| Title: | Analytical Tools for MassArray Data |
|---|---|
| Description: | This package is designed for the import, quality control, analysis, and visualization of methylation data generated using Sequenom's MassArray platform. The tools herein contain a highly detailed amplicon prediction for optimal assay design. Also included are quality control measures of data, such as primer dimer and bisulfite conversion efficiency estimation. Methylation data are calculated using the same algorithms contained in the EpiTyper software package. Additionally, automatic SNP-detection can be used to flag potentially confounded data from specific CG sites. Visualization includes barplots of methylation data as well as UCSC Genome Browser-compatible BED tracks. Multiple assays can be positionally combined for integrated analysis. |
| Authors: | Reid F. Thompson <[email protected]>, John M. Greally <[email protected]> |
| Maintainer: | Reid F. Thompson <[email protected]> |
| License: | GPL (>=2) |
| Version: | 1.65.0 |
| Built: | 2026-05-10 09:33:17 UTC |
| Source: | https://github.com/bioc/MassArray |
Function to predict amplicon fragmentation pattern and details for T&C reactions on the plus and minus strands
ampliconPrediction(sequence, lower.threshold = 1500, upper.threshold = 7000, fwd.tag = "AGGAAGAGAG", rev.tag = "AGCCTTCTCCC", plot = TRUE, table = TRUE, lwd = 1, cex = 1, multiple.conversion = FALSE)ampliconPrediction(sequence, lower.threshold = 1500, upper.threshold = 7000, fwd.tag = "AGGAAGAGAG", rev.tag = "AGCCTTCTCCC", plot = TRUE, table = TRUE, lwd = 1, cex = 1, multiple.conversion = FALSE)
sequence |
Nucleotide sequence input as a character string |
lower.threshold |
Lower limit (in Da) of usable mass window (default: 1500) |
upper.threshold |
Upper limit (in Da) of usable mass window (default: 7000) |
fwd.tag |
Nucleotide tag sequence 5' of the forward primer |
rev.tag |
T7-containing nucleotide tag sequence 5' of the reverse primer |
plot |
Logical specifying whether or not to display graphical representation of fragmentation profiles (default is |
table |
Logical specifying whether or not to return tabular representation of fragmentation profiles (default is |
lwd |
The line width used for fragmentation display, a positive number, defaulting to |
cex |
A numerical value (defaulting to |
multiple.conversion |
Logical value specifying whether or not to include multiple CGs on the same conversion control fragment where possible (default is |
Plotted fragmentation patterns contain a number of detailed features including: CG positions, molecular weight overlaps, conversion controls, fragment assayability, and more.
Note that the graphical output does not contain a built-in legend at this time, but the plot may be interepreted as follows: Putative fragmentation patterns are shown for T and C-cleavage reactions on both the plus and minus strands of an input amplicon, with the T-forward, T-reverse, C-forward, and C-reverse shown in descending order. CG dinucleotides (filled circles) are numbered and colored in blue. Other fragments are colored according to their ability to be assayed: fragment molecular weight outside the testable mass window (gray), fragment molecular weight overlapping with another fragment (red), fragment containing a potential conversion control (green), or fragment uniquely assayable but containing no CGs (black). Linked arrowheads denote molecular weight overlaps between multiple CG-containing fragments. Yellow highlights represent tagged or primer sequences, while lavender highlights denote user-specified "required" sites.
If table is TRUE, returns a list containing the following items:
summary |
A summary matrix of logical values specifying whether or not each CG is assayable by a given combination of cleavage reaction and DNA strand |
counts |
A numerical tally of the quantity of CGs that are assayable by each assay |
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
ampliconPrediction("TGGAACACCCAGCAAAGATCAAGCAGGAAAGGGCGCACGCAGCCTTCGTTGCTAACCTCCTCTGGACTCTGGTACCCCAGGCACCGCGAATGCTCCCCACCTCAGCCCCCTGACCTTTACCATCGCTGAAGCGGGCGTCGCTGATGTCTGCGGCGAGCCTGCCGACCAGCCCAGCTGCCCAGAGGAGCAGCCAGGCAAGGGCGCTGGCAGCCAGGACGCCGGAGCCCGACGCCCGAGAGGGGCGCGCGGAGCAAGCTGCGGTCACGGGAGGAACCTGAGCACGCAGAGCGTACCCCCACCTTCCACGGTGACCCGGACAGAACGCTCCTTGCGCTCCCACCCTAGGACCCCCTGTAACTCCAGGTTCCTGAGA")ampliconPrediction("TGGAACACCCAGCAAAGATCAAGCAGGAAAGGGCGCACGCAGCCTTCGTTGCTAACCTCCTCTGGACTCTGGTACCCCAGGCACCGCGAATGCTCCCCACCTCAGCCCCCTGACCTTTACCATCGCTGAAGCGGGCGTCGCTGATGTCTGCGGCGAGCCTGCCGACCAGCCCAGCTGCCCAGAGGAGCAGCCAGGCAAGGGCGCTGGCAGCCAGGACGCCGGAGCCCGACGCCCGAGAGGGGCGCGCGGAGCAAGCTGCGGTCACGGGAGGAACCTGAGCACGCAGAGCGTACCCCCACCTTCCACGGTGACCCGGACAGAACGCTCCTTGCGCTCCCACCCTAGGACCCCCTGTAACTCCAGGTTCCTGAGA")
Function to determine percent methylation for all CGs from input fragmentation
analyzeCpGs(fragments, peaks, method = c("weighted", "proportion"))analyzeCpGs(fragments, peaks, method = c("weighted", "proportion"))
fragments |
List of MassArrayFragment objects |
peaks |
List of MassArrayPeak objects comprising spectral data for a given assay |
method |
Specifies which algorithm to use when calculating percent methylation (either "weighted" or "proportion") |
Wrapper function for calcMeth(), takes fragmentation pattern and spectral data as input and applies percent methylation calculation for all CG-containing, non conversion control fragments
Returns a list of numerical values corresponding to percent methylation for each CG dinucleotide, with 0
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also calcMeth
data(MassArray.example.data) cpg.data <- analyzeCpGs(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks, method="weighted") barplot(cpg.data, xlab="CpG (Number)", ylim=c(0,1), ylab="Methylation (Percent)")data(MassArray.example.data) cpg.data <- analyzeCpGs(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks, method="weighted") barplot(cpg.data, xlab="CpG (Number)", ylim=c(0,1), ylab="Methylation (Percent)")
Bisulphite convert nucleotide sequence input
bisConvert(sequence)bisConvert(sequence)
sequence |
Nucleotide sequence in the form of a character string |
Returns a character value corresponding to the bisulphite converted input sequence.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
bisConvert("AAATTCGGAACCC")bisConvert("AAATTCGGAACCC")
Function to calculate percent methylation from a collection of peaks corresponding to a single fragment.
