fpkm = FALSE, pseudoCount = 0, librarySize = "full", weight.RFP = 1L, weight.RNA = 1L )
grl |
a |
RNA |
RnaSeq reads as |
RFP |
RiboSeq reads as |
tx |
a GRangesList of the transcripts. If you used cage data, then the tss for the the leaders have changed, therefor the tx lengths have changed. To account for that call: ' translationalEff(grl, RNA, RFP, tx = extendLeaders(tx, cageFiveUTRs)) ' where cageFiveUTRs are the reannotated by CageSeq data leaders. |
with.fpkm |
logical, default: FALSE, if true return the fpkm values together with translational efficiency as a data.table |
pseudoCount |
a numeric, default 0, set it to 1 if you want to avoid NA and inf values. |
librarySize |
either numeric value or character vector. Default ("full"), number of alignments in library (reads). If you just have a subset, you can give the value by librarySize = length(wholeLib) or sum(wholeLib$score), if you want lib size to be only number of reads overlapping grl, do: librarySize = "overlapping" sum(countOverlaps(reads, grl) > 0), if reads[1] has 3 hits in grl, and reads[2] has 2 hits, librarySize will be 2, not 5. You can also get the inverse overlap, if you want lib size to be total number of overlaps, do: librarySize = "DESeq" This is standard fpkm way of DESeq2::fpkm(robust = FALSE) sum(countOverlaps(grl, reads)) if grl[1] has 3 reads and grl[2] has 2 reads, librarySize is 5, not 2. |
weight.RFP |
a vector (default: 1L). Can also be character name of column in RFP. As in translationalEff(weight = "score") for: GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. |
weight.RNA |
Same as weightRFP but for RNA weights. (default: 1L) |
a numeric vector of fpkm ratios, if with.fpkm is TRUE, return a data.table with te and fpkm values (total 3 columns then)
doi: 10.1126/science.1168978
Other features:
computeFeatures(),
computeFeaturesCage(),
countOverlapsW(),
disengagementScore(),
distToCds(),
distToTSS(),
entropy(),
floss(),
fpkm(),
fpkm_calc(),
fractionLength(),
initiationScore(),
insideOutsideORF(),
isInFrame(),
isOverlapping(),
kozakSequenceScore(),
orfScore(),
rankOrder(),
ribosomeReleaseScore(),
ribosomeStallingScore(),
startRegion(),
startRegionCoverage(),
stopRegion(),
subsetCoverage()
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+") RNA <- GRanges("1", IRanges(1, 50), "+") tx <- GRangesList(tx1 = GRanges("1", IRanges(1, 50), "+")) # grl must have same names as cds + _1 etc, so that they can be matched. te <- translationalEff(grl, RNA, RFP, tx, with.fpkm = TRUE, pseudoCount = 1) te$fpkmRFP te$teORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") grl <- GRangesList(tx1_1 = ORF) RFP <- GRanges("1", IRanges(25, 25), "+") RNA <- GRanges("1", IRanges(1, 50), "+") tx <- GRangesList(tx1 = GRanges("1", IRanges(1, 50), "+")) # grl must have same names as cds + _1 etc, so that they can be matched. te <- translationalEff(grl, RNA, RFP, tx, with.fpkm = TRUE, pseudoCount = 1) te$fpkmRFP te$te
From fastp runs in ORFik alignment process
trimming.table( trim_folder, raw_libraries = dir(trim_folder, "\\.json$", full.names = TRUE), include_adapter = FALSE )trimming.table( trim_folder, raw_libraries = dir(trim_folder, "\\.json$", full.names = TRUE), include_adapter = FALSE )
trim_folder |
folder of trimmed files, only reads fastp .json files. Can be NULL if raw_libraries is defined |
raw_libraries |
character, default:
|
include_adapter |
logical, default FALSE. If TRUE, will add an extra column: adapter, with adapter found. If not found, it will specify: "passed". |
a data.table with 6 columns, raw_library (names of library), raw_reads (numeric, number of raw reads), trim_reads (numeric, number of trimmed reads), raw_mean_length (numeric, raw mean read length), trim_mean_length (numeric, trim mean read length). Optional columns: adapter (character, adapter, if not found "passed")
# Location of fastp trimmed .json files trimmed_file <- system.file("extdata/test_processing/trim", "output_template.json", package = "ORFik") trimmed_folder <- dirname(trimmed_file) trimming.table(trimmed_folder) trimming.table(NULL, trimmed_file) trimming.table(NULL, trimmed_file, include_adapter = TRUE)# Location of fastp trimmed .json files trimmed_file <- system.file("extdata/test_processing/trim", "output_template.json", package = "ORFik") trimmed_folder <- dirname(trimmed_file) trimming.table(trimmed_folder) trimming.table(NULL, trimmed_file) trimming.table(NULL, trimmed_file, include_adapter = TRUE)
Using the ORFik definition of orf name, which is:
