| Title: | Predict open reading frames in nucleotide sequences |
|---|---|
| Description: | The ORFhunteR package is a R and C++ library for an automatic determination and annotation of open reading frames (ORF) in a large set of RNA molecules. It efficiently implements the machine learning model based on vectorization of nucleotide sequences and the random forest classification algorithm. The ORFhunteR package consists of a set of functions written in the R language in conjunction with C++. The efficiency of the package was confirmed by the examples of the analysis of RNA molecules from the NCBI RefSeq and Ensembl databases. The package can be used in basic and applied biomedical research related to the study of the transcriptome of normal as well as altered (for example, cancer) human cells. |
| Authors: | Vasily V. Grinev [aut, cre] (ORCID: <https://orcid.org/0000-0001-9981-7333>), Mikalai M. Yatskou [aut], Victor V. Skakun [aut], Maryna Chepeleva [aut] (ORCID: <https://orcid.org/0000-0003-3036-4916>), Petr V. Nazarov [aut] (ORCID: <https://orcid.org/0000-0003-3443-0298>) |
| Maintainer: | Vasily V. Grinev <[email protected]> |
| License: | MIT License |
| Version: | 1.21.0 |
| Built: | 2026-05-24 06:35:54 UTC |
| Source: | https://github.com/bioc/ORFhunteR |
Annotate the open reading frames identified in nucleotide sequences of interest.
annotateORFs(orfs, tr, gtf = NULL, prts, workDir = NULL)annotateORFs(orfs, tr, gtf = NULL, prts, workDir = NULL)
orfs |
character string giving the name of tab-delimited TXT file with coordinates of open reading frame(-s). This file should include three mandatory fields: i) transcript_id - transcript ID; ii) start - start coordinate of open reading frame in a transcript; iii) end - end coordinate of open reading frame in a transcript. |
tr |
character string giving the name of file with transcript(-s) of interest. This file must include the transcript(-s) for which the open reading frame(-s) was/were identified and listed in above orfs file. Valid format is "fasta" or "fa". |
gtf |
character string giving the name of GTF/GFF file with annotated transcripts of interest. Default value is NULL. |
prts |
character string giving the name of FASTA file with sequences of in silico translated proteins encoded by identified open reading frames. |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
data.frame object with columns:
transcript_id |
transcript ID. |
f_utr.length |
length of 5'UTRs. |
start.codon |
type of start codon. |
orf.start |
start coordinate of open reading frames. |
orf.stop |
stop coordinate of open reading frames. |
stop.codon |
type of stop codon. |
stop.status |
PTC status of stop codon. |
orf.length |
length of open reading frames. |
t_utr.length |
length of 3'UTRs. |
MW |
molecular weight. |
pI |
isoelectic point of a protein sequence. |
indexPPI |
potential protein interaction index. |
Vasily V. Grinev
orfs_path <- system.file("extdata", "Set.trans_ORFs.coordinates.txt", package="ORFhunteR") tr_path <- system.file("extdata", "Set.trans_sequences.fasta", package="ORFhunteR") gtf_path <- system.file("extdata", "Set.trans_sequences.gtf", package="ORFhunteR") prts_path <- system.file("extdata", "Set.trans_proteins.sequences.fasta", package="ORFhunteR") anno_orfs <- annotateORFs(orfs=orfs_path, tr=tr_path, gtf=gtf_path, prts=prts_path, workDir=NULL)orfs_path <- system.file("extdata", "Set.trans_ORFs.coordinates.txt", package="ORFhunteR") tr_path <- system.file("extdata", "Set.trans_sequences.fasta", package="ORFhunteR") gtf_path <- system.file("extdata", "Set.trans_sequences.gtf", package="ORFhunteR") prts_path <- system.file("extdata", "Set.trans_proteins.sequences.fasta", package="ORFhunteR") anno_orfs <- annotateORFs(orfs=orfs_path, tr=tr_path, gtf=gtf_path, prts=prts_path, workDir=NULL)
Clussify the pseudo and true ORF candidates.
classifyORFsCandidates( ORFLncRNAs, ORFmRNAs, pLearn = 0.75, nTrees = 500, modelRF = NULL, workDir = NULL, showAccuracy = FALSE )classifyORFsCandidates( ORFLncRNAs, ORFmRNAs, pLearn = 0.75, nTrees = 500, modelRF = NULL, workDir = NULL, showAccuracy = FALSE )
ORFLncRNAs |
the oject of the class list of non-coding pseudo ORFs. |
ORFmRNAs |
the oject of the class list of coding true ORFs. |
pLearn |
probability threshold for the "traing" class of ORFs. Default value is 0.75. |
nTrees |
nuber of the decision trees in randomForest. Default value is 500. |
modelRF |
character string giving the name of RDS-file to store the classification model. NULL by default. |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
showAccuracy |
logic TRUE or FALSE. Use TRUE for print accuracy metrics. Default value is FALSE |
The classificator object of the class randomForest.