calcMeth(SNR.list, fragments = rep(1, length(SNR.list)), non.cg.fragments = numeric(0), method = c("weighted", "proportion"), prune.non.cg.peaks = TRUE, na.rm = FALSE)calcMeth(SNR.list, fragments = rep(1, length(SNR.list)), non.cg.fragments = numeric(0), method = c("weighted", "proportion"), prune.non.cg.peaks = TRUE, na.rm = FALSE)
SNR.list |
List of signal-to-noise ratios, sorted from low to high MWs, corresponding to the unmethylated and methylated peaks for a given set of fragments |
fragments |
List of all fragments contributing to each of the input peaks, automatically defaulting to a single fragment |
non.cg.fragments |
List of fragments (without CGs) contributing to any of the input peaks, automatically defaulting to |
method |
Specifies which algorithm to use when calculating percent methylation (either |
prune.non.cg.peaks |
Boolean value determining whether or not to remove non-CG-containing fragments prior to analysis or whether to include them in the calculating model (note that setting this option to |
na.rm |
Boolean value determing whether or not to return an error on input of any unspecified data ( |
Note that the current release of this function performs as expected for the large majority of cases. However, certain complex combinations of peak overlaps are not handled at this time. This may affect data for a minority of points, particularly those containing multiple overlaps with alternative fragments. Please ensure more in-depth review of such loci.
Returns a numerical values corresponding to percent methylation, with 0
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
Coolen, M.W., et al. (2007) Genomic profiling of CpG methylation and allelic specificity using quantitative high-throughput mass spectrometry: critical evaluation and improvements, Nucleic Acids Research, 35(18), e119.
See Also MassArrayPeak
data(MassArray.example.data) frags <- MassArray.example.data$fragments.T[[6]]$"MW" peaks <- findPeaks(frags, unlist(lapply(MassArray.example.data$samples[[1]]$peaks, slot, "MW.actual"))) SNRs <- unlist(lapply(MassArray.example.data$samples[[1]]$peaks[peaks], slot, "SNR")) frag.list <- list(1:3, 1:3, 1:3, 1:3) calcMeth(SNRs, fragments=frag.list, method="weighted") calcMeth(SNRs, fragments=frag.list, method="proportion")data(MassArray.example.data) frags <- MassArray.example.data$fragments.T[[6]]$"MW" peaks <- findPeaks(frags, unlist(lapply(MassArray.example.data$samples[[1]]$peaks, slot, "MW.actual"))) SNRs <- unlist(lapply(MassArray.example.data$samples[[1]]$peaks[peaks], slot, "SNR")) frag.list <- list(1:3, 1:3, 1:3, 1:3) calcMeth(SNRs, fragments=frag.list, method="weighted") calcMeth(SNRs, fragments=frag.list, method="proportion")
Function to calculate molecular weight of a fragment generated by the MassCLEAVE assay for either the T or C cleavage reactions
calcMW(sequence, extra = c("5OH", "5PPP-3P", "5PPP-3OH"), adduct = c("", "Na", "K"), rxn = c("T", "C"))calcMW(sequence, extra = c("5OH", "5PPP-3P", "5PPP-3OH"), adduct = c("", "Na", "K"), rxn = c("T", "C"))
sequence |
Nucleotide sequence input |
extra |
One of "5OH" (default), "5PPP-3P", or "5PPP-3OH" describing 5' and/or 3' modifications of the fragment |
adduct |
One of 'Na', 'K', or ” (default) specifying whether or not the molecular weight should be calculated for a salt adduct |
rxn |
One of 'T' or 'C' indicating which cleavage reaction is employed to generate the fragment |
Returns a numerical output corresponding to the molecular weight (in Da) of sequence input. Note that the output may actually represent multiple molecular weights if/whenever the input sequence contains one or more degenerate bases (e.g. R or Y).
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
calcMW("AAATCCC") calcMW("AARTYCC")calcMW("AAATCCC") calcMW("AARTYCC")
Function to calculate ratio of salt adduct peak heights to reference/unmodified peaks
calcPercentAdduct(peaks)calcPercentAdduct(peaks)
peaks |
List of MassArrayPeak objects comprising complete spectral data |
Salt adducts (either Na or K) are identified and compared to each of their unmodified reference peaks
Returns a list of numerical values corresponding to the ratios of salt adduct peak heights to their unmodified reference peaks
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
data(MassArray.example.data) adduct.ratios <- calcPercentAdduct(MassArray.example.data$samples[[1]]$peaks) median(adduct.ratios)data(MassArray.example.data) adduct.ratios <- calcPercentAdduct(MassArray.example.data$samples[[1]]$peaks) median(adduct.ratios)
Function to calculate percent methylation (wrapper for calcMeth() function) for each identified conversion control
calcPercentConversion(fragments, peaks)calcPercentConversion(fragments, peaks)
fragments |
List of MassArrayFragment objects |
peaks |
List of MassArrayPeak objects comprising spectral data to be used for conversion control calculations |
This function serves as a wrapper function for calcMeth(), such that percent methylation is calculated for all conversion controls within the input list of fragments.