example ENSEMBL:
tx name: ENST0909090909090
orf id: _1 (the first of on that tx)
orf_name: ENST0909090909090_1
So therefor txNames("ENST0909090909090_1") = ENST0909090909090
txNames(grl, ref = NULL, unique = FALSE)txNames(grl, ref = NULL, unique = FALSE)
grl |
a |
ref |
a reference |
unique |
a boolean, if true unique the names, used if several orfs map to same transcript and you only want the unique groups |
The names must be extracted from a column called names, or the names of the grl object. If it is already tx names, it returns the input
NOTE! Do not use _123 etc in end of transcript names if it is not ORFs. Else you will get errors. Just _ will work, but if transcripts are called ENST_123124124000 etc, it will crash, so substitute "_" with "." gsub("_", ".", names)
a character vector of transcript names, without _* naming
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopCodons(),
stopSites(),
uniqueGroups(),
uniqueOrder()
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1_1 = gr_plus, tx2_1 = gr_minus) # there are 2 orfs, both the first on each transcript txNames(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1_1 = gr_plus, tx2_1 = gr_minus) # there are 2 orfs, both the first on each transcript txNames(grl)
Works for ensembl, UCSC and other standard annotations.
txNamesToGeneNames(txNames, txdb)txNamesToGeneNames(txNames, txdb)
txNames |
character vector, the transcript names to convert. Can also be a named object with tx names (like a GRangesList), will then extract names. |
txdb |
the transcript database to use or gtf/gff path to it. |
character vector of gene names
df <- ORFik.template.experiment() txdb <- loadTxdb(df) loadRegions(txdb, "cds") # using tx names txNamesToGeneNames(cds, txdb) # Identical to: loadRegions(txdb, "cds", by = "gene")df <- ORFik.template.experiment() txdb <- loadTxdb(df) loadRegions(txdb, "cds") # using tx names txNamesToGeneNames(cds, txdb) # Identical to: loadRegions(txdb, "cds", by = "gene")
For each GRanges object, find the sequence of it from faFile or BSgenome.
txSeqsFromFa(grl, faFile, is.sorted = FALSE, keep.names = TRUE)txSeqsFromFa(grl, faFile, is.sorted = FALSE, keep.names = TRUE)
grl |
a |
faFile |
|
is.sorted |
a speedup, if you know the grl ranges are sorted |
keep.names |
a logical, default (TRUE), if FALSE: return as character vector without names. |
A wrapper around extractTranscriptSeqs that works for
DNAStringSet and ORFik experiment input.
For debug of errors do:
which(!(unique(seqnamesPerGroup(grl, FALSE))
This happens usually when the grl contains chromsomes that the fasta
file does not have. A normal error is that mitocondrial chromosome is
called MT vs chrM even though they have same seqlevelsStyle. The
above line will give you which chromosome it is missing.
a DNAStringSet of the transcript sequences
Other ExtendGenomicRanges:
asTX(),
coveragePerTiling(),
extendLeaders(),
extendTrailers(),
reduceKeepAttr(),
tile1(),
windowPerGroup()
Sometimes GRangesList groups might be identical,
for example ORFs from different isoforms can have identical ranges.
Use this function to reduce these groups to unique elements
in GRangesList grl, without names and metacolumns.
uniqueGroups(grl)uniqueGroups(grl)
grl |
a GRangesList of unique orfs
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopCodons(),
stopSites(),
txNames(),
uniqueOrder()
gr1 <- GRanges("1", IRanges(1,10), "+") gr2 <- GRanges("1", IRanges(20, 30), "+") # make a grl with duplicated ORFs (gr1 twice) grl <- GRangesList(tx1_1 = gr1, tx2_1 = gr2, tx3_1 = gr1) uniqueGroups(grl)gr1 <- GRanges("1", IRanges(1,10), "+") gr2 <- GRanges("1", IRanges(20, 30), "+") # make a grl with duplicated ORFs (gr1 twice) grl <- GRangesList(tx1_1 = gr1, tx2_1 = gr2, tx3_1 = gr1) uniqueGroups(grl)
Do you want to load/save libraries with unique mappers only, for bam it subsets from file, for other formats it presumes a directory './unique_mappers' relative to bam directory.
uniqueMappers(x)uniqueMappers(x)
x |
an ORFik |
a logical (length 1)
Do you want to load/save libraries with unique mappers only, for bam it subsets from file, for other formats it presumes a directory './unique_mappers' relative to bam directory.