Mikalai M. Yatskou
## Not run: clt <- classifyORFsCandidates(ORFLncRNAs, ORFmRNAs) ## End(Not run)## Not run: clt <- classifyORFsCandidates(ORFLncRNAs, ORFmRNAs) ## End(Not run)
This function scans a nucleotide sequence of interest in the search of canonical start codon ATG or non-canonical start codons GTG, TTG and CTG as well as stop codons TAA, TAG and TGA.
codonStartStop(x)codonStartStop(x)
x |
character string giving the nucleotide sequence. |
list of potential start and stop codons with their coordinates.
Vasily V. Grinev
codons <- codonStartStop(x = "AAAATGGCATGGTAAGTC")codons <- codonStartStop(x = "AAAATGGCATGGTAAGTC")
Identify all possible variants of open reading frames in a nucleotide sequence of interest.
findORFs(x, codStart = "ATG")findORFs(x, codStart = "ATG")
x |
character string giving the nucleotide sequence of interest. |
codStart |
character string with type of start codon: "ATG", "GTG", "TTG" or "CTG". Default value is "ATG". |
matrix with start and stop positions, length and sequence of identified variants of open reading frames.
Vasily V. Grinev
x <- "AAAATGGCTGCGTAATGCAAAATGGCTGCGAATGCAAAATGGCTGCGAATGCCGGCACGTTGCTACGT" orf <- findORFs(x = x, codStart = "ATG")x <- "AAAATGGCTGCGTAATGCAAAATGGCTGCGAATGCAAAATGGCTGCGAATGCCGGCACGTTGCTACGT" orf <- findORFs(x = x, codStart = "ATG")
Identify the premature termination codons in nucleotide sequences of interest.
findPTCs(orfs, gtf, workDir = NULL)findPTCs(orfs, gtf, workDir = NULL)
orfs |
character string giving the name of tab-delimited TXT file with coordinates of open reading frame(-s). This file should include four mandatory fields: i) transcript_id - transcript ID; ii) start - start coordinate of open reading frame in a transcript; iii) end - end coordinate of open reading frame in a transcript; iv) length - length of open reading frame. |
gtf |
character string giving the name of GTF/GFF file with annotated transcripts of interest. Valid format is "gtf" or "gff". |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
data.frame object with start and stop positions, length and stop status of codons for each transcript ID.
Vasily V. Grinev
orfs_path <- system.file("extdata", "Set.trans_ORFs.coordinates.txt", package="ORFhunteR") gtf_path <- system.file("extdata", "Set.trans_sequences.gtf", package="ORFhunteR") ptcs <- findPTCs(orfs = orfs_path, gtf = gtf_path, workDir = NULL)orfs_path <- system.file("extdata", "Set.trans_ORFs.coordinates.txt", package="ORFhunteR") gtf_path <- system.file("extdata", "Set.trans_sequences.gtf", package="ORFhunteR") ptcs <- findPTCs(orfs = orfs_path, gtf = gtf_path, workDir = NULL)
Extract the sequences of identified open reading frames.
getSeqORFs(orfs, tr, genome = "BSgenome.Hsapiens.UCSC.hg38", workDir = NULL)getSeqORFs(orfs, tr, genome = "BSgenome.Hsapiens.UCSC.hg38", workDir = NULL)
orfs |
character string giving the name of tab-delimited TXT file with coordinates of open reading frame(-s). This file should include three mandatory fields: i) transcript_id - transcript ID; ii) start - start coordinate of open reading frame in a transcript; iii) end - end coordinate of open reading frame in a transcript. |
tr |
character string giving the name of file with transcript(-s) of interest. This file must include the transcript(-s) for which the open reading frame(-s) was/were identified and listed in above orfs file. Valid formats are "gtf", "gff", "fasta" and "fa". |
genome |
character string giving the name of BSgenome data package with full genome sequences. Default value is "BSgenome.Hsapiens.UCSC.hg38". |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
DNAStringSet object with sequences of extracted open reading frames.