Returns a list of numerical values (from 0 to 1) corresponding to percent methylation for each conversion control, with 0 Note that each element within the returned list will represent conversion control(s) for a single sample, while each element may contain multiple values with each value corresponding to data obtained from a single conversion control fragment.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also calcMeth, convControl
data(MassArray.example.data) conversion.data <- calcPercentConversion(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks) mean(conversion.data) # NOTE: conversion control data may already be contained within a MassArrayData object; these data can be accessed and visualized by the following (or alternative) commands conversion.data <- unlist(lapply(lapply(MassArray.example.data$samples, slot, "quality.conversion"), median, na.rm=TRUE)) barplot(conversion.data)data(MassArray.example.data) conversion.data <- calcPercentConversion(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks) mean(conversion.data) # NOTE: conversion control data may already be contained within a MassArrayData object; these data can be accessed and visualized by the following (or alternative) commands conversion.data <- unlist(lapply(lapply(MassArray.example.data$samples, slot, "quality.conversion"), median, na.rm=TRUE)) barplot(conversion.data)
Function to join two MassArrayData objects by sequence positions and samples
combine(x, y, ...)combine(x, y, ...)
x |
MassArrayData object |
y |
MassArrayData object |
... |
Other arguments passed to combine not supported at this time. |
Returns a single MassArrayData object that contains a union of samples and amplicons and spectral data from both MassArrayData objects in input
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
data(MassArray.example.data) samples(MassArray.example.data) combined.data <- combine(MassArray.example.data[2,], MassArray.example.data[1,]) samples(combined.data)data(MassArray.example.data) samples(MassArray.example.data) combined.data <- combine(MassArray.example.data[2,], MassArray.example.data[1,]) samples(combined.data)
Methods for joining two MassArrayData objects by sequence positions and samples, or simply operating on a single MassArrayData object to combine samples, depending on input
Combine two MassArrayData objects by position and then by sample
Combine duplicate samples within the same MassArrayData object
See Also combine
Function to identify all potential conversion controls in a given input sequence, for a given list of fragments
convControl(sequence, fragmentation, multiple = FALSE)convControl(sequence, fragmentation, multiple = FALSE)
sequence |
Nucleotide sequence input as a character string |
fragmentation |
List of MassArrayFragment objects corresponding to the fragmentation pattern of the sequence input |
multiple |
Logical value specifying whether or not to include multiple CGs on the same conversion control fragment where possible (default is |
Potential conversion controls are identified from the nucleotide sequence input through pattern recognition of fragments that contain non-CG cytosines. Any conversion controls that contain CG dinucleotides or have a molecular weight outside of the usable mass window are screened out. Additionally, conversion controls that are located in identified primer sequence or have molecular weight overlap with other fragments are removed from consideration. Lastly, if the consideration of the fragment as a conversion control will cause new molecular weight overlap(s) with one or more other fragments, the control is also removed from consideration.
Returns a list of MassArrayFragment objects identical to the input, with the exception that conversion controls are labeled and updated accordingly.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also as MassArrayFragment
data(MassArray.example.data) MassArray.example.data$fragments.T[[54]] conversion.data <- convControl(MassArray.example.data$sequence, MassArray.example.data$fragments.T) conversion.data[[54]]data(MassArray.example.data) MassArray.example.data$fragments.T[[54]] conversion.data <- convControl(MassArray.example.data$sequence, MassArray.example.data$fragments.T) conversion.data[[54]]
Function to count the number of CG dinucleotides in a given sequence (can include special characters for degenerate bases - i.e. 'Y' or 'R')
countCGs(sequence)countCGs(sequence)
sequence |
Nucleotide sequence input as a character string |
Returns a numerical count of the number of CG dinucleotides in a given sequence, NA if sequence input is NA
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
countCGs("AAACGCGAAAAAAAYGAAA")countCGs("AAACGCGAAAAAAAYGAAA")
Function to create and write a wiggle track (UCSC Genome Browser format) to flat file from methylation data contained in a MassArrayData object
createWiggle(x, file = "", append = FALSE, colors = NULL, na.rm = FALSE, sep = " ")createWiggle(x, file = "", append = FALSE, colors = NULL, na.rm = FALSE, sep = " ")
x |
|
file |
location of file to write wiggle track information; if "", wiggle track prints to the standard output connection: see |
append |
logical; if TRUE, the output is appended to an existent wiggle track file. If FALSE (default), a new file with a new header is created and any existing file of the same name is destroyed. |
colors |
vector of colors, indicates which colors to use for which wiggle track |
na.rm |
logical; if TRUE (default), missing values are removed from data. If FALSE any missing values cause an error |
sep |
a string used to separate columns. Using sep = "\t" (default) gives tab-delimited output. |
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
UCSC Genome Browser, http://genome.ucsc.edu/goldenPath/help/customTrack.html: Kent, W.J., Sugnet, C. W., Furey, T. S., Roskin, K.M., Pringle, T. H., Zahler, A. M., and Haussler, D. The Human Genome Browser at UCSC. Genome Res. 12(6), 996-1006 (2002).
data(MassArray.example.data) createWiggle(MassArray.example.data)data(MassArray.example.data) createWiggle(MassArray.example.data)
Function to estimate level of signal due to primer dimers in a given spectrum
estimatePrimerDimer(fragments, peaks, method = c("ratio", "mann-whitney"))estimatePrimerDimer(fragments, peaks, method = c("ratio", "mann-whitney"))
fragments |
List of MassArrayFragment objects corresponding to the sample |
peaks |
List of MassArrayPeak objects comprising spectral data for a complete assay |
method |
Specifies which algorithm to use when estimating primer dimer levels (either |
Primer dimers are calculated by: 1) identifying fragments that occur within the expected primer sequence, 2) identifying which of these fragments is assayable, and 3) comparing the overall signal for primer peaks and peaks from the rest of the amplicon.