## S4 method for signature 'experiment' uniqueMappers(x)## S4 method for signature 'experiment' uniqueMappers(x)
x |
an ORFik |
a logical (length 1)
Do you want to load/save libraries with unique mappers only, for bam it subsets from file, for other formats it presumes a directory './unique_mappers' relative to bam directory.
## S4 method for signature 'NULL' uniqueMappers(x)## S4 method for signature 'NULL' uniqueMappers(x)
x |
an ORFik |
a logical (length 1)
Do you want to load/save libraries with unique mappers only, for bam it subsets from file, for other formats it presumes a directory './unique_mappers' relative to bam directory.
uniqueMappers(x) <- valueuniqueMappers(x) <- value
x |
an ORFik |
value |
a logical (length 1) (NA values not allowed) |
an ORFik experiment with updated uniqueMappers
Do you want to load/save libraries with unique mappers only, for bam it subsets from file, for other formats it presumes a directory './unique_mappers' relative to bam directory.
## S4 replacement method for signature 'experiment' uniqueMappers(x) <- value## S4 replacement method for signature 'experiment' uniqueMappers(x) <- value
x |
an ORFik |
value |
a logical (length 1) (NA values not allowed) |
an ORFik experiment with updated uniqueMappers
This function can be used to calculate unique numerical identifiers
for each of the GRangesList elements. Elements of
GRangesList are unique when the GRanges
inside are not duplicated, so ranges differences matter as well as
sorting of the ranges.
uniqueOrder(grl)uniqueOrder(grl)
grl |
an integer vector of indices of unique groups
uniqueGroups
Other ORFHelpers:
defineTrailer(),
longestORFs(),
mapToGRanges(),
orfID(),
startCodons(),
startSites(),
stopCodons(),
stopSites(),
txNames(),
uniqueGroups()
gr1 <- GRanges("1", IRanges(1,10), "+") gr2 <- GRanges("1", IRanges(20, 30), "+") # make a grl with duplicated ORFs (gr1 twice) grl <- GRangesList(tx1_1 = gr1, tx2_1 = gr2, tx3_1 = gr1) uniqueOrder(grl) # remember ordering # example on unique ORFs uniqueORFs <- uniqueGroups(grl) # now the orfs are unique, let's map back to original set: reMappedGrl <- uniqueORFs[uniqueOrder(grl)]gr1 <- GRanges("1", IRanges(1,10), "+") gr2 <- GRanges("1", IRanges(20, 30), "+") # make a grl with duplicated ORFs (gr1 twice) grl <- GRangesList(tx1_1 = gr1, tx2_1 = gr2, tx3_1 = gr1) uniqueOrder(grl) # remember ordering # example on unique ORFs uniqueORFs <- uniqueGroups(grl) # now the orfs are unique, let's map back to original set: reMappedGrl <- uniqueORFs[uniqueOrder(grl)]
Same as [AnnotationDbi::unlist2()], keeps names correctly. Two differences is that if grl have no names, it will not make integer names, but keep them as null. Also if the GRangesList has names , and also the GRanges groups, then the GRanges group names will be kept.