Vasily V. Grinev
orfs_path <- system.file("extdata", "Set.trans_ORFs.coordinates.txt", package = "ORFhunteR") tr_path <- system.file("extdata", "Set.trans_sequences.fasta", package = "ORFhunteR") seq_orfs <- getSeqORFs(orfs = orfs_path, tr = tr_path, genome = "BSgenome.Hsapiens.UCSC.hg38", workDir = NULL)orfs_path <- system.file("extdata", "Set.trans_ORFs.coordinates.txt", package = "ORFhunteR") tr_path <- system.file("extdata", "Set.trans_sequences.fasta", package = "ORFhunteR") seq_orfs <- getSeqORFs(orfs = orfs_path, tr = tr_path, genome = "BSgenome.Hsapiens.UCSC.hg38", workDir = NULL)
Load a set of experimental transcripts.
loadTrExper(tr, genome = "BSgenome.Hsapiens.UCSC.hg38", workDir = NULL)loadTrExper(tr, genome = "BSgenome.Hsapiens.UCSC.hg38", workDir = NULL)
tr |
character string giving the name of file with experimental transcripts. Allowed file formats are "fasta", "fa", "gtf" or "gff". |
genome |
character string giving the name of BSgenome data package with full genome sequences. Default value is "BSgenome.Hsapiens.UCSC.hg38". |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
List of loaded transcript sequences.
Vasily V. Grinev
trans <- system.file("extdata", "Set.trans_sequences.fasta", package = "ORFhunteR") trans_seq <- loadTrExper(tr = trans)trans <- system.file("extdata", "Set.trans_sequences.fasta", package = "ORFhunteR") trans_seq <- loadTrExper(tr = trans)
Predict the true ORFs in mRNA molecules.
predictORF( tr, genome = "BSgenome.Hsapiens.UCSC.hg38", model = NULL, prThr = 0.5, workDir = NULL )predictORF( tr, genome = "BSgenome.Hsapiens.UCSC.hg38", model = NULL, prThr = 0.5, workDir = NULL )
tr |
character string giving the name of file with experimental transcripts. Allowed file formats are "fasta", "fa", "gtf" or "gff". |
genome |
character string giving the name of BSgenome data package with full genome sequences. Default value is "BSgenome.Hsapiens.UCSC.hg38". |
model |
character string giving the connection or full path to the file from which the classification model is read. Use default NULL value to use our default model. |
prThr |
probability threshold for the "winning" class of ORFs. Default value is 0.5. |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
The coordinates of ORFs in mRNA molecules of interest.
Mikalai M. Yatskou
## Not run: tr_path <- system.file("extdata", "Set.trans_sequences.fasta", package="ORFhunteR") model <- "http://www.sstcenter.com/download/ORFhunteR/classRFmodel_1.rds" ORFs <- predictORF(tr=tr_path, model=model) ## End(Not run)## Not run: tr_path <- system.file("extdata", "Set.trans_sequences.fasta", package="ORFhunteR") model <- "http://www.sstcenter.com/download/ORFhunteR/classRFmodel_1.rds" ORFs <- predictORF(tr=tr_path, model=model) ## End(Not run)
Translate the identified open reading frames to proteins.
translateORFs(seqORFs, aaSymbol = 1, workDir = NULL)translateORFs(seqORFs, aaSymbol = 1, workDir = NULL)
seqORFs |
character string giving the name of FASTA/FA file with sequences of identified open reading frames. |
aaSymbol |
type of amino acid symbols (one- or three-letter coding). Default value is 1. |
workDir |
character string giving the path to and name of work directory. NULL by default that mean the current working directory. |
AAStringSet object with protein sequences.
Vasily V. Grinev
seq_orf_path <- system.file("extdata", "Set.trans_ORFs.sequences.fasta", package = "ORFhunteR") prot_seqs <- translateORFs(seqORFs = seq_orf_path)seq_orf_path <- system.file("extdata", "Set.trans_ORFs.sequences.fasta", package = "ORFhunteR") prot_seqs <- translateORFs(seqORFs = seq_orf_path)
Vectorize the ORF(-s) sequence(-s) to sequence features.
vectorizeORFs(x)vectorizeORFs(x)
x |
DNAStringSet object with ORF(-s) sequence(-s). |
The object of class data.frame with ORF(-s) vectorized into sequence features.
Mikalai M. Yatskou
x = DNAStringSet(x = "ATGGGCCTCA") feats <- vectorizeORFs(x = x)x = DNAStringSet(x = "ATGGGCCTCA") feats <- vectorizeORFs(x = x)