Returns a list containing primer dimer ratios or significance estimates (i.e. p-values) depending on the analytical method specified ("ratio" or "mann-whitney", respectively). Returns "NA" in cases where insufficient data is present to calculate primer dimer levels.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
data(MassArray.example.data) primer.data <- estimatePrimerDimer(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks, "ratio") mean(primer.data) primer.data <- estimatePrimerDimer(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks, "mann-whitney") mean(primer.data)data(MassArray.example.data) primer.data <- estimatePrimerDimer(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks, "ratio") mean(primer.data) primer.data <- estimatePrimerDimer(MassArray.example.data$fragments.T, MassArray.example.data$samples[[1]]$peaks, "mann-whitney") mean(primer.data)
Function to analyze a MassArrayData object for all potential single nucleotide polymorphisms (SNPs) indicated by new and/or missing peaks in the the spectral data for one or more samples
evaluateSNPs(x, verbose = TRUE, plot = TRUE)evaluateSNPs(x, verbose = TRUE, plot = TRUE)
x |
MassArrayData object containing spectral data for one or more samples |
verbose |
Logical specifying whether or not to display descriptive progress updates as SNPs are analyzed |
plot |
Logical specifying whether or not to display graphical representation of fragmentation profiles (default is |
This function performs an exhaustive search for all potential SNPs (single base pair substitutions or deletions) that may give rise to new and/or missing peaks. Graphical output is displayed by default, and extensive data describing putative SNPs is also returned.
Note that the graphical output does not contain a built-in legend at this time, but the plot may be interepreted as follows: In the uppermost panel the T-cleavage fragmentation profile is shown for a given amplicon (C-cleavage reactions occupy a split screen whenever relevant). CG dinucleotides (filled circles) are numbered and colored in blue. Other fragments are colored according to their ability to be assayed: fragment molecular weight outside the testable mass window (gray), fragment molecular weight overlapping with another fragment (red), fragment containing a potential conversion control (green), or fragment uniquely assayable but containing no CGs (black). Putative SNPs are shown directly below their location within the amplicon fragmentation profile. Each row represents analysis from a single sample. Small, gray symbols represent potential SNPs that do not have sufficient evidence (presence of a new peak with corresponding absence of an expected peak). Larger black symbols indicate a potential SNP with both new peaks and missing expected peaks. Triangles indicate base pair substitution, while circles indicate single base pair deletion.
Returns a list of potential SNPs for each identified new peak in the spectral data. Note that each new peak may be explained by any number of potential SNPs; the list returned only includes the most reliable hits, but the redundant nature of the data necessitates returning a nested list, such that each new peak is associated with the following list elements:
SNP |
Contains a list of SNPs, each of which takes the form " |
SNR |
Contains a numerical list of signal-to-noise ratios corresponding to the expected original peak for the fragment mapping to the identified SNP position |
fragment |
Contains a numerical list of fragment IDs which map the SNP position to a specific fragment |
SNP.quality |
Contains a numerical list (values ranging from |
samples |
Contains a list of samples whose spectral data contained the given new peak |
count |
Specifies the number of unique SNP and sample pairs, exactly equivalent to the length of |
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also identifySNPs
data(MassArray.example.data) SNP.data <- evaluateSNPs(MassArray.example.data[2,])data(MassArray.example.data) SNP.data <- evaluateSNPs(MassArray.example.data[2,])
Function to process shorthand form of a nucleotide sequence, where a given base pair followed by a number specifies a run of the indicated nucleotide for the specified length (ex: "A6TTCGA4")
expandSequence(sequence)expandSequence(sequence)
sequence |
Nucleotide sequence input as a character string |
Returns an expanded nucleotide sequence as a character string
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
expandSequence("A6TTCGA4") expandSequence("C10C10") expandSequence("AT1CG")expandSequence("A6TTCGA4") expandSequence("C10C10") expandSequence("AT1CG")
Function to determine which subset(s) of peaks collide with eachother (i.e. molecular weights are indistinguishable given the specified resolution)
findCollisions(peaks, resolution = 0.5)findCollisions(peaks, resolution = 0.5)
peaks |
Numerical list of molecular weights (in Da) corresponding to a set of peaks |
resolution |
Resolution (in Da), used to specify the ability to distinguish two different molecular weights. For a resolution of 0.5 (default), two molecular weights are considered identical if they are less than 0.5 Da apart. |
Returns a list of peak collisions for each peak in the original list, thus the data object returned is in the form of a nested list.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
findCollisions(1:5, 1.5)findCollisions(1:5, 1.5)
Function to identify which fragment(s) in a list of fragments match a given molecular weight
findFragments(MW, fragments, resolution = 1)findFragments(MW, fragments, resolution = 1)
MW |
Molecular weight target (in Da) |
fragments |
List of molecular weights corresponding to unique fragments |
resolution |
Resolution (in Da), used to specify the ability to distinguish two different molecular weights. For a resolution of 1 (default), two molecular weights are considered identical if they are less than 1 Da apart. |
Returns the index or indices of fragment(s) within the input list that have a molecular weight which matches that specified as input
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
data(MassArray.example.data) findFragments(3913,MassArray.example.data$fragments.T, resolution=0.1) findFragments(3913,MassArray.example.data$fragments.T, resolution=0.5)data(MassArray.example.data) findFragments(3913,MassArray.example.data$fragments.T, resolution=0.1) findFragments(3913,MassArray.example.data$fragments.T, resolution=0.5)
Function to determine which peak(s) in a list of peaks match a given molecular weight.