unlistGrl(grl)unlistGrl(grl)
grl |
a GRangesList |
a GRanges object
ORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") # GRL named, GR not named grl <- GRangesList(tx1_1 = ORF) res <- unlistGrl(grl) res_original <- unlist(grl) identical(res, res_original) # TRUE # GRL not named, GR not named grl_no_names <- grl names(grl_no_names) <- NULL unlistGrl(grl_no_names) res <- unlistGrl(grl_no_names) res_original <- unlist(grl_no_names) identical(res, res_original) # TRUE # GRL named, GR named grl_names_gr_names <- unlistGrl(grl) grl_names_gr_names <- split(grl_names_gr_names, names(grl_names_gr_names)) res <- unlistGrl(grl_names_gr_names) res_original <- unlist(grl_names_gr_names) identical(res, res_original) # FALSE # GRL not named, GR named grl_not_names_gr_names <- grl_names_gr_names names(grl_not_names_gr_names) <- NULL res <- unlistGrl(grl_not_names_gr_names) res_original <- unlist(grl_not_names_gr_names) identical(res, res_original) # TRUEORF <- GRanges(seqnames = "1", ranges = IRanges(start = c(1, 10, 20), end = c(5, 15, 25)), strand = "+") # GRL named, GR not named grl <- GRangesList(tx1_1 = ORF) res <- unlistGrl(grl) res_original <- unlist(grl) identical(res, res_original) # TRUE # GRL not named, GR not named grl_no_names <- grl names(grl_no_names) <- NULL unlistGrl(grl_no_names) res <- unlistGrl(grl_no_names) res_original <- unlist(grl_no_names) identical(res, res_original) # TRUE # GRL named, GR named grl_names_gr_names <- unlistGrl(grl) grl_names_gr_names <- split(grl_names_gr_names, names(grl_names_gr_names)) res <- unlistGrl(grl_names_gr_names) res_original <- unlist(grl_names_gr_names) identical(res, res_original) # FALSE # GRL not named, GR named grl_not_names_gr_names <- grl_names_gr_names names(grl_not_names_gr_names) <- NULL res <- unlistGrl(grl_not_names_gr_names) res_original <- unlist(grl_not_names_gr_names) identical(res, res_original) # TRUE
For a GRangesList, get start and end site, return back as GRanges.
unlistToExtremities(grl)unlistToExtremities(grl)
grl |
a GRangs object with meta column "group", which gives
Given a GRangesList of 5' UTRs or transcripts, reassign the start sites using max peaks from CageSeq data (if CAGE is given). A max peak is defined as new TSS if it is within boundary of 5' leader range, specified by 'extension' in bp. A max peak must also be higher than minimum CageSeq peak cutoff specified in 'filterValue'. The new TSS will then be the positioned where the cage read (with highest read count in the interval). If you want to include uORFs going into the CDS, add this argument too.
uORFSearchSpace( fiveUTRs, cage = NULL, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, cds = NULL )uORFSearchSpace( fiveUTRs, cage = NULL, extension = 1000, filterValue = 1, restrictUpstreamToTx = FALSE, removeUnused = FALSE, cds = NULL )
fiveUTRs |
(GRangesList) The 5' leaders or full transcript sequences |
cage |
Either a filePath for the CageSeq file as .bed .bam or .wig, with possible compressions (".gzip", ".gz", ".bgz"), or already loaded CageSeq peak data as GRanges or GAlignment. NOTE: If it is a .bam file, it will add a score column by running: convertToOneBasedRanges(cage, method = "5prime", addScoreColumn = TRUE) The score column is then number of replicates of read, if score column is something else, like read length, set the score column to NULL first. |
extension |
The maximum number of basses upstream of the TSS to search for CageSeq peak. |
filterValue |
The minimum number of reads on cage position, for it to be counted as possible new tss. (represented in score column in CageSeq data) If you already filtered, set it to 0. |
restrictUpstreamToTx |
a logical (FALSE). If TRUE: restrict leaders to not extend closer than 5 bases from closest upstream leader, set this to TRUE. |
removeUnused |
logical (FALSE), if False: (standard is to set them to original annotation), If TRUE: remove leaders that did not have any cage support. |
cds |
(GRangesList) CDS of relative fiveUTRs, applicable only if you want to extend 5' leaders downstream of CDS's, to allow upstream ORFs that can overlap into CDS's. |
a GRangesList of newly assigned TSS for fiveUTRs, using CageSeq data.