findPeaks(MW, peaks, resolution = 1)findPeaks(MW, peaks, resolution = 1)
MW |
Molecular weight target (in Da) |
peaks |
List of molecular weights corresponding to unique peaks |
resolution |
Resolution (in Da), used to specify the ability to distinguish two different molecular weights. For a resolution of 1 (default), two molecular weights are considered identical if they are less than 1 Da apart. |
Returns the index or indices of peak(s) within the input list that have a molecular weight which matches that specified as input
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
findPeaks(3.1, 6:1, res=0) findPeaks(3.1, 6:1, res=0.2)findPeaks(3.1, 6:1, res=0) findPeaks(3.1, 6:1, res=0.2)
Function to identify potential single nucleotide polymorphisms (SNPs) which allow mapping of a novel peak sequence to the expected amplicon sequence
identifySNPs(peak.sequence, sequence, rxn = c("T", "C"))identifySNPs(peak.sequence, sequence, rxn = c("T", "C"))
peak.sequence |
Nucleotide sequence (can also be base composition - ex: "A6G2C1T3") as a character string |
sequence |
Nucleotide sequence for wildtype/expected amplicon as a character string |
rxn |
One of "T" or "C" specifying which cleavage reaction to use for SNP analysis |
The algorithm steps through the sequence, substituting one nucleotide at a time with the other three base pairs or a blank character (deletion), in order to determine a base compositional match to the input peak.sequence which represents a peak not found in the native sequence.
Returns a list of potential SNP matches for the input peak.sequence. Each element of the list contains multiple items as follows:
sequence |
corresponds to |
position |
corresponds to the matched position within |
base |
corresponds to the altered nucleotide (i.e. "A", "T", "C", "G", or "") |
type |
corresponds to the class of SNP (i.e. "substitution" or "deletion") |
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
## SINGLE SUBSTITUTION identifySNPs("AAGT","AATTTT") ## MULTIPLE SUBSTITUTION POSSIBILITIES identifySNPs("A1G1T1","AATTTT") ## DELETION identifySNPs("AAT","AGATTTT")## SINGLE SUBSTITUTION identifySNPs("AAGT","AATTTT") ## MULTIPLE SUBSTITUTION POSSIBILITIES identifySNPs("A1G1T1","AATTTT") ## DELETION identifySNPs("AAT","AGATTTT")
Function to read and import an EpiTyper datafile (v.1.0) and store it as a MassArraySpectrum objects
importEpiTyperData(data, MassArrayObject, verbose = TRUE)importEpiTyperData(data, MassArrayObject, verbose = TRUE)
data |
location of EpiTyper datafile as a character string |
MassArrayObject |
Pre-existent MassArrayData object in which store relevant sample and spectral information from datafile |
verbose |
Logical specifying whether or not to display descriptive progress updates as datafile is processed |
EpiTyper v.1.0 datafiles must only contain a single amplicon, thus the user must export peak data for one amplicon at a time.
Returns a list of MassArraySpectrum objects each populated by spectral data
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArraySpectrum
Function to read and import an EpiTyper datafile (v.1.0.5) and store it as a list of MassArraySpectrum objects
importEpiTyperData.new(data, MassArrayObject, verbose = TRUE)importEpiTyperData.new(data, MassArrayObject, verbose = TRUE)
data |
location of EpiTyper datafile as a character string |
MassArrayObject |
Pre-existent MassArrayData object in which store relevant sample and spectral information from datafile |
verbose |
Logical specifying whether or not to display descriptive progress updates as datafile is processed |
EpiTyper v.1.0.5 datafiles must only contain a single amplicon, thus the user must export peak data for one amplicon at a time.
Returns a list of MassArraySpectrum objects each populated by spectral data
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArraySpectrum
Function to perform a complete in silico fragmentation of input sequence. Provides wrapper to a number of different functions, each of which determines additional information about each fragment.
inSilicoFragmentation(sequence, fwd.tag = "", rev.tag = "", type = c("T", "C"), lower.threshold = 1500, upper.threshold = 7000, fwd.primer = 0, rev.primer = 0, multiple.conversion = FALSE)inSilicoFragmentation(sequence, fwd.tag = "", rev.tag = "", type = c("T", "C"), lower.threshold = 1500, upper.threshold = 7000, fwd.primer = 0, rev.primer = 0, multiple.conversion = FALSE)
sequence |
Nucleotide sequence input as a character string |
fwd.tag |
Nucleotide tag sequence 5' of the forward primer |
rev.tag |
T7-containing nucleotide tag sequence 5' of the reverse primer |
type |
One of 'T' or 'C' indicating which cleavage reaction to use |
lower.threshold |
Lower limit (in Da) of usable mass window (default: 1500) |
upper.threshold |
Upper limit (in Da) of usable mass window (default: 7000) |
fwd.primer |
Length (in bp) of forward primer |
rev.primer |
Length (in bp) of reverse primer |
multiple.conversion |
Logical value specifying whether or not to include multiple CGs on the same conversion control fragment where possible (default is |
In silico fragmentation analysis includes RNAse A digestion, peak mapping and overlap detection, CG detection, assayability and conversion controls.