Other uorfs:
addCdsOnLeaderEnds(),
filterUORFs(),
removeORFsWithSameStartAsCDS(),
removeORFsWithSameStopAsCDS(),
removeORFsWithStartInsideCDS(),
removeORFsWithinCDS()
# example 5' leader, notice exon_rank column fiveUTRs <- GenomicRanges::GRangesList( GenomicRanges::GRanges(seqnames = "chr1", ranges = IRanges::IRanges(1000, 2000), strand = "+", exon_rank = 1)) names(fiveUTRs) <- "tx1" # make fake CageSeq data from promoter of 5' leaders, notice score column cage <- GenomicRanges::GRanges( seqnames = "chr1", ranges = IRanges::IRanges(500, 510), strand = "+", score = 10) # finally reassign TSS for fiveUTRs uORFSearchSpace(fiveUTRs, cage)# example 5' leader, notice exon_rank column fiveUTRs <- GenomicRanges::GRangesList( GenomicRanges::GRanges(seqnames = "chr1", ranges = IRanges::IRanges(1000, 2000), strand = "+", exon_rank = 1)) names(fiveUTRs) <- "tx1" # make fake CageSeq data from promoter of 5' leaders, notice score column cage <- GenomicRanges::GRanges( seqnames = "chr1", ranges = IRanges::IRanges(500, 510), strand = "+", score = 10) # finally reassign TSS for fiveUTRs uORFSearchSpace(fiveUTRs, cage)
Faster version than S4Vector generic caller
## S4 method for signature 'GRanges' width(x)## S4 method for signature 'GRanges' width(x)
x |
a GRanges |
an integer (length equal to x)
Get total widths per GRangesList group
widthPerGroup(grl, keep.names = TRUE)widthPerGroup(grl, keep.names = TRUE)
grl |
|
keep.names |
a boolean, keep names or not, default: (TRUE) |
an integer vector (named/unnamed) of widths
gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) widthPerGroup(grl)gr_plus <- GRanges(seqnames = c("chr1", "chr1"), ranges = IRanges(c(7, 14), width = 3), strand = c("+", "+")) gr_minus <- GRanges(seqnames = c("chr2", "chr2"), ranges = IRanges(c(4, 1), c(9, 3)), strand = c("-", "-")) grl <- GRangesList(tx1 = gr_plus, tx2 = gr_minus) widthPerGroup(grl)
Spanning a region like a transcripts, plot how the reads distribute.
windowCoveragePlot( coverage, output = NULL, scoring = "zscore", colors = c("skyblue4", "orange"), title = "Coverage metaplot", type = "transcripts", scaleEqual = FALSE, setMinToZero = FALSE )windowCoveragePlot( coverage, output = NULL, scoring = "zscore", colors = c("skyblue4", "orange"), title = "Coverage metaplot", type = "transcripts", scaleEqual = FALSE, setMinToZero = FALSE )
coverage |
a data.table, e.g. output of scaledWindowCoverage |
output |
character string (NULL), if set, saves the plot as pdf or png to path given. If no format is given, is save as pdf. |
scoring |
character vector, default "zscore", either of zscore, transcriptNormalized, sum, mean, median, .. or NULL. Set NULL if already scored. see ?coverageScorings for info and more alternatives. |
colors |
character vector colors to use in plot, will fix automaticly, using binary splits with colors c('skyblue4', 'orange'). |
title |
a character (metaplot) (what is the title of plot?) |
type |
a character (transcripts), what should legends say is the whole region? Transcripts, genes, non coding rnas etc. |
scaleEqual |
a logical (FALSE), should all fractions (rows), have same max value, for easy comparison of max values if needed. |
setMinToZero |
a logical (FALSE), should minimum y-value be 0 (TRUE). With FALSE minimum value is minimum score at any position. This parameter overrides scaleEqual. |
If coverage has a column called feature, this can be used to subdivide the meta coverage into parts as (5' UTRs, cds, 3' UTRs) These are the columns in the plot. The fraction column divide sequence libraries. Like ribo-seq and rna-seq. These are the rows of the plot. If you return this function without assigning it and output is NULL, it will automaticly plot the figure in your session. If output is assigned, no plot will be shown in session. NULL is returned and object is saved to output.
Colors: Remember if you want to change anything like colors, just return the ggplot object, and reassign like: obj + scale_color_brewer() etc.
a ggplot object of the coverage plot, NULL if output is set, then the plot will only be saved to location.