Returns a list of MassArrayFragment objects, each with extensive contextual and other information
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also as MassArrayFragment
inSilicoFragmentation("GGGTTAGTCC")inSilicoFragmentation("GGGTTAGTCC")
Function to determine whether or not a given molecular weight is assayable (i.e. within the usable mass window specified)
isAssayable(MW, lower.threshold = 1500, upper.threshold = 7000)isAssayable(MW, lower.threshold = 1500, upper.threshold = 7000)
MW |
Numerical input corresponding to molecular weight |
lower.threshold |
Lower limit (in Da) of usable mass window (default: 1500) |
upper.threshold |
Upper limit (in Da) of usable mass window (default: 7000) |
Returns a logical corresponding to whether or not the molecular weight input falls within the usable mass window specified
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
isAssayable(5000) isAssayable(1200)isAssayable(5000) isAssayable(1200)
This data contains MassArray spectral information for two samples.
MassArray.example.dataMassArray.example.data
The format is: Formal class 'MassArrayData' [package "MassArray"] with 17 slots ..@ sequence : chr "CCAGGTCCAAAGGTTCAGACCAGTCTGAACCTGTCCAGGGGCACTCCATATTTTCCTACCTGTCCCTCTTTGCTTGTAAAAACAAATTAAACAGGGATCCCAGCAACTTCGGGGCATGTGTGTAACT"| __truncated__ ..@ chr : chr(0) ..@ start : int(0) ..@ end : int(0) ..@ strand : chr "+" ..@ fwd.tag : chr "AGGAAGAGAG" ..@ rev.tag : chr "AGCCTTCTCCC" ..@ fwd.primer : num 29 ..@ rev.primer : num 27 ..@ lower.threshold : num 1500 ..@ upper.threshold : num 9000 ..@ fragments.T :List of 89 .. ..$ :Formal class 'MassArrayFragment' [package "MassArray"] with 21 slots .. .. .. ..@ ID : int 1 .. .. .. ..@ assay.name : chr "" .. .. .. ..@ name : chr "" .. .. .. ..@ sequence : chr "GGGAGAAGGCT" .. .. .. ..@ position : int 385 .. .. .. ..@ length : int 11 .. .. .. ..@ CpGs : int 0 .. .. .. ..@ MW : num 3913 .. .. .. ..@ collisions : int 0 .. .. .. ..@ collision.IDs :List of 1 .. .. .. .. ..$ : int(0) .. .. .. ..@ CG.collisions : int 0 .. .. .. ..@ CG.collision.IDs : list() .. .. .. ..@ type : chr "T" .. .. .. ..@ direction : chr "+" .. .. .. ..@ extra : chr "5PPP-3P" .. .. .. ..@ bisulfite.converted: logi TRUE .. .. .. ..@ assayable : logi TRUE .. .. .. ..@ conversion.control : logi FALSE .. .. .. ..@ required : logi FALSE .. .. .. ..@ ignored : logi FALSE .. .. .. ..@ primer : logi TRUE ..@ samples :List of 2 .. ..$ :Formal class 'MassArraySpectrum' [package "MassArray"] with 9 slots .. .. .. ..@ sample : chr "A" .. .. .. ..@ rxn : chr "T" .. .. .. ..@ strand : chr "+" .. .. .. ..@ peaks :List of 184 .. .. .. .. ..$ :Formal class 'MassArrayPeak' [package "MassArray"] with 16 slots .. .. .. .. .. .. ..@ ID : int 1 .. .. .. .. .. .. ..@ MW.theoretical : num 1111 .. .. .. .. .. .. ..@ MW.actual : num NA .. .. .. .. .. .. ..@ probability : num 0 .. .. .. .. .. .. ..@ SNR : num 0 .. .. .. .. .. .. ..@ height : num NA .. .. .. .. .. .. ..@ sample.intensity: num NA .. .. .. .. .. .. ..@ ref.intensity : num 0.1 .. .. .. .. .. .. ..@ sequence : chr "ACACAAT" .. .. .. .. .. .. ..@ adduct : chr "" .. .. .. .. .. .. ..@ type : chr "Modified" .. .. .. .. .. .. ..@ charge : int 1 .. .. .. .. .. .. ..@ collisions : int 0 .. .. .. .. .. .. ..@ components : int 0 .. .. .. .. .. .. ..@ missing : logi TRUE .. .. .. .. .. .. ..@ new : logi FALSE .. .. .. ..@ quality.conversion : num [1:4] 0.0529 0 0 0 .. .. .. ..@ quality.spectra : num NA .. .. .. ..@ quality.primerdimer: num [1:7] 8.51 15.83 3.28 1.04 0 ... .. .. .. ..@ quality.contaminant: num NA .. .. .. ..@ quality.adducts : num [1:114] 1 1 0.97 0.231 0.412 ... ..@ groups : chr(0) ..@ CpG.data : num [1:2, 1:18] 0.0322 0.0449 0.1468 0.3641 0.1468 ... ..@ CpG.data.combined: num [1:2, 1:18] 0.0322 0.0449 0.1468 0.3641 0.1468 ...
Thompson et al. 2009
data(MassArray.example.data)data(MassArray.example.data)
A data structure containing MassArray data and associated information for a single amplicon
Objects can be created by calls of the form new("MassArrayData", sequence, file, verbose, fwd.tag, rev.tag, fwd.primer, rev.primer, strand, lower.threshold, upper.threshold, header, skip, sep, comment.char, fill, method, position, ...).
sequence:Nucleotide sequence for unconverted amplicon
chr:Chromosomal position of amplicon
start:Chromosomal position of amplicon
end:Chromosomal position of amplicon
strand:DNA strand used for amplicon (can be '+' or '-')
fwd.tag:Nucleotide tag sequence 5' of the forward primer
rev.tag:T7-containing nucleotide tag sequence 5' of the reverse primer
fwd.primer:Length (in bp) of forward primer
rev.primer:Length (in bp) of reverse primer
lower.threshold:Lower limit (in Da) of usable mass window (default: 1500)
upper.threshold:Upper limit (in Da) of usable mass window (default: 7000)
fragments.T:List containing objects of class MassArrayFragment, corresponding to the T-cleavage reaction for the amplicon on the specified strand
fragments.C:List containing objects of class MassArrayFragment, corresponding to the C-cleavage reaction for the amplicon on the specified strand
samples:List containing object of class MassArraySpectrum, each corresponding to spectral data from a single sample
groups:List of the group name to which each sample belongs
CpG.data:Matrix containing analyzed methylation data, where each row is a sample and each column is a CG dinucleotide site
CpG.data.combined:Matrix containing methylation data combined from multiple objects (or collapsed from within a single object), where each row is a sample and each column is a CG dinucleotide site
signature(x = "MassArrayData"): ...
signature(x = "MassArrayData"): ...
signature(x = "MassArrayData"): ...
signature(.Object = "MassArrayData"): ...
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
showClass("MassArrayData")showClass("MassArrayData")
A data structure containing information for a single fragment of an amplicon
Objects can be created by calls of the form new("MassArrayFragment", ID, sequence, assay.name, name, position, type, direction, extra, bisulfite.converted, assayable, primer, ...).
ID:Unique integer indexing the fragment's position within a potential list of multiple fragments
assay.name:(currently not supported)
name:(currently not supported)
sequence:Bisulphite converted nucleotide sequence of fragment
position:Relative position of fragment within the amplicon
length:Length (in bp) of fragment sequence
CpGs:Number of CG dinucleotides contained within the fragment
MW:Predicted molecular weight(s) of fragment, including methylated and unmethylated mass, adducts, etc.
collisions:Number of fragments that share the same molecular weight as the current fragment
collision.IDs:IDs of other fragments that share the same molecular weight as the current fragment
CG.collisions:Number of CG-containing fragments that share the same molecular weight as the current fragment
CG.collision.IDs:IDs of other CG-containing fragments that share the same molecular weight as the current fragment
type:Specifies either 'T' or 'C' cleavage reaction
direction:DNA strand used for fragment sequence (can be '+' or '-')
extra:One of "5PPP-3P", "5OH", or "5PPP-3OH" (default)
bisulfite.converted:Logical indicating whether the fragment sequence represents bisulfite converted sequence
assayable:Logical indicating whether or not the fragment molecular weight is within the usable mass window
conversion.control:Logical indicating whether or not the fragment is designated as a potential conversion control
required:Logical indicating whether or not the fragment is designated as 'required' by the user
ignored:Logical indicating whether or not the fragment is to be ignored
primer:Logical indicating whether or not the fragment overlaps with primer or tagged sequence
signature(x = "MassArrayFragment"): ...
signature(x = "MassArrayFragment"): ...
signature(.Object = "MassArrayFragment"): ...
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
showClass("MassArrayFragment")showClass("MassArrayFragment")
A data structure containing information and data for a single peak from a single spectrum
Objects can be created by calls of the form new("MassArrayPeak", ID, MW.theoretical, MW.actual, probability, SNR, height, sample.intensity, ref.intensity, sequence, adduct, type, charge, collisions, components, missing, new, ...).
ID:Peak ID inicating indexed position within a potentially large list of peaks
MW.theoretical:Expected molecular weight of peak based on nucleotide sequence
MW.actual:Observed molecular weight from experimental data
probability:Object of class "numeric" ~~
SNR:Signal-to-noise ratio
height:Raw peak height
sample.intensity:Raw sample intensity
ref.intensity:Object of class "numeric" ~~
sequence:Nucleotide composition or sequence(s) corresponding to peak
adduct:One of 'Na', 'K', or ” indicating whether or not peak represents a salt adduct of another expected peak
type:Object of class "character" ~~
charge:Degree of ionization of fragment (default is '1' indicating a single positive charge per fragment)
collisions:Number of peaks that share the same molecular weight as the current peak
components:Number of fragments expected to give rise to a peak of this molecular weight
missing:Logical indicating whether or not the expected peak is missing from the spectral data
new:Logical indicating whether or not the observed peak is unexpected given the amplicon sequence
signature(x = "MassArrayPeak"): ...
signature(x = "MassArrayPeak"): ...
signature(.Object = "MassArrayPeak"): ...
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
showClass("MassArrayPeak")showClass("MassArrayPeak")
A data structure containing MassArray spectral data for a single sample
Objects can be created by calls of the form new("MassArraySpectrum", sample, rxn, strand, peaks, quality.conversion, quality.spectra, quality.primerdimer, quality.contaminant, quality.adducts, ...).
sample:Sample name
rxn:Cleavage reaction (either 'T' or 'C')
strand:DNA strand for amplicon (either '+' or '-')
peaks:List containing objects of class MassArrayPeak
quality.conversion:Overall level(s) of remnant unconverted cytosines, as measured by one or more conversion controls
quality.spectra:(currently not supported)
quality.primerdimer:(currently not supported)
quality.contaminant:(currently not supported)
quality.adducts:Overall ratio(s) of Na and/or K adduct peak heights to expected peak heights
signature(x = "MassArraySpectrum"): ...
signature(x = "MassArraySpectrum"): ...
signature(.Object = "MassArraySpectrum"): ...