Other coveragePlot:
coverageHeatMap(),
pSitePlot(),
savePlot()
library(data.table) coverage <- data.table(position = seq(20), score = sample(seq(20), 20, replace = TRUE)) windowCoveragePlot(coverage) #Multiple plots in one frame: coverage2 <- copy(coverage) coverage$fraction <- "Ribo-seq" coverage2$fraction <- "RNA-seq" dt <- rbindlist(list(coverage, coverage2)) windowCoveragePlot(dt, scoring = "log10sum") # See vignette for a more practical examplelibrary(data.table) coverage <- data.table(position = seq(20), score = sample(seq(20), 20, replace = TRUE)) windowCoveragePlot(coverage) #Multiple plots in one frame: coverage2 <- copy(coverage) coverage$fraction <- "Ribo-seq" coverage2$fraction <- "RNA-seq" dt <- rbindlist(list(coverage, coverage2)) windowCoveragePlot(dt, scoring = "log10sum") # See vignette for a more practical example
Per GRanges input (gr) of single position inputs (center point),
create a GRangesList window output of specified
upstream, downstream region relative to some transcript "tx".
If downstream is 20, it means the window will start 20 downstream of
gr start site (-20 in relative transcript coordinates.)
If upstream is 20, it means the window will start 20 upstream of
gr start site (+20 in relative transcript coordinates.)
It will keep exon structure of tx, so if -20 is on next exon, it jumps to
next exon.
windowPerGroup(gr, tx, upstream = 0L, downstream = 0L)windowPerGroup(gr, tx, upstream = 0L, downstream = 0L)
gr |
a GRanges/IRanges object (startSites or others, must be single point per in genomic coordinates) |
tx |
a |
upstream |
an integer, default (0), relative region to get upstream end from. (0 means start site, +1 is one upstream, -1 is one downstream) |
downstream |
an integer, default (0), relative region to get downstream end from (0 means start site, +1 is one downstream, -1 is one upstream) |
If a region has a part that goes out of bounds, E.g if you try to get window
around the CDS start site, goes longer than the 5' leader start site,
it will set start to the edge boundary
(the TSS of the transcript in this case).
If region has no hit in bound, a width 0 GRanges object is returned.
This is useful for things like countOverlaps, since 0 hits will then always
be returned for the correct object index. If you don't want the 0 width
windows, use reduce() to remove 0-width windows.
a GRanges, or GRangesList object if any group had > 1 exon.
Other ExtendGenomicRanges:
asTX(),
coveragePerTiling(),
extendLeaders(),
extendTrailers(),
reduceKeepAttr(),
tile1(),
txSeqsFromFa()
# find 2nd codon of an ORF on a spliced transcript ORF <- GRanges("1", c(3), "+") # start site names(ORF) <- "tx1_1" # ORF 1 on tx1 tx <- GRangesList(tx1 = GRanges("1", c(1,3,5,7,9,11,13), "+")) windowPerGroup(ORF, tx, upstream = 0, downstream = 0) # <- TIS windowPerGroup(ORF, tx, upstream = 0, downstream = 1) # <- first and second base windowPerGroup(ORF, tx, upstream = -1, downstream = 1) # <- second base # find 2nd codon of an ORF on a spliced transcript windowPerGroup(ORF, tx, upstream = -3, downstream = 5) # <- 2nd codon # With multiple extensions downstream ORF <- rep(ORF, 2) names(ORF)[2] <- "tx1_2" windowPerGroup(ORF, tx, upstream = 0, downstream = c(2, 5)) # The last one gives 2nd for first ORF and (1st and 2nd) codon for # second ORF, returned as two groups of class GRanges/GRangsList# find 2nd codon of an ORF on a spliced transcript ORF <- GRanges("1", c(3), "+") # start site names(ORF) <- "tx1_1" # ORF 1 on tx1 tx <- GRangesList(tx1 = GRanges("1", c(1,3,5,7,9,11,13), "+")) windowPerGroup(ORF, tx, upstream = 0, downstream = 0) # <- TIS windowPerGroup(ORF, tx, upstream = 0, downstream = 1) # <- first and second base windowPerGroup(ORF, tx, upstream = -1, downstream = 1) # <- second base # find 2nd codon of an ORF on a spliced transcript windowPerGroup(ORF, tx, upstream = -3, downstream = 5) # <- 2nd codon # With multiple extensions downstream ORF <- rep(ORF, 2) names(ORF)[2] <- "tx1_2" windowPerGroup(ORF, tx, upstream = 0, downstream = c(2, 5)) # The last one gives 2nd for first ORF and (1st and 2nd) codon for # second ORF, returned as two groups of class GRanges/GRangsList
This is defined as: Fraction of reads per read length, per position in whole window (defined by upstream and downstream) If tx is not NULL, it gives a metaWindow, centered around startSite of grl from upstream and downstream. If tx is NULL, it will use only downstream , since it has no reference on how to find upstream region. The exception is when upstream is negative, that is, going into downstream region of the object.