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
showClass("MassArraySpectrum")showClass("MassArraySpectrum")
Function to count the number of peak collisions (i.e. molecular weights are indistinguishable given the specified resolution)
numCollisions(peaks, resolution = 0.5)numCollisions(peaks, resolution = 0.5)
peaks |
Numerical list of molecular weights (in Da) corresponding to a set of peaks |
resolution |
Resolution (in Da), used to specify the ability to distinguish two different molecular weights. For a resolution of 0.5 (default), two molecular weights are considered identical if they are less than 0.5 Da apart. |
Returns a list of peak collision counts for each peak in the original list.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
numCollisions(1:5, 1.5)numCollisions(1:5, 1.5)
Function to generate graphical output for methylation data in a MassArrayData object
## S3 method for class 'MassArrayData' plot(x, ..., collapse = TRUE, bars = TRUE, scale = TRUE, sequence = TRUE, labels = TRUE, colors = TRUE, main = position(x), width = 1.5)## S3 method for class 'MassArrayData' plot(x, ..., collapse = TRUE, bars = TRUE, scale = TRUE, sequence = TRUE, labels = TRUE, colors = TRUE, main = position(x), width = 1.5)
x |
Object of class |
... |
Other arguments to plot, currently not supported at this time |
collapse |
Logical specifying whether or not to combine samples by unique |
bars |
Logical specifying whether or not to display error bars. If |
scale |
Logical specifying whether or not to keep the x axis to scale. If |
sequence |
Logical specifying whether or not to display the nucleotide sequence for the amplicon |
labels |
Logical specifying whether or not to display data labels |
colors |
Logical specifying whether or not to plot in color. If |
main |
Label/title for overall plot (default is |
width |
Numerical value specifying the display width to use for each methylation value; number corresponds to the number of base pairs to include in both directions from the methylation position (default is |
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
data(MassArray.example.data) plot(MassArray.example.data,collapse=FALSE,bars=FALSE,scale=FALSE)data(MassArray.example.data) plot(MassArray.example.data,collapse=FALSE,bars=FALSE,scale=FALSE)
Function to access (and/or assign) positional information for a MassArrayData object
position(object) position(object) <- valueposition(object) position(object) <- value
object |
Object of class |
value |
Character string containing positional information of the form "chrXX:XXXX-XXXX" |
Returns a character string containing positional information of the form "chrXX:XXXX-XXXX" if accessing a MassArrayData object. If updating a MassArrayData object, function returns the object with updated positional information
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also MassArrayData
data(MassArray.example.data) position(MassArray.example.data) position(MassArray.example.data) <- "chrB:2001-2374" position(MassArray.example.data)data(MassArray.example.data) position(MassArray.example.data) position(MassArray.example.data) <- "chrB:2001-2374" position(MassArray.example.data)
Methods to access (and/or assign) positional information for a MassArrayData object
Access positional information for MassArrayData object
Handle empty function call, simply return the MassArrayData object
Assign position of MassArrayData object to value
Function to find the reverse complement
revComplement(x)revComplement(x)
x |
sequence input to use for reverse complement. |
Returns the reverse complement of a character string or MassArrayData object, depending upon input data type.
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
revComplement("AATCCGGGGGAA")revComplement("AATCCGGGGGAA")
Methods for reverse complement
Finds reverse complement of a MassArrayData object, a function that consists of altering sequence, strand, fragmentation, and methylation data
Calculates reverse complement from nucleotide sequence as character input
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
Function to perform an in silico RNAse A digest for either the T or C cleavage reactions
rnaDigest(sequence, type = c("T", "C"))rnaDigest(sequence, type = c("T", "C"))
sequence |
Nucleotide sequence input |
type |
One of either 'T' or 'C', specifying which cleavage reaction mixture was used |
Returns a list of MassArrayFragment objects, each containing information about a given fragment generated by the RNA digest
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also as MassArrayFragment
rnaDigest("AAAACCCCCTGCGGAGAGAGGCCGACAAAA", type="T")rnaDigest("AAAACCCCCTGCGGAGAGAGGCCGACAAAA", type="T")
Function to access (and/or assign) sample name information for a MassArrayData object
samples(object) samples(object) <- valuesamples(object) samples(object) <- value
object |
Object of class |
value |
List of character strings containing sample name information, one for each sample contained in the |
Returns a list of character strings containing sample name information for each sample in MassArrayData object. If updating a MassArrayData object, function returns the object with updated sample name information
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also as MassArrayData
data(MassArray.example.data) samples(MassArray.example.data) samples(MassArray.example.data)[2] <- "SECOND" samples(MassArray.example.data)data(MassArray.example.data) samples(MassArray.example.data) samples(MassArray.example.data)[2] <- "SECOND" samples(MassArray.example.data)
Methods to access (and/or assign) sample name information for a MassArrayData object
Access sample name information for MassArrayData object
Handle empty function call, simply return the MassArrayData object
Assign sample name of MassArrayData object to value
Function to collapse multiple MassArraySpectrum objects into a single MassArraySpectrum representing the sum of each
## S3 method for class 'MassArraySpectrum' sum(x, ..., trim = 0, na.rm = TRUE)## S3 method for class 'MassArraySpectrum' sum(x, ..., trim = 0, na.rm = TRUE)
x |
One or multiple MassArraySpectrum objects to include in sum |
... |
Any additional MassArraySpectrum objects to include in sum |
trim |
Numerical value between 0 and 0.5 specifying the proportion of spectra to remove from consideration on a per peak basis, such that the SNR of each peak is calculated as the trimmed mean of the same peak across all included spectra. |
na.rm |
Logical value passed to |
Returns a single MassArraySpectrum object that represents the union of all unique peaks from the component MassArraySpectrum objects, with SNR for each peak representing the average value of that peak across all spectra
Reid F. Thompson ([email protected]), John M. Greally ([email protected])
See Also as MassArraySpectrum
data(MassArray.example.data) MassArray.example.data$samples[[1]]$peaks[[11]]$height MassArray.example.data$samples[[1]] <- sum.MassArraySpectrum(MassArray.example.data$samples[[1]], MassArray.example.data$samples[[2]]) MassArray.example.data$samples[[1]]$peaks[[11]]$heightdata(MassArray.example.data) MassArray.example.data$samples[[1]]$peaks[[11]]$height MassArray.example.data$samples[[1]] <- sum.MassArraySpectrum(MassArray.example.data$samples[[1]], MassArray.example.data$samples[[2]]) MassArray.example.data$samples[[1]]$peaks[[11]]$height