windowPerReadLength( grl, tx = NULL, reads, pShifted = TRUE, upstream = ifelse(!is.null(tx), ifelse(pShifted, 5, 20), min(ifelse(pShifted, 5, 20), 0)), downstream = ifelse(pShifted, 20, 5), acceptedLengths = NULL, zeroPosition = upstream, scoring = "transcriptNormalized", weight = "score", drop.zero.dt = FALSE, append.zeroes = FALSE, windows = startRegion(grl, tx, TRUE, upstream, downstream) )windowPerReadLength( grl, tx = NULL, reads, pShifted = TRUE, upstream = ifelse(!is.null(tx), ifelse(pShifted, 5, 20), min(ifelse(pShifted, 5, 20), 0)), downstream = ifelse(pShifted, 20, 5), acceptedLengths = NULL, zeroPosition = upstream, scoring = "transcriptNormalized", weight = "score", drop.zero.dt = FALSE, append.zeroes = FALSE, windows = startRegion(grl, tx, TRUE, upstream, downstream) )
grl |
a |
tx |
default NULL, a GRangesList of transcripts or (container region), names of tx must contain all grl names. The names of grl can also be the ORFik orf names. that is "txName_id" |
reads |
a |
pShifted |
a logical (TRUE), are Ribo-seq reads p-shifted to size 1 width reads? If upstream and downstream is set, this argument is irrelevant. So set to FALSE if this is not p-shifted Ribo-seq. |
upstream |
an integer (5), relative region to get upstream from. Default:
|
downstream |
an integer (20), relative region to get downstream from. Default:
|
acceptedLengths |
an integer vector (NULL), the read lengths accepted. Default NULL, means all lengths accepted. |
zeroPosition |
an integer DEFAULT (upstream), what is the center point? Like leaders and cds combination, then 0 is the TIS and -1 is last base in leader. NOTE!: if windows have different widths, this will be ignored. |
scoring |
a character (transcriptNormalized), which meta coverage scoring ? one of (zscore, transcriptNormalized, mean, median, sum, sumLength, fracPos), see ?coverageScorings for more info. Use to decide a scoring of hits per position for metacoverage etc. Set to NULL if you do not want meta coverage, but instead want per gene per position raw counts. |
weight |
(default: 'score'), if defined a character name of valid meta column in subject. GRanges("chr1", 1, "+", score = 5), would mean score column tells that this alignment region was found 5 times. Formats which loads a score column like this: Bigwig, wig, ORFik ofst, collapsed bam, bedoc and .bedo. As do CAGEr CAGE files and many other package formats. You can also assign a score column manually. |
drop.zero.dt |
logical FALSE, if TRUE and as.data.table is TRUE, remove all 0 count positions. This greatly speeds up and most importantly, greatly reduces memory usage. Will not change any plots, unless 0 positions are used in some sense. (mean, median, zscore coverage will only scale differently) |
append.zeroes |
logical, default FALSE. If TRUE and drop.zero.dt is TRUE and all windows have equal length, it will add back 0 values after transformation. Sometimes needed for correct plots, if TRUE, will call abort if not all windows are equal length! |
windows |
the GRangesList windows to actually check, default:
|
Careful when you create windows where not all transcripts are long enough, this function usually is used first with filterTranscripts to make sure they are of all of valid length!
a data.table with 4 columns: position (in window), score, fraction (read length). If score is NULL, will also return genes (index of grl). A note is that if no coverage is found, it returns an empty data.table.
Other coverage:
coverageScorings(),
metaWindow(),
regionPerReadLength(),
scaledWindowPositions()
cds <- GRangesList(tx1 = GRanges("1", 100:129, "+")) tx <- GRangesList(tx1 = GRanges("1", 80:129, "+")) reads <- GRanges("1", seq(79,129, 3), "+") windowPerReadLength(cds, tx, reads, scoring = "sum") windowPerReadLength(cds, tx, reads, scoring = "transcriptNormalized")cds <- GRangesList(tx1 = GRanges("1", 100:129, "+")) tx <- GRangesList(tx1 = GRanges("1", 80:129, "+")) reads <- GRanges("1", seq(79,129, 3), "+") windowPerReadLength(cds, tx, reads, scoring = "sum") windowPerReadLength(cds, tx, reads, scoring = "transcriptNormalized")